page 1 of 41 diabetes · 08/03/2016 · streptavidin-binding peptide (sbp) (adeno-pctap-macam)...
TRANSCRIPT
Page 1 of 41 Diabetes
Diabetes Publish Ahead of Print, published online March 8, 2016
The anti-obesity action of ACAM by modulating the dynamics of cell adhesion
and actin polymerization in adipocytes
Kazutoshi Murakami1, 2, Jun Eguchi1, Kazuyuki Hida1, Atsuko Nakatsuka1, Akihiro
Katayama1, Miwa Sakurai3, Haruki Choshi1, Masumi Furutani4, Daisuke Ogawa3, Kohji
Takei5, Fumio Otsuka2, and Jun Wada1
Department of Nephrology, Rheumatology, Endocrinology and Metabolism1, Department of
General Medicine2, Department of Diabetic Nephropathy3, Central Research
Laboratory4, Department of Biochemistry5, Okayama University Graduate School of
Medicine, Dentistry and Pharmaceutical Sciences, Okayama 700-8558, Japan
Running title: Adipocyte adhesion molecule (ACAM) in obesity
Correspondence:
Jun Wada, MD, PhD Department of Nephrology, Rheumatology, Endocrinology and Metabolism Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences 2-5-1 Shikata-cho, Okayama 700-8558, Japan Tel: +81-86-235-7235 FAX: +81-86-222-5214 E-mail: [email protected]
Page 2 of 41Diabetes
2
Summary
Coxsackie- and adenovirus receptor-like membrane protein (CLMP) was identified as the
tight junction-associated transmembrane protein of epithelial cells with homophilic binding
activities. CLMP is also recognized as adipocyte adhesion molecule (ACAM) and it
upregulated in mature adipocytes in rodents and human with obesity. Here, we present aP2
promoter-driven ACAM transgenic mice are protected from obesity and diabetes with the
prominent reduction of adipose tissue mass and smaller size of adipocytes. ACAM is
abundantly expressed on plasma membrane of mature adipocytes and associated with
formation of Phalloidin-positive polymerized form of cortical actin (F-actin). By electron
microscopy, the structure of zonula adherens with an intercellular space of ~10-20 nm was
observed with strict parallelism of the adjoining cell membranes over distances of 1 to 20 µm,
where ACAM and γ-actin are abundantly expressed. The formation of zonula adherens may
increase the mechanical strength, inhibit the adipocyte hypertrophy, and improve the insulin
sensitivities.
Page 3 of 41 Diabetes
3
INTRODUCTION
Quite a few adhesion molecules have been identified by molecular genetics as well as
gene expression profile studies in adipocytes derived from experimental models and human
studies. For instance, only cadherins were reported to be expressed in premature
adipocytes. In the cell lines, such as C3H10T1/2 and 3T3-L1 cells, N-cadherin and
cadherin-11 are expressed and they are prominently suppressed by the induction of
adipocyte differentiation and downregulated to very low levels after the full differentiation(1).
Transgenic expression of dominant-negative N-cadherin decreased bone formation,
delayed acquisition of peak bone mass and increased body fat(2). Although the information
of adhesion molecules in adipocyte biology is limited, we identified adipocyte adhesion
molecule (ACAM) from the visceral adipose tissues of OLETF (Otsuka Long-Evans
Tokushima fatty) rats by PCR-based cDNA suppressive subtraction methods(3). Mouse
ACAM was independently identified as adipocyte-specific protein 5 (ASP5) from 3T3-L1
cells by using signal sequence trap by a retrovirus-mediated expression screening
method(4). Human ACAM had been identified as coxsackie virus and adenovirus
receptor-like membrane protein (CLMP) by bioinformatics approaches and Raschperger et
al. demonstrated that CLMP is a component of the tight junction of epithelial cells and
colocalized with ZO-1 (zonula occludens-1)(5). ACAM/CLMP belongs to CTX (cortical
thymocyte marker in Xenopus) and they are characterized by extracellular variable (V-type)
and constant (C2-type) immunogloburin domains, which are involved in the homophilic
adhesion and aggregation of the cells. Although we reported the expression of ACAM
increased in mature adipocytes in genetically obese db/db and diet-induced obesity mice,
and also in adipose tissues in the subjects with obesity, the functional role of ACAM in
mature adipocytes and in obesity remained totally unknown. Here, we generated aP2
promoter-driven ACAM transgenic mice and they are protected from obesity and diabetes
with reduced accumulation of white and brown adipose tissues. In ACAM Tg mice under
Page 4 of 41Diabetes
4
high-fat high-sucrose (HFHS) chow, ACAM is abundantly expressed on plasma membranes
of mature adipocytes, where the zonula adherens-like structure is formed. The adhesion
process and formation of zonula adherens are associated with the formation of actin
polymerization on the surface of the mature adipocytes. The formation of zonula adherens
may increase the mechanical strength, inhibit the adipocyte hypertrophy, alter the signaling
events, and improve the insulin sensitivities. Our finding provides the new therapeutic
modalities targeting the processes of cell adhesion and actin polymerization of adipocytes in
the treatment of obesity and diabetes.
RESEARCH DESIGN AND METHODS
Generation of ACAM transgenic mice: β-globin intron and human GH poly A signal were
ligated into BamHI-EcoRI and EcoRI-XhoI sites of pcDNA3.1Zeo vector (Invitrogen),
respectively (Figure S1a). Coding region of mouse ACAM cDNA was inserted into EcoRI
site by blunt end ligation after filling-in reaction. BamHI and XhoI fragment was subjected to
blunt end ligation into SmaI site of pBluescript SKII(+) (Stratagene), in which mouse aP2
promotor was inserted into EcoRV-PstI site by blunt end ligation. The insert was excised
with HindIII and NotI and transgene was generated. Microinjected C57BL/6JJcl one-cell
stage zygotes were oviduct-transferred and permitted to develop to term. Three transgenic
founders were obtained and Southern blot analysis was performed using EcoRI and SmaI
fragment of the transgene. Genotyping of Tg mice was performed by PCR using primers
5’-GACATTGAATGGCTGCTCACCG-3’ and 5’-GCTCTGCACATACTGTACAGTC-3’;
5’-GTTGGAACGCTGGGAACTCACACTGAGATC-3’ and
5’-GGTTCAGAACCTCTCACTTCCGGTCCTATG-3’.
Animals: Male C57BL/6JJcl mice were housed in cages and maintained on a 12-hour
light-dark cycle. For the animal experiments with mice, standard chow (NMF; Oriental Yeast)
and high fat-high sucrose (HFHS) diet (D12331; Research Diet) were used and the mice
Page 5 of 41 Diabetes
5
were sacrificed at 30 weeks of age. Oxygen consumption was measured using O2/CO2
metabolism measuring system (MK-5000, Muromachi). All animal experiments were
approved by the Animal Care and Use Committee of the Department of Animal Resources,
Advanced Science Research Center, Okayama University. Liver triglyceride was measured
by Folch’s method (Skylight Biotech, Tokyo).
Cell culture and adipocyte differentiation: Mouse 3T3-L1 fibroblasts (ATCC; American
Type Culture Collection) were cultured in vitro and differentiated into mature adipocytes.
3T3-L1 cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM) (Sigma)
supplemented with 10 % calf serum (Hyclone), 100 U/ml penicillin, and 0.1 mg/ml
streptomycin (Sigma). Confluent cells were induced to differentiate by the addition of 0.5
mM 1-methyl-3-isobutylxanthine (IBMX), 0.25 µM dexamethasone (DEX), and 10 µg/ml
insulin (INS) (Sigma). After 48 hours, induction medium was removed and cells were
cultured with DMEM supplemented with 10 % fetal bovine serum (Invitrogen) and 10 µg/ml
insulin for 14 days. To determine the major inducer for ACAM expression, the confluent
preadipocytes were treated with DEX/IBMX/INS, DEX, IBMX, INS, DEX/IBMX, IBMX/INS,
DEX/INS, fetal bovine serum (FBS), pioglitazone (PIO), DEX/IBMX/INS/PIO,
8-bromoadenosine-cAMP (8-br-cAMP) (Calbiochem), or forskolin (Sigma) at the
concentrations indicated. In separate experiments, confluent preadipocytes were
preincubated with H89 (Sigma), SB203580 (Calbiochem), PD98059 (Calbiochem), and
LY294002 (Sigma) for 30min, respectively, in prior to induction of differentiation.
