phenotypic and expression analysis of a novel...

Exp. Anim. 59(1), 57–71, 2010

Phenotypic and Expression Analysis of a Novel Spontaneous Myosin VI Null Mutant Mouse

Eiji MOCHIZUKI1), Kazuhiro OKUMURA1), Masashi ISHIKAWA1), Sachi YOSHIMOTO1), Junya YAMAGUCHI1), Yuta SEKI1), Kenta WADA1), Michinari YOKOHAMA1),

Tatsuo USHIKI2), Hisashi TOKANO3), Rie ISHII4), Hiroshi SHITARA4), Choji TAYA4), Ken KITAMURA3), Hiromichi YONEKAWA4), and Yoshiaki KIKKAWA1, 4)

1)Department of Bioindustry, Tokyo University of Agriculture, 196 Yasaka, Abashiri, Hokkaido 099-2493, Japan, 2)Department of Anatomy, Graduate School of Medical and Dental Sciences, Niigata University,

1–757 Asahimachi, Niigata 951-8122, Japan, 3)Department of Otolaryngology, Tokyo Medical and Dental University, 1–5–45 Yushima, Bunkyo-ku, Tokyo 113-8519, Japan, and 4)Department of

Laboratory Animal Science, The Tokyo Metropolitan Institute of Medical Science, 2–1–6 Kamikitazawa, Setagaya-ku, Tokyo 156-8506, Japan

Abstract: In humans, hearing is a major factor in quality of life. Mouse models are important tools for the discovery of genes responsible for genetic hearing loss, often enabling analysis of the processes that regulate the onset of deafness in humans. Thus far, at least 400 deafness mutants have been discovered in laboratory mouse populations and used in the study of deafness. Here we report the discovery of a new spontaneous recessive Rinshoken shaker/waltzer (rsv) mutant derived from our in-house C57BL/6J stock, which exhibits circling and/or head-tossing behaviour and complete lack of auditory brain response to any sound pressure. The hearing and balance phenotypes are associated with structural defects, in particular, disorganisation and fusion of stereocilia in the inner ear hair cells. Two sets of intersubspecific N2 mice were generated for the positional cloning of the rsv mutation. The mutant locus was mapped to a 4.8-Mb region of chromosome 9, which contains myosin VI (Myo6), a gene responsible for deafness in humans and Snell’s waltzer mutation in mice. The rsv mutant showed reduced expressions of Myo6 mRNA and MYO6 protein in the inner ear. Moreover, no immunoreactivity was observed in the cochlear and vestibular hair cells in the rsv mutant mice. We sequenced the genomic region (30,154 bp) of Myo6, including all coding exons, a non-coding exon, UTRs and the Myo6 promoter; however, no mutation was discovered in these regions. We therefore speculate that loss of MYO6 expression might cause shaker/waltzer behaviour and deafness in the rsv mutant; also, loss of MYO6 expression might be the result of mutations in an unidentified regulatory region(s) of the gene.Key words: deafness, inner ear hair cell, mouse mutant, myosin VI, stereocilia

(Received 13 July 2009 / Accepted 6 October 2009)Address corresponding: Y. Kikkawa, Department of Bioindustry, Tokyo University of Agriculture, 196 Yasaka, Abashiri, Hokkaido 099-2493, Japan

—Original—

58 E. MOCHIZUKI, ET AL.

Introduction

Hearing impairment affects 1 in 1,000 newborns, and the causes of approximately half of all cases are inher-ited [9]. Recently, a large number of genetic loci that cause deafness have been mapped in humans (Hereditary Hearing Loss Homepage: http://webh01.ua.ac.be/hhh/). However, the underlying genes still remain to be identi-fied. Genetic linkage analysis of deafness in humans is possible only in large families that contain several hear-ing impaired members. In addition, one human family may carry two or more deafness-related mutations, be-cause hearing-impaired persons from different families often marry each other [27]. Moreover, histopathologi-cal studies are confounded by the fact that auditory neural tissue cannot be removed and morphologically examined by extraction and fixation during life.

Auditory mouse mutants have contributed to the iden-tification of candidate deafness-causing genes in humans [6, 10, 11]. Due to the remarkable structural similarity between human and mouse auditory systems, auditory mouse mutants have provided valuable insight into the ontogenesis, morphogenesis and function of the human ear [3].

Within the phenotypes of auditory mouse mutants, shaker/waltzer behaviour is characteristic of vestibular dysfunction of the inner ear and is often associated with deafness [2, 5, 8, 12, 21, 26, 28, 33]. Vestibular dysfunc-tion and deafness is, in most cases, caused by abnor-malities of stereocilia on inner ear hair cells. Vertebrate inner ear hair cells are mechanosensors that transduce mechanical forces arising from sound waves and head movement providing the sense of hearing and balance, respectively [13, 23]. Stereocilia is a mechanically sen-sitive organelle, which consists of actin filaments, non-muscle-type myosin and several scaffold proteins [6, 10, 11]. Mouse mutations underlying vestibular dysfunction and deafness occur preferentially in genes encoding such proteins. These genes regulate organisation, structure, growth, and function of stereocilia; hence, mutations in these genes often directly affect stereocilia morphology [13, 32].