Poly (A+) RNA analysis of various tissues: For quantitative real time PCR analysis in
various tissues in mice, cDNA synthesized from 2 µg total RNA was analyzed in a Sequence
Detector (model 7900; Applied Biosystems) with specific primers and SYBR Green PCR
Master (Applied Biosystems). The relative abundance of mRNAs was standardized with
36B4 mRNA as the invariant control. The mRNA expression was determined by SYBR
Page 6 of 41Diabetes
6
green. Gene specific primers are indicated in Table S1.
RNA isolation and Northern blot analyses of 3T3-L1 cells: Total RNA was isolated from
3T3-L1 cells by using RNeasy Lipid Tissue Mini Kit (Qiagen). For Northern blot analysis, 10
µg total RNAs were subjected to 2.2 M formaldehyde 1% agarose gel electrophoresis and
capillary transferred to the Hybond XL nylon membranes (GE Healthcare Life Sciences).
The membranes were hybridized with [α-32
P]dCTP-radiolabeled mouse ACAM, mouse
C/EBPβ, mouse C/EBPδ, mouse C/EBPα, mouse PPARγ, mouse LPL and mouse 18S
ribosomal RNA (ATCC) cDNAs at 68oC in ExpressHyb
TM Hybridization Solution (Clontech)
for 1 hour. Filters were washed at high stringency conditions, i.e. four times in 1 X SSC/0.1%
SDS at 20oC, followed by two times at 50
oC in 0.1 X SSC/0.1% SDS.
Antibodies: Sheep polyclonal anti-ASAM (ACAM) (R&D systems), rat monoclonal
anti-F4/80 (Cl:A3-1) (AbD Serotec), rabbit polyclonal anti-nonmuscle myosin heavy chain
II-A (Covance), mouse monoclonal anti-γ-actin (Sigma) antibodies were used for
immunoblotting, immunofluorescence and immunogold studies. For secondary antibodies,
rabbit anti-sheep IgG, HRP conjugated (Millipore), Alexa Fluor 594 donkey anti-sheep IgG
(H+L), Alexa Fluor 488 goat anti-rat IgG (H+L), and Alexa Fluor 488 chicken anti-rabbit IgG
(H+L) (Invitrogen) were used.
LC-MS/MS (high performance liquid chromatography-tandem mass spectrometry)
and MALDI-TOF/MS (matrix assisted laser desorption/ionization): Recombinant
full-length of mouse ACAM tagged with calmodulin-binding peptide (CBP) and
streptavidin-binding peptide (SBP) (Adeno-pCTAP-mACAM) (InterPlay Mammalian TAP
system, Stratagene) were prepared by Adenovirus Expression Kit (Takara).
Adeno-pCTAP-mACAM was introduced to 3T3-L1 cells. Soluble proteins were purified by
CBP and SBP binding resin (InterPlay Mammalian TAP System, Stratagene) and subjected
Page 7 of 41 Diabetes
7
to SDS-PAGE and Coomassie blue staining. Visible bands were excised and in-gel-digested
with trypsin and analyzed with LC-MS/MS and MALDI-TOF/MS.
Cell fractionation of cultured 3T3-L1 cells: 3T3-L1 cells at 24 hours after the induction
were fractioned. Cells were washed in PBS and resuspended in suspension buffer (20mM
Tris-HCl; PH7.4, 1mM EDTA, 255mM sucrose) containing protease inhibitor cocktail (Sigma)
and homogenized with pre-cooled motor-driven Potter-Elvehjem grinder with 20 strokes at
1400 rpm. Nuclei were pelleted by centrifugation at 1,000g for 10min. The post-nuclear
supernatant (S1) was centrifuged at 16,000g for 20min. The pellet containing mitochondria,
peroxisomes and plasma membrane fractions was resuspended in 5 ml of resuspension
buffer and layered onto 5 ml of sucrose cushion (1.12 M sucrose, 1 mM EDTA, 20 mM
Tris-HCl; PH7.4) and centrifuged at 101,000g for 25 min. The mitochondria and
peroxisomes were collected as a pellet and resuspended in suspension buffer. The plasma
membrane was collected at the interface, resuspended in 10 ml of suspension buffer,
centrifuged 16,000g for 15min and resuspended in suspension buffer. S1 was centrifuged at
48,000g for 20min and the pellet containing high density microsomes (HDM) was obtained.
The supernatant was centrifuged at 212,000g for 70 min, separated the pellet containing low
density microsomes (LDM) and the supernatant containing the cytosol. Pellets from
fractions containing HDM and LDM were resuspended in suspension buffer.
Immunoelectron microscopy: Adipose tissues and 3T3-L1 cells were fixed with 4%
paraformaldehyde and 0.05% glutaraldehyde in 0.01 M phosphate buffer, pH 7.4, for 30
minutes and then scraped from the dish, and a pellet was prepared with a microfuge. The
tissues and cell pellets were then dehydrated in a graded series of ethanol and they were
embedded and polymerized in LR-White (Polysciences, Inc.) at 50oC for 48 hours.
Approximately 60-nm thin sections were picked up 300 mesh nickel grid. The sections were
pretreated with 20 mM Tris-buffered saline, pH 8.2, containing 0.25% bovine serum albumin.
Page 8 of 41Diabetes
8
They were incubated with anti-ACAM antibody and then with anti-sheep IgG conjugated with
10 nm colloidal gold particles for 4 hours at room temperature. They were washed with
Tris-buffered saline and stained with lead citrate and uranyl acetate and examined by an
electron microscope at accelerating voltage of 75 kv. Transmission and scanning electron
microscopy was performed as previously described(6).
Adenoviral vectors and infection: The adenoviral vector encoding constitutively active
form of C/EBPβ (LAP) were generously provided by Prof. Hiroshi Sakaue (Tokushima
University, Tokushima, Japan). For adenoviral infection, 3T3-L1 preadipocytes cultured to
90% confluency and were infected at a multiplicity of infection of 10 PFU/cell 48 hours
before induction of differentiation(7). The cells were collected at indicated time points and
were subjected to Northern blot analysis. As a control, the adenoviral vector encoding LacZ
(LacZ) was used.
Plasmid constructs and luciferase reporter assay: The ACAM 1869 bp (-1741 to +128)
luciferase plasmid was generated by ligating into the cloning site of the promorterless
luciferase reporter plasmid pGL3-Basic (Promega). Various 5’-deletion constructs -1341,
-584, -464, -235, -97, -79, -57 were made. The mutant constructs of promoter sequence
using -79 deletion construct: wild type (-72 to -59), 5’-AGCTAACCCCAAAC-3’; mutant 1
(MT1), 5’-AGCTAACAATGGCC-3’; and mutant 2 (MT2), 5’-AGCTAAACCCGAAC-3’, were
generated by PCR. 3T3-L1 preadipocytes were transfected using Neon electroporation
transfection system (Invitrogen). Transfections were performed using 10 µg of pBIND
(Renilla luciferase)-SV40 (internal control) along with 10 µg pGL3-Basic plasmids containing
the ACAM promoter or with pGL3-Basic plasmid. 48 hours after transfection, cells were
incubated with 0.5 mM IBMX for 6 hours, and luciferase reporter assays were performed
using the Dual Luciferase Reporter Assay System (Promega). Transfection efficiencies were
normalized to the Renilla luciferase activity. For the CMV-promoter-driven transient
Page 9 of 41 Diabetes
9
overexpression of Kruppel-like factor 4 (KLF4), GATA binding protein 1 and GATA binding
protein 6, EX-Mm19461-M02 (pReceiver-M02), EX-Mm02659-M02 (pEZ-M02) and
EX-Mm02664-M02 (pEZ-M02) (Genecopia, OmicsLink Expression Clone) were used,
respectively. For negative control, EX-NEG-M02 (pReceiver-M02CT) was used.