We found a new recessive mutant mouse, Rinshoken shaker/waltzer (rsv), in a C57BL/6Slc (B6) colony at The Tokyo Metropolitan Institute of Medical Science

(Rinshoken) that exhibits shaker/waltzer behaviour, in-cluding circling and head tossing. We used a positional cloning approach to identify the gene responsible for the rsv mutation, mapping the locus to chromosome 9, which is very close to the myosin VI (Myo6) gene. Myo6 en-codes an unconventional myosin protein (MYO6) that is mutated in Snell’s waltzer (Myo6sv) mice and in two forms of human non-syndromic deafness, DFNA22 and DFNB37 [1, 5, 25]. Myo6sv mice exhibit deafness and circling behaviour and have fused cochlear and vestibu-lar hair cell stereocilia [5, 31]. In the inner ear, MYO6 is normally located in the cytoplasm of organ of Corti (oC), vestibular hair cells within the cuticular plate and the pericuticular necklace [5, 16], and between the actin core and plasma membrane of stereocilia [29]. Myo6 mutations result in fusion of the stereocilia into a giant structure, suggesting that MYO6 acts as an anchor for the stereociliar membrane at the apex of the hair cell [31].

In this study, we performed genetic, phenotypic and expression analyse of the rsv mutant with a Myo6sv-like phenotype. Our results suggest that this mutant should be classified as a stereociliary mutant that carries a mu-tant allele of Myo6.

Materials and Methods

MiceThe rsv mutant appeared spontaneously in a C57BL/6Slc

(B6) colony in the animal facility of the Tokyo Metro-politan Institute of Medical Science (Rinshoken). We established a mutant strain colony by breeding the found-er mouse and following the deafness phenotype. The mutant strain has been bred in the animal facility of Tokyo University of Agriculture. The B6-rsv mice were crossed with the MSM/Ms (MSM) and JF1/Ms (JF1) strains to generate intersubspecific backcross progeny for linkage analysis. All procedures involving animals met the guide-lines described in the Proper Conduct of Animal Experi-ments as promulgated by the Science Council of Japan and were approved by the Animal Care and Use Com-mittee of the Tokyo University of Agriculture.

Measurement of hearing ability in miceHearing ability in mice was tested by measuring the

auditory brainstem response (ABR) threshold as de-

59NULL MUTATION OF MYO6 IN MICE

scribed previously [21]. The ABR thresholds of all mice were measured using tone pip frequency of 12 kHz.

Phalloidin staining of stereocilia bundlesStereocilia bundles were visualised using Alexa Fluor

568 phalloidin (Invitrogen, Carlsbad, CA). Histological examinations of mutant mice cochlea on postnatal days zero (P0), P5, P7, P10, P24, and P90 were performed as previously described using Alexa Fluor 568-conjugated phalloidin (0.2 µM) [22].

Cochlea histologyCochlea were dissected from mice on day P56 days,

fixed with 4% paraformaldehyde overnight, and then decalcified in 5% EDTA/PBS. After decalcification for 10 days, tissues were dehydrated, embedded in paraffin, sectioned (5 µm), and stained with haematoxylin.

SEMTo fix cochlea, mice were perfused through the heart

with a buffer containing 0.9% saline, 2% glutaraldehyde, and 0.1 M phosphate (pH 7.4). Immediately after perfu-sion, cochlea were removed from the body and immersed in the same fixative. They were treated with a 1% tannic acid solution for 3 h, washed in distilled water for 1 h, and immersed in a 1% OsO4 solution for 4 h at room temperature. The specimens were dehydrated in a grad-ed ethanol series, transferred to isoamyl-acetate, and critical point-dried using liquid CO2. The dried speci-mens were coated with platinum-palladium in an ion coater and examined in a Hitachi S-4300N SEM at an acceleration voltage of 10 kV.

Linkage analysisLinkage mapping of the rsv mutant locus was per-

formed by intersubspecific backcrossing progeny derived from the mating of (MSM × B6-rsv/rsv) F1 × B6-rsv/rsv and (JF1 × B6-rsv/rsv) F1 × B6-rsv/rsv. Mice with a mutant phenotype in the backcross progeny were easily identified by their overt circling and head-shaking be-haviour. Genomic DNA was prepared from liver, tail and/or pinna skin. Genome-wide screening was per-formed with 82 microsatellite markers located within the 15–35 cM interval on each chromosome (data not shown). PCR conditions for genotyping using micro-

satellite markers were as described previously [20]. The recombinants between D9Mit74 and D9Mit273 were used for fine genotyping with markers D9Mit236, D9Mit343, D9Mit307 and D9Mit10, and microsatellite markers (Supplementary Table 1) developed from the genomic sequence (Ensembl release 54: http://www.ensembl.org, from the NCBI m37 Mouse Genome As-sembly) of mouse chromosome 9. Refinement of the map position was done with the aid of the Map Man-ager computer program [24].

Mutation analysis of the genomic Myo6 gene sequenceThirteen genomic DNA fragments covering the 35

coding exons of Myo6 were amplified using AmpliTaq Gold (Applied Biosystems, CA, USA) or KOD FX (TOYOBO, Osaka, Japan). Details of the PCR and se-quencing primer sequences are given in Supplementary Tables 2 and 3. PCR products were purified with the ExoSAP-IT (GE Healthcare, Buckinghamshire, UK) or QIAquick Gel Extraction Kit (Qiagen, Valencia, CA), sequenced using DTCS (Beckman Coulter, Fullerton, CA), and analysed on a Beckman CEQ8000.

RT-PCR and mutation analysis of Myo6 on cDNATotal RNA was isolated from the inner ear, brain,

liver, and kidney of 4-week-old mice using TRIzol (In-vitrogen, Carlsbad, CA) following the manufacturer’s protocol. cDNA was generated with the ThermoScript RT-PCR System (Invitrogen) using 0.1 µg of DNase-pretreated total RNA. The cDNA was amplified for 30–40 cycles (95°C for 30 s, 60°C for 30 s, 72°C for 90 s) using AmpliTaq Gold (Applied Biosystems). Details of the PCR and sequencing primer sequences are given in Supplementary Table 4. The products were subjected to agarose gel electrophoresis and sequenced.

AntibodiesRabbit polyclonal antibody for MYO6 was obtained

commercially (Proteus BioSciences, Ramona, CA). Horseradish peroxidase (HRP)-conjugated donkey anti-rabbit IgG antibody (GE Healthcare) and HRP-conju-gated sheep anti-mouse IgG antibody (GE Healthcare) secondary antibodies were used for western blotting. Alexa-conjugated goat anti-rabbit IgG antibody was obtained from Invitrogen.


Western blottingProteins were isolated from the inner ear, brain, liver,

and kidney of mice using T-PER Tissue Protein Extrac-tion Reagent (Pierce, Rockford, IL) according to the manufacturer’s protocol. Fifty micrograms of total pro-tein was fractionated on 7.5% SDS-polyacrylamide gel and transferred onto a Hybond-P PVDF Membrane (GE Healthcare). The MYO6 antibody was used at a dilution of 1:4,000. The membrane was subsequently stripped and blotted with an anti-a-tubulin monoclonal antibody (1:10,000, Sigma, Milwaukee, WI) to determine protein loading. HRP-conjugated secondary antibodies were used at a dilution of 1:40,000. Blots were developed using the ECL Advance Western Blotting Detection Kit (GE Healthcare).

ImmunohistochemistryWhole-mount immunostaining was performed as pre-

viously described [22]. The MYO6 antibody was used at a dilution of 1:200. Fluorescence images were ob-tained with a Zeiss LSM510 META confocal microscope equipped with a Plan-Fluar (100×/1.45) oil immersion objective.

Results

Isolation and phenotypic characterisation of the spontaneous rsv mutant

The rsv mutant mouse is identifiable at P10 by its lack of balance. At P20, rsv mice display distinct head toss-ing and bidirectional circling behaviour that persists throughout their lives (Fig. 1A). The rsv mutation was proven to be recessive by backcross to unrelated B6 mice with the production of normal phenotype mice. Cross-breeding between the (B6 × rsv) F1 mice produced 31 normal and 11 shaker/waltzer offspring. Moreover, the mating of the (B6 × rsv) F1 with rsv mice produced 61 normal and 57 shaker/waltzer offspring.

To determine whether vestibular hair cells from rsv mutant mice display a similar disorganisation to that displayed by the other shaker/waltzer mutants, utricles from the inner ear of the B6 and rsv mice were examined in confocal microscopy (Figs. 1B and 1C). Stereocilia bundles on hair cells from the utricles of mutant mice lacked the normal staircase configuration (Fig. 1C).

The rsv mice also failed to produce Preyer’s ear reflex, which is typical in shaker/waltzer deafness mutants. ABR tests were performed to estimate their hearing abil-ity at P30 (Figs. 1D and 1E), normally an age of complete mature hearing sensitivity [11]. Even at the highest in-tensity (90 dBpeSPL), the rsv mutant showed no ABR (Fig. 1E), although unaffected littermate controls showed normal waveforms and thresholds (Fig. 1D). An ex-amination of cochlear histology revealed severe degen-eration of the oC in rsv mutant but not wild type (B6) mice at P56, including a loss of inner and outer hair cells and a decrease in spiral ganglion cells (Figs. 1F and 1G). Hair cell morphology was investigated using whole-mount phalloidin staining. Morphogenesis of hair cells from the apex, middle and base areas of oC from wild-type and mutant mice littermates was closely examined (Figs. 2A and 2B). At P0, stereocilia bundles showed a normal pattern of development in littermate wild-type mice with hair cells from the base area being more ad-vanced than hair cells of the apex area. The cluster of microvilli at the top of each hair cell was already polar-ised in the apex area, with a shaped array of microvilli on the lateral edge of each hair cell having grown taller (Fig. 2C). In the middle and base areas at P0, microvil-li had become stereocilia, whereas microvilli in the centre and inner edge of each hair cell were much short-er and in the process of being reabsorbed (Figs. 2D and 2E) [11]. Hair cells from rsv mutant mice at P0 appeared normal, with shaped arrays of growing stereocilia lo-cated at the lateral edge of the hair cells in the apex area, similar to wild-type littermates (Fig. 2F). However, there were signs of disorganisation in the hair cells from the middle area (Fig. 2G), where the stereocilia bundles of inner hair cells (IHC) showed a swirled appearance. Degeneration of the stereocilia bundles on IHCs and outer hair cells (OHCs) were more pronounced in the base area than in the middle area (Fig. 2H). Over the next few days, stereocilia bundles become progres-sively more disorganised, and there were no hair cells with normal stereocilia anywhere in the oC at P5 (Fig. 2I). Practically all hair cells showed fused-like stereo-cilia by P10 stage (Fig. 2J), and there are long and dis-rupted stereocilia by P24 (Fig. 2K). To investigate in detail the disrupted morphology of stereocilia, we ex-amined hair cells of the wild-type and rsv mice at P27