Statistical analysis: Data are expressed as the mean ± standard error (SE) and the
multiple comparisons were performed by a one-way ANOVA with Bonferroni and Tukey
corrections. A value of P < 0.05 was regarded as statistically significant. The data were
analyzed using the IBM SPSS Statistics software program (IBM).
RESULTS
ACAM Tg mice are protected from obesity: Three independent aP2-driven ACAM
transgenic lines of C57BL/6JJcl mice were established (Figure S1a). The copy numbers of
transgenes differed in L11 (high-), L22 (intermediate-), and L4 (low-expression) lines and the
protein expression of ACAM in both epididymal and subdermal fat tissues corresponded to
the copy numbers of transgene (Figure S1b). Under HFHS chow, mRNA expression of
ACAM was significantly augmented in epididymal, subdermal and brown adipose tissues,
and not in liver and skeletal muscle (Figure S1c). The body weight gains under HFHS chow
were prominently reduced in ACAM Tg mice in parallel with the expression of ACAM (Figure
S1d-f). Throughout the following experiments, intermediate-expression (L22) line was
employed, since the mice derived from high-expression (L11) line were completely protected
from obesity and the reduction of body weight may dominantly influence the phenotype such
as improvement of glucose metabolism. In ACAM Tg mice, the body and fat pad weight was
significantly reduced under HFHS chow compared with WT mice (Figure 1a and 1b) and
the adipocyte size was also significantly reduced (Figure 1c-e). In ACAM Tg mice, the
immunoreactivity of ACAM was enhanced on the cell surface of adipocytes in both
Page 10 of 41Diabetes
10
immunofluorescence and immunoperoxidase studies (Figure 1f). The staining of ACAM
merged with F4/80 and the adipose tissue macrophages abundantly expressed ACAM
(Figure 1g). Both glucose tolerance and insulin sensitivity were significantly improved in
ACAM Tg mice under HFHS chow (Figure 2a-c) and serum small-sized LDL cholesterol
was significantly reduced compared with WT mice (Figure 2d). In contrast, the lipid droplets
in liver tissue, liver weight and triglyceride content were not altered in ACAM Tg mice under
HFHS chow (Figure 2e-g). The data suggested that ACAM Tg mice are protected from
obesity and insulin resistance.
Although the locomotor activity, food intake, and respiratory quotient (RQ) were not
altered in ACAM Tg mice under HFHS chow, the weight of brown adipose tissues was
significantly reduced in ACAM Tg mice under HFHS chow compared with WT mice (Figure
3a-3d). The light and electron microscopy demonstrated that lipid droplets were prominently
reduced in ACAM Tg mice under HFHS chow in brown adipose tissues (Figure 3d). The
oxygen consumption rate was significantly elevated in both dark and light periods in ACAM
Tg mice under HFHS chow (Figure 3e-g). Quantitative RT-PCR demonstrated that lipid
metabolism- (Fabp4, Acaca, Fasn, Lpl, Hsd11b1, Slc27a1), inflammation- (Adipoq, Cd36,
Retn), and glucose metabolism-related genes (Hk1, Slc2a4) significantly increased in ACAM
Tg mice compared with WT mice (Figure 4a). In brown adipose tissues, the gene
expression of Ucp1 and Cpt1a significantly increased in ACAM Tg mice compared with WT
(Figure 4c). In contrast, most of the genes expressed in subdermal adipose tissues, skeletal
muscle and liver were not altered in ACAM Tg mice under HFHS chow (Figure 4b, 4d-e).
Taken together, the overexpression of ACAM in adipocytes directly altered the biological
functions of adipose tissues in the status of obesity and it increased brown fat activity. We
also checked conversion of white to bright/beige adipocyte in subdermal WATs; however, we
did not observe such browning in the tissues (Figure S1g).
ACAM is differentially expressed in 3T3-L1 adipocytes: To explore the function of ACAM
Page 11 of 41 Diabetes
11
in adipocytes, we next investigated the mRNA expression during the 3T3-L1 adipocyte
differentiation. ACAM mRNA revealed the first peak at 6 hours after induction, i.e. the early
stage of differentiation, and down-regulated within 48 hours, which coincided with the
induction of Cebpb and Cebpd (Figure 5a and S2a). At 14 days, ACAM mRNA
demonstrated the second peak following the appearance of adipocyte maturation markers,
such as Cebpa, Pparg and Lpl (Figure 5b and S2b). By the fractionation of the 3T3-L1 cells,
ACAM localized mainly in the plasma membrane (PM) fraction, lesser extent in low-density
microsome (LDM) and high density microsome (HDM) fractions (Figure 5c and S2c).
Western blot analyses demonstrated the up-regulation of ACAM after the induction of
differentiation (Figure S2d). Adeno-pCTAP-mACAM was introduced to 3T3-L1 cells, soluble
proteins purified by CBP and SBP binding resin, and finally subjected to SDS-PAGE and
Coomassie blue staining (Figure 5d). Visible bands were excised and in-gel-digested with
trypsin and analyzed with LC-MS/MS and MALDI-TOF/MS, myosin II-A and γ-actin were
identified, respectively. We next confirmed the complex formation of ACAM and γ-actin by
the immunoprecipitation using 3T3-L1 cells (Figure 5e). Before the induction and at the
early stage of differentiation, ACAM expressed mainly on the cell processes of 3T3-L1 cells
revealed by immunofluorescence and immunogold studies (Figure 5f, 5g and 5h). Before
the induction, ACAM did not colocalized with myosin II-A; however, it merged with myosin
II-A concentrated on the cell surface as well as perinuclear cytosol when 3T3-L1 cells fully
differentiated to the mature adipocytes (Figure 5g).
We then searched the critical inducers for the up-regulation of ACAM mRNA expression.
The induction with IBMX or its combination with other inducers up-regulated ACAM mRNA
levels; the effects were almost comparable with DEX/IBMX/INS stimulation (Figure S3a).
IBMX induced ACAM mRNA expression in a dose- and time-dependent manner and it
peaked at 6 hours in the presence of 500 nM IBMX (Figure S3b and S3c). IBMX is known
to inhibit phosphodiesterases, stimulate adenyl cyclase activity, and increase the
intracellular cAMP accumulation(8). Both 8-br-cAMP and forskolin, a cAMP elevating agent,
Page 12 of 41Diabetes
12
up-regulated ACAM mRNA levels in a dose dependent manner (Figure S3d and S3e). It is
also known that cAMP stimulates protein kinase A (PKA) activity(9) and ACAM mRNA
expression was reduced by specific PKA inhibitor (H89) in a dose-dependent manner
(Figure S3f). In contrast, SB203580 (p38 kinase inhibitor), PD98050 (MEK inhibitor), and
LY294002 (PI-3 kinase inhibitor) demonstrated no effects on IBMX-induced expression of
ACAM mRNA (data not shown).
The transcriptional regulation of ACAM mRNA seems to be dependent on IBMX-PKA
pathway, which is a known inducer of C/EBPβ(10). We found 13 consensus C/EBPβ-binding
sites by analyzing the -1741-bp ACAM promoter region (Figure S4a) and observed ~8-fold
induction of luciferase activities in -584, -464, -235, -97, -79 ACAM promoter constructs by
the treatments of IBMX or adenoviral vector encoding active form C/EBPβ (LAP,
liver-enriched activator protein) (Figure S4b and 4c). Possible C/EBPβ-binding consensus
site between -72 and -59, AGCTAACCCCAAAC, was mutated by using -79 ACAM promoter
construct to produce -79 (MT1) and -79 (MT2) ACAM promoter constructs (Figure S4a),
which resulted in a loss of transactivation induced by IBMX and LAP. KLF4 has been
reported to induce adipocyte differentiation by activating C/EBPβ. KLF4-expressing
plasmids in the combination with GATA1 and/or GATA6-expressing plasmids synergistically
enhanced luciferase activity using -79 ACAM promoter construct (Figure S4d).