Fig. 1. Phenotypic characterisation of a Rinshoken shaker/waltzer (rsv) mutation that arose in C57BL/6J. (A) Visible appearance of normal (black arrow) and mutant mice (white arrow-head). The rsv mutant mouse shows abnormal behaviour (circling and/or head-tossing). (B, C) Stereocilia bundles of vestibular hair cells from B6 (B) and rsv mutant (C) mice at P30. To visualise the F-actin-rich stereocilia bundles on the hair cells, the utricle of the vestibular labyrinth was stained with an Alexa Fluor 568-conjugated phalloidin and then analysed by laser scanning confocal microscopy. Scale bar =5 µm. (D) Auditory brainstem response (ABR) from B6 and rsv mice at P30. The five major peaks (labelled I, II, III, IV, and V) of the averaged waveforms were detectable up to 20 dBpeSPL in a wild-type mouse (E), whereas no waveform was recorded at the highest stimulus level of 90 dB peSPL in a rsv mouse. (F) Cochlear histology of wild-type and the rsv mouse. Cross-sections through the middle turn of the cochlea from B6 (F) and rsv mutant mice (G) at P56. The cochlea of the rsv mouse exhibits severe degeneration of the organ of Corti (oC, arrowhead) and spiral ganglion cells (SGCs, arrow). Scale bar =500 µm.


Fig. 2. Development of cochlear hair cells in rsv mutants. Laser scanning confocal images of the morphology of stereocilia bundles in wild-type and rsv mutant mice. (A) Photograph of the cochlea showing areas scanned by a confocal microscope. (B) Confocal image of hair cells of oC in a wild-type mouse at P7. Phalloidin staining of three rows of outer hair cells (OHCs) and one row of inner hair cells (IHC). Stereocilia bundles of wild-type mice (C–E) are compared with that of rsv mutant mice (F–H) at P0. In the middle area at P0, stereocilia of the rsv mutant appear to have an abnormal orientation (G, ar-rows). Confocal images of the maturation of stereocilia bundles in rsv mutant mice at P5 (I), P10 (J), and P24 (K). All hair cells show disrupted stereo-cilia after P10 (J), and long stereocilia are observed on all hair cells at P24 (K). Scale bar =5 µm.


by SEM (Fig. 3). The rsv mice at this stage had areas of both IHCs and OHCs in which the hair cells had com-pletely degenerated, and some stereocilia bundles were severely fused (Fig. 3B). There was excess growth and fusion of stereocilia resulting in large protrusions on top of hair cells, especially in IHCs.

Genetic mapping of the rsv mutationHomozygous rsv mice were crossed to MSM or JF1

strains to generate intersubspecific backcross progeny for linkage analysis. DNA from 24 [(MSM × B6-rsv/rsv) F1 × B6-rsv/rsv] N2 progeny (including 13 affected mice) was genotyped with 82 MIT markers on mouse chromosomes 1–19. This strategy was used to efficient-ly localise the rsv mutation to chromosome 9. DNA from a total of 109 N2 progeny from both crosses was geno-typed to refine the map position with D9Mit108, D9Mit306, D9Mit74, D9Mit236, D9Mit343, D9Mit307, D9Mit10, and D9Mit273 and eight newly developed

microsatellite markers (Supplementary Table 1). Cross-over analysis identified a candidate non-recombinant interval of 4,816,066 bp (Ensembl) between markers D9Mit74 and D9Nok18 (Fig. 4). The non-recombinant region contains 22 protein coding genes (Table 1) and five pseudo genes (Ensembl). Given its genomic lo-calisation and its involvement in a similar mutant pathol-

Fig. 3. Scanning electron micrographs of hair cell stereocilia in the apical turn of the oC from a B6 mouse (A) and rsv mutant mouse (B) at P30. Higher magnification of IHC staircase patterns and rigid morphology of stereocilia of a B6 (C) are compared with the fused stereocilia bundle of a rsv mutants (D). Scale bar =5 µm.

Fig. 4. Genetically derived candidate intervals for the localisation of the rsv mutation. The Ensemble base pair locations along chromosome 9 are shown to the right of each genetic marker. Ar-rows connect recombinant flanking markers used by two backcross panels, delimiting candidate gene intervals for the rsv mutation. The Myo6 gene located in the non-recombinant interval is a strong candidate gene (see Table 1).


ogy in humans and mice, the Myo6 gene was the stron-gest candidate gene for the rsv mutation (Table 1).

Expression and mutation analyses of the myosin VI gene and protein in rsv mutants

To examine the effect of the rsv mutation on Myo6 RNA expression, we carried out RT-PCR analysis using RNA isolated from the inner ear, brain, liver, and kidney of P30 wild-type (B6) and homozygous rsv mice. The transcript level of Myo6 was markedly reduced in rsv mutants (Fig. 5A). Moreover, to examine MYO6 expres-sion in rsv mutant, we performed immunoblot analysis using total protein extracts from the inner ear, brain, liver, and kidney of P30 wild-type and homozygous rsv mice (Fig. 5B). The blot was probed with a rabbit poly-clonal antibody for MYO6 that had been previously characterised [7, 15, 16, 17]. A ~140-kDa band of MYO6 was abundant in tissues from wild-type mice but was not detectable in those of the rsv mutant.

Immunohistochemical analysis was performed to evaluate MYO6 expression in the inner ear hair cells from wild-type and rsv mice (Figs. 5C–F). We confirmed the general localisation of MYO6 in the mature oC and

vestibular hair cells of wild-type mice (Figs. 5C and 5D) [5, 16, 29]. In rsv mutant mice, we did not detect MYO6 in oC and vestibular hair cells (Figs. 5E and 5F), confirm-ing the absence of MYO6 in the inner ear of rsv mu-tants.