ACAM promotes the polymerization of actin and forms zonula adherens in
adipocytes: We investigated the expression of ACAM and polymerized form of actin
(F-actin) by Phalloidin staining. In WT mice under HFHS chow, both F-actin and ACAM were
faintly stained surrounding the adipocytes in epididymal adipose tissues, while they
colocalized and accentuated in a patchy fashion on the adipocytes (Figure 6a-b). In WT
mice, the distance of plasma membranes between adjacent adipocytes was ~100-200 nm in
WT mice under HFHS chow (Figure 6C). In ACAM Tg mice under HFHS chow, we observed
the zone with an intercellular space of ~10-20 nm, the structure of zonula adherens (Figure
Page 13 of 41 Diabetes
13
6c, S5a, S7, black arrows). The zonula adherens was continuous and characterized by strict
parallelism of the adjoining cell membranes over distances of 1 to 20 µm (Figure S6 and
S7). The intercellular space was occupied by homogeneous and amorphous material of low
density, and conspicuous bands of dense material located in the subjacent cytoplasmic
matrix. In the zonula adherens, two layers of plasma membrane joined in a linear and
parallel pattern but they also demonstrated invagination or engulfment (Figure 6c, S5a and
S6, white arrows). The zonula adherens was associated with immunogold particles when
the sections were stained with γ-actin or ACAM-specific antibodies (Figure 6d and S5b,
arrows). In brown adipose tissues in ACAM Tg mice under HFHS chow, similar structures of
zonula adherens was observed and immunogold particles associated with ACAM were
demonstrated along the zonula adherens (Figure S8). The ACAM-mediated homophilic
adhesion of adipocytes and formation of zonula adherens promoted the actin polymerization.
The formation of zonula adherens inhibited the adipocyte hypertrophy by actin
polymerization, which resulted in the improvement of obesity and insulin resistance.
DISCUSSION
In 3T3-L1 adipocytes, IBMX is major inducer of ACAM mRNA expression and it is a
known inducer of C/EBPβ. We identified C/EBPβ binding sites in the promoter regions of
ACAM gene and luciferase-reporter gene assay demonstrated the promoter activities were
enhanced by C/EBPβ expressed by LAP. KLF4 functions as an immediate early regulator of
adipogenesis to induce C/EBPβ(11) and KLF4, GATA1 and GATA6 has been reported to
enhance the transcriptional activity of ACAM gene in Sertoli cells(12). In current study, we
demonstrated that the promoter activities in luciferase assay were further enhanced by the
expression of KLF4, GATA1 and GATA6 and they are the critical coactivator of the
transcription of the ACAM gene. Immunofluorescence and immunogold studies
demonstrated the presence of ACAM at the cell processes of the 3T3-L1 cells and we
Page 14 of 41Diabetes
14
speculate that ACAM may serve the heterophilic binding by interacting with certain
extracellular matrix (ECM) glycoproteins and also with cytoskeletal components such as
γ-actin and myosin II-A complex.
The mature adipocytes are surrounded by ECM glycoproteins such as collagens type I,
IV, V, VI, fibronectin and thrombospondin, and ECM environment regulates the adipogenesis
and adipocyte function(13). The remodeling of ECM surrounding the adipocytes takes place
and the basal lamina are thickened in omental adipose tissues of the rats fed with high-fat
diet(14). The administration of matrix metalloproteinase inhibitor, tolylsam, into the mice fed
with a high-fat diet resulted in lower body weight, lower subcutaneous and gonadal adipose
tissue mass(15). Thus, the peri-adipocyte ECM remodeling is tightly related to the
adipogenesis, tissue inflammation, fibrosis, insulin sensitivity and cardiovascular
diseases(13). Since peri-adipocyte ECM plays an important role in adipocyte biology and
the close cell-cell contact of the adipocytes has not been visualized in EM observation, the
role of ACAM in mature adipocytes remains elusive. ACAM/CLMP is expressed in tight
junction of epithelial cells and involved in the development and maintenance of epithelial
cells. Recently, we have developed ACAM knockout mice and ACAM-/-
mice demonstrate
the elongation of small intestine, dilatation of bronchi, and formation of huge renal cysts
(submitted).
The presence of functional gap junction in cultured osteoblasts and adipocytes was
demonstrated; the inhibition of gap junctional communication by 18-α-glycyrrhetinic acid
(AGRA) blocks the maturation of pre-osteoblastic cells and converts to an adipogenic
phenotype(16). The later study further confirmed that the application of gap junction inhibitor
and small interfering RNA targeting connexin 43 inhibit the mitotic clonal expansion,
expression of Cebpb and adipocyte differentiation(17). Connexin 43 is a membrane
phosphoprotein forming gap junction and phosphorylation of connexin 43 is downregulated
after the induction of adipocyte differentiation. After the downregulation of phosphorylation,
connexin 43 is displaced from the plasma membrane and degraded by proteosomal
Page 15 of 41 Diabetes
15
pathway(18). Thus, gap-junctional intercellular communication is required in mitotic clonal
expansion and adipocyte differentiation. Historically, Farquhar and Palade observed EMs of
various epithelial cells and provided the identification of the zonula occludens (tight junction),
zonula adherens (intermediary junction), and the macula adherens (desmosome)(19). Gap
junction was not delineated from tight junction until the work of Revel and Karnovsky(20),
since extracellular or intermembrane gap is quite similar in tight and gap junctions(21). In
later study, the treatment of samples with uranyl acetate instead of lanthanum established
the presence of a 1.8 nm gap between the outer leaflets of the apposed membranes of gap
junction(21). Although the presence of functional gap junction in adipocytes has been
proved in previous studies, the morphological investigations by EM in adipose tissues has
not been published. We also extensively searched the adipose tissues of WT and ACAM Tg
mice under HFHS chow; however, we could not find the gap junction-like structures by EM.
Instead, we readily recognized zonula adherens with 10-20 nm intercellular space in ACAM
Tg mice under HFHS chow, in which transgenic overexpression of ACAM facilitated the
formation of zonula adherens. Originally, Farquhar and Palade defined zonula adherens by
the presence of an intercellular space (~20 nm) occupied by homogeneous, apparently
amorphous material of low density; by strict parallelism of the adjoining cell membranes over
distances of 0.2 to 0.5 µm; and by conspicuous bands of dense material located in the
subjacent cytoplasmic matrix(19), the observed structures ACAM Tg mice under HFHS
chow exactly corresponded to the definition of zonula adherens.
To further characterize the molecular organization of zonula adherens in adipocytes, we
performed TAP purification and immunoprecipitation studies, and demonstrated that ACAM
interacts with myosin II-A and γ-actin in 3T3-L1 cells. We further confirmed that ACAM and
γ-actin colocalized with zonula adherens observed in adipose tissues of ACAM Tg mice by
immunoelectron microscopy. Coxsackie and adenovirus receptor (CAR) is a homologue of
ACAM with 35% identity and it also interacts and binds to actin(22). CAR is strongly
expressed in developing nervous system, it uniformly expresses on all neural cells at an
Page 16 of 41Diabetes
16
initial stage, and it downregulates and then restricts to axonal and dendritic surface at more
advanced stages(23). The membrane proximal Ig domain of CAR binds to a fibronectin
fragment and is involved in the heterophilic interactions, while two extracellular Ig domains
are involved in the homophilic interactions of CAR(23). Similarly, ACAM is localized on the
cell processes of preadipocytes, down-regulates after differentiation, and it re-distributes on
the plasma membrane of 3T3-L1 cells. In mature adipocytes in ACAM Tg mice, ACAM
colocalized with polymerized actin concentrated on the area of zonula adherens. Recently,
the actin cytoskeleton dynamics of polymerization and depolymerization cycles have been
reported to drive the adipocyte differentiation. Adipogenic stimuli downregulate RhoA-ROCK
signaling, induce the disruption of actin stress fibers, and result in the conversion to the
monomeric globular-actin (G-actin). The binding G-actin to MKL1 (megakaryoblastic
leukemia 1) inhibits the nuclear translocation of MKL1, the reduction of MKL1 in nuclei
activates the transcriptional activity of Pparg gene, and it results in adipocyte
differentiation(24). In fully-differentiated adipocytes, cortical F-actin is again formed and it
regulates the insulin-simulated translocation of GLUT4 from intracellular pool to the plasma
membrane. The overexpression of ACAM in transgenic mice prominently facilitates the
formation of cortical F-actin under the HFHS chow. One can speculate that the enhanced
formation of cortical F-actin may increase the mechanical strength per unit area and it
inhibits the adipocyte hypertrophy in the status of obesity induced by HFHS chow. In
addition, the formation of cortical F-actin enhances the translocation of GLUT4 and it may
improve the insulin sensitivity in ACAM Tg mice. We have also generated ACAM knockout
mice; however they were small for age and lethal around 14 weeks and we are unable to
analyze the size of adipocytes (submitted).