These findings lead us to conclude that the shaker/waltzer behaviour and deafness in rsv mutant mice are caused by a mutation in the Myo6 locus, suggesting that the mutation is an allele of Myo6sv. We designed PCR primers (Supplementary Table 2; set A–M) to amplify 35 exons corresponding to the full Myo6 se-quence (Ensembl gene ID ENSMUST00000035889, ENSMUST00000113268, ENSMUST00000076140, ENSMUST00000113266, ENSMUST00000098514, and ENSMUST00000113259) of genomic DNA from B6, rsv heterozygous and homozygous mutant mice using the primers listed in Supplementary Tables 2 and 3. DNA sequencing (28,648 bp) of the 34 coding exons and a non-coding exon as well as exon-intron boundaries and the UTRs of Myo6 did not reveal any mutations. We also sequenced a 1,506-bp region, including the pro-moter region of Myo6 identified by Jung et al. [19]; however, no new sequence variants were identified.

Table 1. List of known proteins encoding non-recombinant intervals of mouse rsv mutations

Ensembl position (bp) Gene symbol Gene name Ensembl ID

78,175,837–78,177,399 Omt2b Oocyte maturation, beta ENSMUSG0000003875078,178,826–78,194,957 Gsta2 Glutathione S-transferase A2 ENSMUSG0000005793378,214,864–78,215,965 Dppa5a Developmental pluripotency-associated protein 5A ENSMUSG0000006046178,223,912–78,226,360 Ooep Oocyte-expressed protein homolog ENSMUSG0000003234678,278,326–78,291,044 E330016A19Rik RIKEN cDNA E330016A19 gene ENSMUSG0000003234478,296,027–78,321,957 Mto1 MTO1 homolog, mitochondrial precursor ENSMUSG0000003234278,326,265–78,329,478 Eef1a1 Elongation factor 1-alpha 1 ENSMUSG0000003774278,384,313–78,435,834 Slc17a5 Sialin ENSMUSG0000004962478,463,584–78,564,058 Cd109 CD109 antigen Precursor ENSMUSG0000004618678,668,445–78,669,647 AC161256.3 Putative uncharacterised protein ENSMUSG0000005942279,294,568–79,294,705 AC157516.2 Putative uncharacterised protein ENSMUSG0000007417479,446,798–79,566,527 Col12a1 Collagen alpha-1(XII) chain precursor ENSMUSG0000003233279,603,215–79,607,520 Cox7a2 Cytochrome c oxidase polypeptide 7A2, ENSMUSG00000032330 mitochondrial precursor79,616,750–79,641,314 Tmem30a Cell cycle control protein 50A ENSMUSG0000003232879,663,369–79,825,689 Filip1 Filamin-A-interacting protein 1 ENSMUSG0000003489879,914,710–79,992,587 Senp6 Sentrin-specific protease 6 ENSMUSG0000003425280,012,847–80,159,536 Myo6 Myosin-VI ENSMUSG0000003357780,160,894–80,359,018 Impg1 Interphotoreceptor matrix proteoglycan 1 Precursor ENSMUSG0000003234381,524,999–81,526,159 Htr1b 5-hydroxytryptamine receptor 1B ENSMUSG0000004951181,757,312–82,099,614 4930486G11Rik RIKEN cDNA 4930486G11 gene ENSMUSG0000004328982,723,476–82,741,293 Irak1bp1 Interleukin-1 receptor-associated kinase 1-binding protein 1 ENSMUSG0000003225182,759,766–82,869,096 Phip PH-interacting protein ENSMUSG00000032253


Fig. 5. Myosin VI RNA and protein expression in wild-type (B6) and rsv mutant mice. (A) Comparison of Myo6 RNA expression between B6 and rsv mutant mice by RT-PCR. cDNA was amplified as a 2,071-bp Myo6 product (top). Primers used for the detection of Myo6-specific transcripts were Myo6F7 and Myo6R1 (Supplementary Table 4). cDNA integrity was confirmed with a 1,144-bp Gapdh control band (bottom). Myo6 mRNA levels in the brain and kidney from rsv mutants were markedly reduced compared with control B6 mice and were undetectable in the liver and the inner ear from the rsv mutant. (B) Western blots of homogenates prepared from brain, liver, kidney, and inner ear of B6 and rsv mutant mice labelled with anti-MYO6 antibody (top). Note the absence of specific labelling in the molecular mass regions confirmed by Hasson et al. [16] for MYO6 (~140 kDa) in rsv mutant mice. The samples were processed for indirect immunofluorescence with an anti-a-tubulin antibody (bottom). (C–F) Confocal microscopic localisation of MYO6 in the wild-type (C, D) and rsv (E, F) mouse oC and vestibular (utricle) hair cells. Confocal images of hair cells labelled with antibody to MYO6 (green) and phalloidin (red). The left panel shows the distribution of MYO6, and the right panel shows the merge of the MYO6 and F-actin labels. Specific labelling of MYO6 in the inner ear hair cells of wild-type (B6) mice at P30 (C, D). MYO6 localises to cuticular plates, stereocilia bundles, and cell bodies, including hair cells of oC (C) and vestibular (D) hair cells. The labelling was most intense in the circumference of the cuticular plates, namely the peri-cuticular necklace (C, D). MYO6 signals were not detected in the oC or vestibule of rsv mutant mice (E, F). Scale bar =5 µm.


Because no mutations were found by genomic sequencing of Myo6, we looked for a splice-site mutation in the gene. Primers were designed for RT-PCR and to fully sequence the cDNA in overlapping fragments (Supplementary Table 4). Sequencing revealed three different length transcripts (Ensembl gene ID ENSMUST00000035889, ENSMUST00000113268, and ENSMUST00000076140) from wild-type and rsv mutant mouse brain cDNA caused by alternative splicing of Myo6 (data not shown). The Myo6 alternative splice forms can be found in the both wild-type and rsv mice.

Discussion

Researchers using mouse models for deafness have emphasised the need for multiple genetic alleles, because new mutations may lead to new phenotypes and genes involved in hearing to help elucidate new functions for associated proteins. In this study, we have isolated a new spontaneous mutant mouse, rsv, lacking MYO6 expression (Figs. 5B–F). Moreover, the phenotypes in the rsv mutant are very similar to those described for MYO6-null mice, Myo6sv (Figs. 1–3) [5]. Genetic map-ping placed the rsv mutation in the same chromosomal interval as Myo6 (Fig. 4). There are 22 named genes in the current candidate gene interval for rsv (Table 1). In addition to Myo6, Slc17a5 is the only known deafness- and behavioural abnormality-associated gene (Table 1). In humans, lysosomal free sialic acid storage diseases are recessively inherited allelic neurodegenerative dis-orders that include Salla disease and infantile sialic acid storage disease caused by mutation in the SLC17A5 gene encoding a lysosomal membrane protein, sialin, which transports sialic acid from the lysosome [4]. Slc17a5 knock-out mice exhibit numerous neurological abnor-malities, including impaired exploratory and locomotor activity, hearing deficits, and an increased depressive-like response (MGI, unpublished data). Although the phenotypes in the Slc17a5 knock-out mice are not sim-ilar to rsv mice, to test whether Slc175a was a candidate for the rsv mutation, we designed PCR primers to am-plify the open reading frame (ORF) of the gene (Supple-mentary Table 5). No difference of transcript level and length could be seen for any tissue between wild-type and rsv mice (data not shown). Also DNA sequencing

of the ORF of Slc175a did not reveal any mutations.The Myo6sv mutant mouse was reported in 1960 [14].

Two spontaneous alleles, three ENU mutagenesis-in-duced alleles and a radiation-induced allele of Myo6sv

have been identified: Myo6sv-2J, Myo6sv-3J, Myo6sv-4J

(MGI: http://www.jax.org), Myo6twt [30], Myo6Tlc [17], and Bmp5seMyo6sv [5]. The mutation sites are not known for Myo6sv-2J, Myo6sv-3J, and Myo6sv-4J mutant mice. The Myo6sv mouse contains a 1.1-kb intragenic deletion that removes 130 bp from the Myo6 coding region and is likely to represent a null allele [5]. Myo6twt mice contain a T-to-A transversion in Myo6 that replaces a tyrosine residue with a stop codon that truncates the tail domain [30]. Bmp5seMyo6sv mice result from a paracentric inver-sion that breaks upstream of the Myo6 coding region [5]. Although Myo6 mRNA of normal size is expressed in Bmp5seMyo6sv mice, its expression is greatly reduced. Homozygous Bmp5seMyo6sv mice show extensive and early stereocilia fusion in inner ear hair cells [5, 30, 31]. In contrast, Myo6Tlc mice that contain a D179Y ENU mutagenesis-induced mutation in the Myo6 motor domain exhibit gradual deterioration of both hearing and vestibu-lar dysfunction in heterozygous and homozygous mice, with normal MYO6 expression levels [17]. Myo6Tlc ho-mozygous mice also exhibit stereocilia fusion. The stereocilia fusion detected in rsv mice is similar to the phenotype of other alleles of Myo6sv (Figs. 2 and 3). Thus, our MYO6-null mutant, rsv, is a likely to be al-lelic with Myo6sv, although we did not confirm this by allelic complementation.

Myo6 mutant mice, including our spontaneous mutant, exhibit stereocilia fusion (Figs. 3B and 3D) [5, 30, 31]. MYO6 is localised to the cytoplasm of the inner and outer hair cells within the cuticular plate and the pericu-ticular necklace, and between the actin core and plasma membrane of stereocilia (Figs. 5C and 5D). Therefore, Myo6 mutations result in fusion of stereocilia into a gi-ant structure, suggesting that MYO6 acts as an anchor for the stereocilia membrane at the apex of the hair cell [31]. We found that in rsv mutant mice, stereocilia of oC hair cells begin normal development, forming cor-rectly oriented arrays of growing stereocilia; however, these arrays become progressively more disorganised and fuse around the apex area of oC at P0 (Fig. 2F). This process occurs rapidly, with very few abnormal cells in


the middle area at P0 (Fig. 2G), and practically all hair cells are affected in the base area of oC (Fig. 2H). Ste-reocilia fusion is extensive by P10 with giant fused ste-reocilia (Fig. 2J). At P30, the hair cells also start to degenerate (Fig. 3). The observation of hair cell degen-eration in rsv mutants is similar to earlier reports in Myo6sv mice [31]. These findings suggest that MYO6 is essential for the maintenance of inner ear hair cells rather than for organogenesis and development.