In 3T3-L1 preadipocytes, the expression of ACAM is induced by cAMP-PKA-C/EBPβ
pathway and it concentrates on the cellular processes. Once ACAM expression declines
and again appears on cell surface of the full-differentiated 3T3-L1 adipocytes. ACAM Tg
mice are protected from obesity and insulin resistance. The current investigation also
Page 17 of 41 Diabetes
17
provides the evidence that the mature adipocytes develop the zonula adherens with the
molecular organization of ACAM and cortical F-actin in ACAM Tg mice under HFHS chow.
The promotion and maintenance of cortical F-actin by targeting ACAM is a candidate for the
new therapeutic modalities in the treatment of obesity and diabetes (Figure S9).
Funding.
This work was supported by JSPS Grant-in-Aid for Scientific Research, Grant numbers
(25126716, 26293218, 26461361, 26461362, and 40620753). KM is supported by The
Okayama Medical Foundation and recipient of Biological Study Award for Encouragement
(Ryobi Teien Memory Foundation).
Duality of Interests.
JW receives speaker honoraria from Astellas, Boehringer Ingelheim, Novartis, Novo Nordisk,
and Tanabe Mitsubishi, and receives grant support from Bayer, Daiichi Sankyo, Kyowa
Hakko Kirin, MSD, Novo Nordisk, Otsuka, Torii, Pfizer, Takeda, Taisho Toyama and
Tanabe Mitsubishi.
Author Contributions.
KM, JE, JW, and KH participated in the design of the whole study. AN, JW, JE, KM, and KH
participated in the generation of ACAM transgenic mice. Cell culture studies were performed
by KM, JE, AN, AK, MS, and HC. Western blot analyses were performed by DO, KT, and FO.
Electron microscopy was performed by MF and JW. KM, KT, FO, and JW and conceived of
the study, participated in coordination, performed the statistical analyses and helped to draft
the manuscript. All authors read and approved the final manuscript. JW takes full
responsibility for the work as a whole, including the study design, access to data, and the
decision to submit and publish the manuscript.
Page 18 of 41Diabetes
18
References
1. Shin CS, Lecanda F, Sheikh S, Weitzmann L, Cheng SL, Civitelli R: Relative abundance of different cadherins defines differentiation of mesenchymal precursors into osteogenic, myogenic, or adipogenic pathways. Journal of cellular biochemistry 2000;78:566-577 2. Castro CH, Shin CS, Stains JP, Cheng SL, Sheikh S, Mbalaviele G, Szejnfeld VL, Civitelli R: Targeted expression of a dominant-negative N-cadherin in vivo delays peak bone mass and increases adipogenesis. Journal of cell science 2004;117:2853-2864 3. Eguchi J, Wada J, Hida K, Zhang H, Matsuoka T, Baba M, Hashimoto I, Shikata K, Ogawa N, Makino H: Identification of adipocyte adhesion molecule (ACAM), a novel CTX gene family, implicated in adipocyte maturation and development of obesity. The Biochemical journal 2005;387:343-353 4. Tsuruga H, Kumagai H, Kojima T, Kitamura T: Identification of novel membrane and secreted proteins upregulated during adipocyte differentiation. Biochemical and biophysical research communications 2000;272:293-297 5. Raschperger E, Engstrom U, Pettersson RF, Fuxe J: CLMP, a novel member of the CTX family and a new component of epithelial tight junctions. The Journal of biological chemistry 2004;279:796-804 6. Makino H, Yamasaki Y, Haramoto T, Shikata K, Hironaka K, Ota Z, Kanwar YS: Ultrastructural changes of extracellular matrices in diabetic nephropathy revealed by high resolution scanning and immunoelectron microscopy. Laboratory investigation; a journal of technical methods and pathology 1993;68:45-55 7. Sakaue H, Ogawa W, Matsumoto M, Kuroda S, Takata M, Sugimoto T, Spiegelman BM, Kasuga M: Posttranscriptional control of adipocyte differentiation through activation of phosphoinositide 3-kinase. J Biol Chem 1998;273:28945-28952 8. Parsons WJ, Ramkumar V, Stiles GL: Isobutylmethylxanthine stimulates adenylate cyclase by blocking the inhibitory regulatory protein, Gi. Mol Pharmacol 1988;34:37-41 9. Chernogubova E, Cannon B, Bengtsson T: Norepinephrine increases glucose transport in brown adipocytes via beta3-adrenoceptors through a cAMP, PKA, and PI3-kinase-dependent pathway stimulating conventional and novel PKCs. Endocrinology 2004;145:269-280 10. Cao Z, Umek RM, McKnight SL: Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev 1991;5:1538-1552 11. Birsoy K, Chen Z, Friedman J: Transcriptional regulation of adipogenesis by KLF4. Cell metabolism 2008;7:339-347 12. Sze KL, Lee WM, Lui WY: Expression of CLMP, a novel tight junction protein, is mediated via the interaction of GATA with the Kruppel family proteins, KLF4 and Sp1, in mouse TM4 Sertoli cells. Journal of cellular physiology 2008;214:334-344 13. Chun TH: Peri-adipocyte ECM remodeling in obesity and adipose tissue fibrosis. Adipocyte 2012;1:89-95 14. Aslan H, Altunkaynak BZ, Altunkaynak ME, Vuraler O, Kaplan S, Unal B: Effect of a high fat diet on quantitative features of adipocytes in the omentum: an experimental, stereological and ultrastructural study. Obesity surgery 2006;16:1526-1534 15. Van Hul M, Lupu F, Dresselaers T, Buyse J, Lijnen HR: Matrix metalloproteinase inhibition affects adipose tissue mass in obese mice. Clinical and experimental pharmacology & physiology 2012;39:544-550 16. Schiller PC, D'Ippolito G, Brambilla R, Roos BA, Howard GA: Inhibition of gap-junctional communication induces the trans-differentiation of osteoblasts to an adipocytic phenotype in vitro. The Journal of biological chemistry 2001;276:14133-14138 17. Yanagiya T, Tanabe A, Hotta K: Gap-junctional communication is required for mitotic clonal expansion during adipogenesis. Obesity 2007;15:572-582 18. Yeganeh A, Stelmack GL, Fandrich RR, Halayko AJ, Kardami E, Zahradka P: Connexin 43 phosphorylation and degradation are required for adipogenesis. Biochimica et biophysica acta 2012;1823:1731-1744
Page 19 of 41 Diabetes
19
19. Farquhar MG, Palade GE: Junctional complexes in various epithelia. The Journal of cell biology 1963;17:375-412 20. Revel JP, Karnovsky MJ: Hexagonal array of subunits in intercellular junctions of the mouse heart and liver. The Journal of cell biology 1967;33:C7-C12 21. Grosely R, Sorgen PL: A history of gap junction structure: hexagonal arrays to atomic resolution. Cell communication & adhesion 2013;20:11-20 22. Huang KC, Yasruel Z, Guerin C, Holland PC, Nalbantoglu J: Interaction of the Coxsackie and adenovirus receptor (CAR) with the cytoskeleton: binding to actin. FEBS letters 2007;581:2702-2708 23. Patzke C, Max KE, Behlke J, Schreiber J, Schmidt H, Dorner AA, Kroger S, Henning M, Otto A, Heinemann U, Rathjen FG: The coxsackievirus-adenovirus receptor reveals complex homophilic and heterophilic interactions on neural cells. The Journal of neuroscience : the official journal of the Society for Neuroscience 2010;30:2897-2910 24. Nobusue H, Onishi N, Shimizu T, Sugihara E, Oki Y, Sumikawa Y, Chiyoda T, Akashi K, Saya H, Kano K: Regulation of MKL1 via actin cytoskeleton dynamics drives adipocyte differentiation. Nature communications 2014;5:3368
Page 20 of 41Diabetes
20
FIGURE LEGENDS
Figure 1 ACAM transgenic (Tg) mice are resistant to obesity. a. Wild type (WT) and
ACAM Tg male C57BL/6JJcl mice were fed with high fat-high sucrose (HFHS) and standard
(STD) chow. b. Fat pad weight of WT and ACAM Tg mice at 30 weeks of age. c. The
average size of adipocytes in epididymal adipose tissues of WT and ACAM Tg mice under
HFHS diet. The size distribution of adipocytes (d), Periodic acid-Schiff (PAS) staining (e. left
panels) and scanning electron micrographs (e. right panels), immunofluorescence (f. left
panels) and immunoperoxidase (f. right panels) staining of ACAM, and double
immunofluorescence staining of F4/80 and ACAM (g) in epididymal adipose tissues of WT
and ACAM Tg mice under HFHS diet. All data are presented as mean ± standard error (SE).
n=8. *p<0.05 vs. WT mice.
Figure 2 Glucose tolerance and insulin sensitivity are improved in ACAM Tg mice. a.
Glucose tolerance test by intraperitoneal injection of glucose in WT and ACAM Tg mice
under STD and HFHS diet. Glucose tolerance was improved in ACAM Tg mice under STD
and HFHS chow. Insulin tolerance test. Insulin sensitivity was improved in ACAM Tg mice
under HFHS (b) but not under STD (c) chow. d. Serum cholesterol levels of lipoprotein
fractions separated by High-performance liquid chromatography (HPLC) at 25 weeks of age.
e. PAS and Oil Red O staining of liver tissues in WT and ACAM Tg mice under HFHS chow.
There were no significant differences in both liver weight (f) and triglyceride contents (g). All
data are presented as mean ± SE. n=8. *p<0.05 vs. WT mice.
Figure 3 Oxygen consumption rate increases in ACAM Tg under HFHS chow.
Locomotor activities (a), food intake (b), and respiratory quotient (RQ) (c) were not altered in
WT and ACAM Tg mice fed with HFHS and STD chow. d. The weight of brown adipose
tissues was significantly reduced in ACAM Tg mice compared with WT mice under HFHS
Page 21 of 41 Diabetes
21
chow. The size of lipid droplets was prominently reduced in ACAM Tg mice demonstrated by
light and electron microscopy. e-g. Oxygen consumption rate (V・
O2) was significantly
increased in ACAM Tg mice during both dark and light periods compared with WT mice
under HFHS chow. All data are presented as mean ± SE. n=8. *p<0.05 vs. WT mice.
Figure 4 Quantitative RT-PCR for genes related to glucose and lipid metabolism in
various tissues in WT and ACAM Tg mice under HFHS chow. a. Epididymal adipose
tissues. Many genes, such as Fabp4, Acaca, Fasn, Lpl, Hsd11b1, Slc27a1, Adipoq, Cd36,
Retn, Hk1 and Slc2a4, were upregulated in ACAM Tg mice compared with WT mice under
HFHS chow. b. Subdermal adipose tissues. c. Brown adipose tissues. Ucp1 and Cpt1a
were up-regulated in ACAM Tg mice compared with WT mice under HFHS chow. d. Skeletal
muscle. e. Liver. All data are presented as mean ± SE. n=4. *p<0.05 vs. WT mice under
HFHS.
Figure 5 ACAM expression is spatio-temporally regulated in the differentiation of
3T3-L1 adipocytes. a and b. ACAM mRNA revealed its peak at 6 hours after the induction
of differentiation and down-regulates within 48 hours. Again, ACAM mRNA expression
up-regulated ~14 days after induction at the late stage of differentiation. c. 3T3-L1 cells at 18
hours after hormonal induction were homogenized and fractionated by sucrose gradient
centrifugation. A protein (40 µg) from each fraction was separated by SDS/PAGE and
immunoblotted using anti-ACAM. Fractions are nucleus (Nuc), mitochondria/peroxisomes
(Mito/Per), plasma membrane (PM), low density microsome (LDM), high density microsome
(HDM), and cytosol (Cyto). d. Adenovirus vector expressing ACAM C-terminal tagged with
calmodulin and streptavidin-binding peptides (Adeno-pCTAP-mACAM) was applied to
3T3-L1 cells and purified products were analyzed by SDS-PAGE. Excised bands were
subjected to in-gel digestion with trypsin, analyzed by LC-MS/MS and MALDI-TOF/MS, and
myosin II-A and γ-actin were identified. e. Immunoprecipitation study. Cell lysates of 3T3-L1
Page 22 of 41Diabetes
22
cells were immunoprecipitated with anti-γ-actin and blotted with anti-ACAM antibodies. f.
Before the induction of adipocyte differentiation (Day 0), ACAM localized on the cell
processes and did not merge with myosin II-A. g. In mature 3T3-L1 adipocytes at 14 days
after the induction (Day 14), ACAM merged with myosin-IIA, and they coloalized on cell
surface. h. The immunogold studies using ACAM antibody demonstrated that they were
preferentially expressed on the cell process of 3T3-L1 cells at 2 days after the induction
(Day 2).
Figure 6 Formation of zonula adherence in ACAM Tg mice associated with ACAM and
γ-actin. a and b. Double immunofluorescence staining of phalloidin and ACAM in WT and
ACAM Tg mice under HFHS chow. F-actin demonstrated by phalloidin staining was faintly
visualized in WT mice. In contrast, F-actin was prominently increased and it merged with
ACAM. c. In WT mice, the distance of plasma membranes between adjacent adipocytes
was ~100-200 nm in WT mice under HFHS chow. In ACAM Tg mice under HFHS chow, the
structure of zonula adherens with an intercellular space of ~10-20 nm was observed (black
arrows). Two layers of plasma membrane joined in a linear and parallel pattern but they also
demonstrated invagination or engulfment (white arrows). d. The zonula adherens in ACAM
Tg mice under HFHS chow was associated with immunogold particles of γ-actin or
ACAM-specific antibodies (black arrows).
Page 23 of 41 Diabetes
297x420mm (300 x 300 DPI)
Page 24 of 41Diabetes
297x420mm (300 x 300 DPI)
Page 25 of 41 Diabetes
297x420mm (300 x 300 DPI)
Page 26 of 41Diabetes
190x275mm (200 x 200 DPI)
Page 27 of 41 Diabetes
190x275mm (220 x 219 DPI)
Page 28 of 41Diabetes
190x275mm (120 x 121 DPI)
Page 29 of 41 Diabetes
Supplementary Figures and Tables
Supplementary Figure S1, related to Figure 1
Production of adipocyte adhesion molecule transgenic (ACAM Tg) mice. a. Schematic
diagram showing structure of transgene consisting of aP2 promotor, β-globin intron, coding
region of ACAM cDNA and hGH polyA tail. EcoRI and SmaI-digested fragment of cDNA was
used for genomic Southern blot analysis. b. Genomic Southern blot analyses of 3 transgenic
lines and Western blot analyses of ACAM in epididymal and subdermal fat tissues. c.
Quantitative RT-PCR for ACAM mRNA in ACAM Tg and wild type (WT) mice at 30 weeks of
age. All data are presented as mean ± standard error (SE). n=8. *p < 0.05 WT vs. ACAM Tg
mice. d. e. f. Body weight of WT and ACAM Tg lines under high fat high sucrose (HFHS)
chow. All data are presented as mean ± s.e.m. n = 8. **p<0.01 and *p<0.05 vs. WT mice.
Line 4 (n=20), Line 11 (n=8) and Line 22 (n=20). g. PAS staining of subdermal adipose
tissues (WATs) in ACAM Tg and WT mice fed HFHS chow. Browning of adipocytes are not
seen in ACAM Tg mice.
Supplementary Figure S2, related to Figure 5
a. b. c. Uncropped images for the blots shown Figure 5a, 5b and 5c. d. Western blot
analyses of ACAM before (Day 0) and after differentiation (Day 6 and 14) of 3T3-L1 cells.