We did not find any potentially causative changes in rsv mutant mice by DNA sequencing of Myo6 at either the genomic or the cDNA level. Furthermore, although the promoter region of the Myo6 gene has already been identified [19], DNA sequencing did not reveal any mu-tations in this region. Western blot and immunohis-tochemical analysis of MYO6 expression, however, indicated a complete loss of MYO6 expression in rsv mutant mice compared with wild-type mice (Figs. 5B, 5E, and 5F). We surmise that the loss of MYO6 expres-sion causes congenital deafness and vestibular dysfunc-tion in rsv mutant mice; however, the possibility that a mutation in another gene may be responsible for the rsv mutant phenotype cannot be completely excluded. A possible alternative explanation is that there is a regula-tory sequence mutation or a position effect mutation in rsv mutant mice that affects Myo6 expression. Two re-ports have suggested that mutations in regulatory se-quences or position effect mutations of Myo6 in the Myo6sv allele [5] and in a family affected by autosomal dominant deafness [18]. A possible regulatory region of Myo6 was found in mice harbouring a Bmp5seMyo6sv

allele, which shows stereocilia fusion due to a paracen-tric inversion caused by a break 30–220 kb upstream of Myo6 [5]. Recently, it was shown by quantitative real-time PCR that mRNA expression of MYO6 in humans is elevated 1.5- to 1.8-fold in family members suffering inherited deafness compared with unaffected family members [18]. No causative mutation was found by genomic sequencing in coding exons, non-coding exons, exon-intron boundaries, UTRs, and the promoter region of MYO6 in these patients. However, in humans and mice, no regulatory regions of the myosin VI gene have been identified thus far, making it very difficult to con-firm in an in vitro study. The new mouse mutant, rsv, is likely to provide new information on the mechanism of

how Myo6 expression is regulated, especially if a muta-tion is identified in a previously unknown regulatory region of Myo6.

Acknowledgments

This work were supported by Grant-in-Aid for Scien-tific Research (B, no. 20300147) from the Japan Society for the Promotion of Science, and by Grants for the Ad-vancement of Research at the Graduate Schools from the Ministry of Education, Culture, Sports, Science and Technology of Japan.

References

1. Ahmed, Z.M., Morell, R.J., Riazuddin, S., Gropman, A., Shaukat, S., Ahmad, M.M., Mohiddin, S.A., Fananapazir, L., Caruso, R.C., Husnain, T., Khan, S.N., Riazuddin, S., Griffith, A.J., Friedman, T.B., and Wilcox, E.R. 2003. Mutations of MYO6 are associated with recessive deafness, DFNB37. Am. J. Hum. Genet. 72: 1315–1322.

2. Alagramam, K.N., Murcia, C.L., Kwon, H.Y., Pawlowski, K.S., Wright, C.G., and Woychik, R.P. 2001. The mouse Ames waltzer hearing-loss mutant is caused by mutation of Pcdh15, a novel protocadherin gene. Nat. Genet. 27: 99–102.

3. Anagnostopoulos, A.V. 2002. A compendium of mouse knockouts with inner ear defects. Trends Genet. 18: S21–38.

4. Aula, P. and Gahl, W.A. 2001. Disorders of free sialic acid storage. pp. 5109–5120. In: The Metabolic and Molecular Bases of Inherited Disease, 8th ed. (Scriver, C.R., Beauded, A.L., Sly, W.E., and Valle, D. eds.), McGraw-Hill, New York.

5. Avraham, K.B., Hasson, T., Steel, K.P., Kingsley, D.M., Russell, L.B., Mooseker, M.S., Copeland, N.G., and Jenkins, N.A. 1995. The mouse Snell’s waltzer deafness gene encodes an unconventional myosin required for structural integrity of inner ear hair cells. Nat. Genet. 11: 369–375.

6. Brown, S.D., Hardisty-Hughes, R.E., and Mburu, P. 2008. Quiet as a mouse: dissecting the molecular and genetic basis of hearing. Nat. Rev. Genet. 9: 277–290.

7. Coffin, A.B., Dabdoub, A., Kelley, M.W., and Popper, A.N. 2007. Myosin VI and VIIa distribution among inner ear epithelia in diverse fishes. Hear. Res. 224: 15–26.

8. Di Palma, F., Holme, R.H., Bryda, E.C., Belyantseva, I.A., Pellegrino, R., Kachar, B., Steel, K.P., and Noben-Trauth, K. 2001. Mutations in Cdh23, encoding a new type of cadherin, cause stereocilia disorganization in waltzer, the mouse model for Usher syndrome type 1D. Nat. Genet. 27: 103–107.

9. Fortnum, H.M., Summerfield, A.Q., Marshall, D.H., Davis, A.C., and Bamford, J.M. 2001. Prevalence of permanent childhood hearing impairment in the United Kingdom and


implications for universal neonatal hearing screening: questionnaire based ascertainment study. BMJ 323: 536–540.

10. Friedman, L.M., Dror, A.A., and Avraham, K.B. 2007. Mouse models to study inner ear development and hereditary hearing loss. Int. J. Dev. Biol. 51: 609–631.

11. Frolenkov, G.I., Belyantseva, I.A., Friedman, T.B., and Griffith, A.J. 2004. Genetic insights into the morphogenesis of inner ear hair cells. Nat. Rev. Genet. 5: 489–498.

12. Gibson, F., Walsh, J., Mburu, P., Varela, A., Brown, K.A., Antonio, M., Beisel, K.W., Steel, K.P., and Brown, S.D. 1995. A type VII myosin encoded by the mouse deafness gene shaker-1. Nature 374: 62–64.