Supplementary Figure S3, related to Figure 5
The effect of various inducers on ACAM mRNA expression in 3T3L1 adipocytes a.
Confluent 3T3-L1 cells were cultured for 6 hours and stimulated with various combination of
inducers. The addition of IBMX alone or the combination with other inducers up-regulates
ACAM mRNA levels. (IBMX, 0.5 mM 1-methyl-3-isobutylxanthine; DEX, 0.25 M
dexamethasone; INS, 10 μg/ml insulin; FBS, 10% fetal bovine serum; PIO, pioglitazone) b
and c. IBMX up-regulated ACAM mRNA levels in a dose dependent manner and the peak
was observed at 6 hours and declined within 48 hrs. d and e. cAMP (8-bromoadenosine-
Page 30 of 41Diabetes
cAMP) and Forskolin increased ACAM mRNA levels. f. Effect of H89 (PKA inhibitor) on
DEX/IBMX/INS induced expression of ACAM mRNA. 3T3-L1 preadipocytes were pretreated
with H89 for 30 minutes and stimulated with DEX/IBMX/INS for 6 hours. H89 inhibited the
up-regulation of ACAM mRNA in a dose dependent manner.
Supplemental Figure S4, related to Figure 5
Luciferase reporter assay of ACAM promoter. a. Several possible CCAAT/enhancer-
binding protein β (C/EBPβ)-binding sites are indicated in ACAM promoter region (underlined).
We prepared deletion constructs of mouse ACAM promoter and ligated into pGL3 vector.
Mutations were also introduced into the -79 construct between -72 to -59; -79 (Mutant 1; MT
1) and -79 (Mutant 2; MT 2). b. ~8-fold induction of luciferase activity was observed in -584
to -79-bp ACAM promoter constructs by IBMX (1-methyl-3-isobutylxanthine) stimulation and
the luciferase activity was reduced to the basal level in the -57-bp ACAM promoter construct.
-79 (MT 1) and -79 (MT 2) constructs showed loss of transactivation. c. Constitutively active
form of C/EBPβ (LAP) also significantly increased luciferase activity in -584 to -79 constructs
and it was lost in -57, -79 (MT 1) and -79 (MT 2) constructs. d. The transfection of expression
vectors for Kruppel-like factor 4 (KLF4), somatic globin transcription factor 1 and 6 (GATA1
and GATA6) enhanced the luciferase activities. *p<0.01 vs. control basic vectors.
Supplemental Figure S5, related to Figure 6
Transmission and immunogold electron microscopy of epididymal fat tissues in
ACAM Tg mice under HFHS chow. a. The zomula adherens was continuous and
characterized by strict parallelism of the adjoining cell membranes over distances of 1 to 20
μm. The intercellular space was occupied by homogeneous and amorphous material of low
density, and conspicuous bands of dense material located in the subjacent cytoplasmic
matrix. In the zonula adherens, two layers of plasma membrane joined in a linear and
parallel pattern (black arrows) but they also demonstrated invagination or engulfment (white
Page 31 of 41 Diabetes
arrows). b. Immunogold particles associated with γ-actin and ACAM antibodies were aligned
along the zonula adherens.
Supplemental Figure S6, related to Figure 6
Transmission electron microscopy of epididymal fat tissues in ACAM Tg mice under
HFHS chow. a-f. The zomula adherens was often observed at the corner of polygonal-
shaped adipocytes. The length of zonula adherens expanded from 1 to 20 μm and it was
frequently associated with invagination of the two layers of plasma membranes as indicated
by white arrows (b, c, d, e, and f).
Supplemental Figure S7, related to Figure 6
Transmission electron microscopy of epididymal fat tissues in ACAM Tg mice under
HFHS chow. a-c. The zomula adherens was observed at the corner of polygonal-shaped
adipocytes and it traveled longer distance about 20 μm indicated black arrows.
Supplemental Figure S8, related to Figure 6
Transmission electron microscopy of brown adipose tissues in ACAM Tg mice under
HFHS chow. a-g. As observed in epididymal adipose tissues in ACAM Tg mice under HFHS
chow, similar structures of zonula adherens were observed in brown adipose tissues. Dense
material in the subjacent cytoplasmic matrix along the two layers of plasma membranes was
observed. Immunogold particles associated with ACAM were observed along the zonula
adherens in brown adipose tissues.
Page 32 of 41Diabetes
a
c
d e
Supplementary Figure S1
15
20
25
30
35
40
45
50
Bod
y w
eigh
t (g)
15
20
25
30
35
40
45
50
Bod
y w
eigh
t (g)
f
L4 L11
**
ACAM Tg(HFHS)
ACAM Tg(HFHS)
WT (HFHS) WT (HFHS)
aP2 promoter -globin hGH polyAACAM cDNA
5.4 kb 0.65 kb 0.52 kb
Eco
RI
Pst
I
Bam
HI
Sm
aI
Xho
I
Hin
dIII
Eco
RI
Sm
aI
Not
I
Southern Probe (641 bp)
1.1 kb
Eco
RV
15
20
25
30
35
40
45
50
Body weight (g)
L22
*
ACAM Tg(HFHS)
WT (HFHS)
Southern blot analyses (Epididymal fat)
Epididymal fat (HFHS) Subdermal fat (HFHS)
Western blot analyses
L11 L22 L4 WTL11 L22 L4 WT
40kDa
ACAM mRNA
0
200
400
600
800
1000
Epididymaladiposetissues
Subdermaladiposetissues
Brownadiposetissues
Liver Skeletalmuscle
WT (HFHS) ACAM Tg (HFHS)WT (STD) ACAM Tg (STD)
Rel
ativ
e m
RN
A e
xpre
ssio
n*
* * * *
*
b
-641 bp
WT L4 L4 WT L11 L11 WT L22 L22
g
WT Sub WAT 297
Tg Sub WAT 282
WT (HFHS)
100m
ACAM Tg (HFHS)
100m
Page 33 of 41 Diabetes
a b
Cebpd
ACAM
Cebpb
Cebpa
Pparg
18S
18S
Pparg
Cebpa
ACAM
Lpl
c
Figure 5a Original figures Figure 5b Original figures
Figure 5c Original figure
Supplementary Figure S2
250‐150‐100‐75‐50‐37‐
25‐20‐15‐
(kDa)
Day 6 Day 14
Western blot analyses (3T3-L1 cells)
Day 0
d
-40kDa
Page 34 of 41Diabetes
a
d f
c
e
bD
EX
/IBM
X/IN
SD
EX
IB
MX
INS
DE
X/IB
MX
DE
X/IN
SIB
MX
/INS
PIO
DE
X/IB
MX
/INS
/PIO
FB
S
ACAM
Cebpb
18S
0 n
M1
nM
5 n
M50
nM
250
nM
500
nM
ACAM
Cebpb
18S
0 h
r3
hr
6 h
r12
hr
24 h
r48
hr
ACAM
Cebpb
18S
IBMX (6 hrs) IBMX (500 nM)
0 μ
M10
μM
100
μM
250
μM
500
μM
1 m
M
cAMP (6 hrs)
18S
ACAM
Cebpb
Forskolin (6 hrs)
5 μ
M
0 n
M5
nM
50 n
M50
0 n
M
50μ
M
H89 (6 hrs) 0
μM
1 μ
M2.
5 μ
M5
μM
10 μ
M20
μM
ACAMACAM
Cebpb Cebpb
18S 18S
Supplementary Figure S3
Page 35 of 41 Diabetes
a
d
*
Luciferase activity (Firefly/Renilla)
*
*
** *
b c
6 hrs after IBMX stimulation
Luciferase activity (Firefly/Renilla)
* **
* *
Luciferase activity (Firefly/Renilla)
* **
* *
0.0
0.1
0.2
0.3
0
0.1
0.2
0.3
Lac Z LAP
0
0.05
0.1
0.15
0.2
0.25
0.3
0.35
0.4
0.45
-584 ggtacccctagcgatttcataccgacctaaccagacctggaaggagaagagaaataagag -525-524 gctgggggaaacaagaagagagaggaagaagggaggagacaagagcaagaaagggaacaa -465-464 gatctggtgtagtgatgcgctcagcactaggtatatctatgtgagttcgagaccagccta -405-404 gtctacgtagacttccagaccaacaaagagctacagagtgcgaccctgtctaccaccacc -345-344 ccagtcatcctcgggagggggaggagagagagagagagagagagagagagagagagacat -285-284 aaagcattgtgagagacaaaaatatacaaaagagcagagagattagagagatcaaggaga -225-224 aaaaagacagaattgaaaaggccgcatccaccggttcttggcccaagtgctgcggattct -165-164 ctcctgcaccgcatcagttggcaccgagcgcccccctcgatcaccccgggccgcggccct -105-104 ccctcccgggtgggaggtaaagcagccccagcagctaaccccaaacgcagagagggaggg - 45- 44 cgggagcgaagagaagggagggcgaggggagggatggagggaggGGCTGCGGTAGGAGGC 1617 AGCCGTGTGGTTCCAGCTCATTTTTTTTCCCTCTTTCTCCAGTCGGTTTTCTTTCCAAAC 7677 AGGGAAAAGTGTTCCACGAAGCGGTAGCTCCTTGCCGCCTCGCCTTCTCCTCCCTAACCC 136
137 TGGGCCCGGCCCCCGTCCCGGCGCGAGCTGGTGGAGCCAGGGCTAGAAGCCCTCGGTGCC 196197 CCCGGAGCGCAGCGCGCAGGGGACCCGGGCGCGGGGCCAGCGCCCGCACATGGCTGCAGC 256257 CCCCCGCGCGCACCCCGAGGCGCCGCGCCCTGCTCACAGAAGGTCCGTCGGCTGGGCTCG 316317 GTCGCCCTGCAGCCAGGCTGCGCTGAGCCGGGAAGTGCCCGTGTCCGGAGATCGGGATGT 376
M S377 CCCTCTTCTTCCTCTGGCTA 396
L F F L W L
luciferase
-584 -79-235 -97-464 -57
Consensus NKNTTGCNYAAYNNWild type AGCTAACCCCAAACMutant 1 AGCTAACAATGGCCMutant 2 AGCTAAACCCGAAC
Supplementary Figure S4
Page 36 of 41Diabetes
1 μm 0.2 μm
ACAM Tg (HFHS) ACAM Tg (HFHS)
ACAM Tg (HFHS) ACAM Tg (HFHS)
0.5 μm0.5 μmγ-actin Ab ACAM Ab
a
b
Supplementary Figure S5
Page 37 of 41 Diabetes
Supplementary Figure S6
Tg3-D-0012 Tg3-D-0013
2.0 μm2.0 μm
b
Tg3-D-0007 Tg3-D-0006
5.0 μm 1.0 μm
a
Tg3-D-0041 Tg3-D-0042
2.0 μm 1.0 μm
f
Tg3-D-0038 Tg3-D-0039
2.0 μm 2.0 μm
e
Tg3-D-0009 Tg3-D-0010
5.0 μm 1.0 μm
d
Tg3-D-0004Tg3-D-0002
1.0 μm 0.2 μm
c
Page 38 of 41Diabetes
Supplementary Figure S7
10 μm
2.0 μm
2.0 μm
a
b
c
Page 39 of 41 Diabetes
2.0 μm
5 m
Supplementary Figure S8
1.0 μm
2.0 μm
1.0 μm2.0 μm
0.5 mACAM AbACAM Ab
a b
c
d e
f g
Page 40 of 41Diabetes
Supplementary Figure S9
Preadipocytes
F-actin
ACAM/CLMP
ACAM/CLMP
Adherens junction
Cortical actin
Mature adipocytes with hypertrophy in obesity
Mechanical strength, Inhibition of hypertrophy, Signal transduction
Page 41 of 41 Diabetes
1
Supplementary Table 1
Gene Symbols
Forward primers Reverse primers
Acaca 5’-GGATGACAGGCTTGCAGCTATG-3’ 5’-GGAACGTAAGTCGCCGGATG-3’
Acc1 5’-GGATGACAGGCTTGCAGCTATG-3’ 5’-GGAACGTAAGTCGCCGGATG-3’
Aco 5’-TGACCTGCCGAGCCAGCGTAT-3’ 5’-GACAGAAGTCAAGTTCCACGCCACT-3’
Adipoq 5’-CTACGACCAGTATCAGGA-3’ 5’-GAAAGCCAGTAAATGTAGAG-3’
Cd36 5’-AAGCTATTGCGACATGATT-3’ 5’-GATCCGAACACAGCGTAGAT-3’
Clmp (ACAM)
5’-AGCCGTCATGTCTACAATAACTTGA-3’ 5’-GGGCTTGGATGGTCTCACTAGCACT-3’
Cpt1a 5’-GCTGCTTCCCCTCACAAGTTCC-3’ 5’-GCTTTGGCTGCCTGTGTCAGTATGC-3’
Fabp4 5’-CCGCAGACGACAGGA-3’ 5’-CTCATGCCCTTTCATAAACT-3’
Fasn 5’-GCTGGCATTCGTGATGGAGTCGT-3’ 5’-AGGCCACCAGTGATGATGTAACTCT-3’
G6pc 5’-AGCCTCCGGAAGTATTGTCTCA-3’ 5’-TCCACCCCTAGCCCTTTTAGTAG-3’
G6pdh 5’-CCGGTGTTTGAACGTCATCT-3’ 5’-CCGGAGGCTGGCATTGTAG-3’
Gck 5’-TACGACCGGATGGTGGATGA-3’ 5’-ACCAGCTCGCCCATGTACTTTC-3’
Hk1 5’-TGCTACATGGAGGAACTGCGACACAT-3’ 5’-ATGCCGCTCACCATCTTCTCGAACAG-3’
Hsd11b1 5’-GCTCACTACATTGCTGGCACTATGG-3’ 5’-TCTTCGCACAGAGTGGATGTCGTCA-3’
Irs2 5’-GGAGAACCCAGACCCTAAGCTACT-3’ 5’-GATGCCTTTGAGGCCTTCAC-3’
Leptin 5’-CACCAGGCTCCCAAGAATCATGTA-3’ 5’-GGGATGGCTCTTATCTCTACTTGCT-3’
Lpl 5’-AGGACCCCTGAAGACAC-3’ 5’-GGCACCCAACTCTCATA-3’
Pck1 5’- CCACAGCTGCTGCAGAACA-3’ 5’- GAAGGGTCGCATGGCAAA-3’
Pgc1a 5’-ATACCGCAAAGAGCACGAGAAG-3’ 5’-CTCAAGAGCAGCGAAAGCGTCACAG-3’
Pparg 5’-GTTTTATGCTGTTATGGGTG-3’ 5’-GTAATTTCTTGTGAAGTGCTCATAG-3’
Retn 5’-AACTCCCTGTTTCCAAATGCAATAA-3’ 5’-GGGCTGCTGTCCAGTCTATCCTT-3’
Rplp0 (36B4)
5’-GACAATGGCAGCATCTACAG-3’ 5’-CAACAGTCGGGTAGC-3’
Slc2a4 5’-CACAGAAGGTGATTGAACAGAGC-3’ 5’-TCCGGTCCCCCAGGA-3’
Slc27a1 5’-GCCGATGTGCTCTATGACT-3’ 5’-CGGCAGATTTCACCTATGTA-3’
Srebf1 5’-GAGCCATGGATTGCACATTT-3’ 5’-CACGGACGGGTACATCT-3’
Tnfa 5’-CCCACACCGTCAGCCGATTT-3’ 5’-GTCTAAGTACTTGGGCAGATTGACC-3’
Ucp1 5’-TACCAAGCTGTGCGATGTCCA-3’ 5’-CACACAAACATGATGACGTTCC-3’
Ucp2 5’-TGCCTTCCTTTCTCCGCTTGG-3’ 5’-GAAAGGTGCCTCCCGAGATTGGTAG-3’
Ucp3 5’-CAGGATTCTGGCAGGCTGCACGACA-3’ 5’-TTCCTCCCTGGCGATGGTTC-3’
Page 42 of 41Diabetes