13. Grant, L. and Fuchs, P.A. 2007. Auditory transduction in the mouse. Pflugers Arch. 454: 793–804.

14. Green, M.C. 1960. New mutant—Snell’s waltzer—sv. Mouse News Lett. 23: 40.

15. Hasson, T. and Mooseker, M.S. 1994. Porcine myosin-VI: characterization of a new mammalian unconventional myosin. J. Cell Biol. 127: 425–440.

16. Hasson, T., Gillespie, P.G., Garcia, J.A., MacDonald, R.B., Zhao, Y., Yee, A.G., Mooseker, M.S., and Corey, D.P. 1997. Unconventional myosins in inner-ear sensory epithelia. J. Cell Biol. 137: 1287–1307.

17. Hertzano, R., Shalit, E., Rzadzinska, A.K., Dror, A.A., Song, L., Ron, U., Tan, J.T., Shitrit, A.S., Fuchs, H., Hasson, T., Ben-Tal, N., Sweeney, H.L., de Angelis, M.H., Steel, K.P., and Avraham, K.B. 2008. A Myo6 mutation destroys coordination between the myosin heads, revealing new functions of myosin VI in the stereocilia of mammalian inner ear hair cells. PLoS Genet. 4: e1000207.

18. Hilgert, N., Topsakal, V., van Dinther, J., Offeciers, E., Van de Heyning, P., and Van Camp, G. 2008. A splice-site mutation and overexpression of MYO6 cause a similar phenotype in two families with autosomal dominant hearing loss. Eur. J. Hum. Genet. 16: 593–602.

19. Jung, E.J., Liu, G., Zhou, W., and Chen, X. 2006. Myosin VI is a mediator of the p53-dependent cell survival pathway. Mol. Cell. Biol. 26: 2175–2186.

20. Kikkawa, Y., Miura, I., Takahama, S., Wakana, S., Yamazaki, Y., Moriwaki, K., Shiroishi, T., and Yonekawa, H. 2001. Microsatellite database for MSM/Ms and JF1/Ms, molossinus-derived inbred strains. Mamm. Genome 12: 750–752.

21. Kikkawa, Y., Shitara, H., Wakana, S., Kohara, Y., Takada, T., Okamoto, M., Taya, C., Kamiya, K., Yoshikawa, Y., Tokano, H., Kitamura, K., Shimizu, K., Wakabayashi, Y., Shiroishi, T., Kominami, R., and Yonekawa, H. 2003. Mutations in a new scaffold protein Sans cause deafness in Jackson shaker mice. Hum. Mol. Genet. 12: 453–461.

22. Kikkawa, Y., Mburu, P., Morse, S., Kominami, R., Townsend, S., and Brown, S.D. 2005. Mutant analysis reveals whirlin as a dynamic organizer in the growing hair cell stereocilium. Hum. Mol. Genet. 14: 391–400.

23. LeMasurier, M. and Gillespie, P.G. 2005. Hair-cell mechanotransduction and cochlear amplification. Neuron 48: 403–415.

24. Manly, K.F., Cudmore, R.H. Jr., and Meer, J.M. 2001. Map Manager QTX, cross-platform software for genetic mapping. Mamm. Genome 12: 930–932

25. Melchionda, S., Ahituv, N., Bisceglia, L., Sobe, T., Glaser, F., Rabionet, R., Arbones, M.L., Notarangelo, A., Di Iorio, E., Carella, M., Zelante, L., Estivill, X., Avraham, K.B., and Gasparini, P. 2001. MYO6, the human homologue of the gene responsible for deafness in Snell’s waltzer mice, is mutated in autosomal dominant nonsyndromic hearing loss. Am. J. Hum. Genet. 69: 635–640.

26. Mburu, P., Mustapha, M., Varela, A., Weil, D., El-Amraoui, A., Holme, R.H., Rump, A., Hardisty, R.E., Blanchard, S., Coimbra, R.S., Perfettini, I., Parkinson, N., Mallon, A.M., Glenister, P., Rogers, M.J., Paige, A.J., Moir, L., Clay, J., Rosenthal, A., Liu, X.Z., Blanco, G., Steel, K.P., Petit, C., and Brown, S.D. 2003. Defects in whirlin, a PDZ domain molecule involved in stereocilia elongation, cause deafness in the whirler mouse and families with DFNB31. Nat. Genet. 34: 421–428.

27. Petit, C. 2006. From deafness genes to hearing mechanisms: harmony and counterpoint. Trends Mol. Med. 12: 57–64.

28. Probst, F.J., Fridell, R.A., Raphael, Y., Saunders, T.L., Wang, A., Liang, Y., Morell, R.J., Touchman, J.W., Lyons, R.H., Noben-Trauth, K., Friedman, T.B., and Camper, S.A. 1998. Correction of deafness in shaker-2 mice by an unconventional myosin in a BAC transgene. Science 280: 1444–1447.

29. Rzadzinska, A.K., Schneider, M.E., Davies, C., Riordan, G.P., and Kachar, B. 2004. An actin molecular treadmill and myosins maintain stereocilia functional architecture and self-renewal. J. Cell Biol. 164: 887–897.

30. Schwander, M., Sczaniecka, A., Grillet, N., Bailey, J.S., Avenarius, M., Najmabadi, H., Steffy, B.M., Federe, G.C., Lagler, E.A., Banan, R., Hice, R., Grabowski-Boase, L., Keithley, E.M., Ryan, A.F., Housley, G.D., Wiltshire, T., Smith, R.J., Tarantino, L.M., and Müller, U. 2007. A forward genetics screen in mice identifies recessive deafness traits and reveals that pejvakin is essential for outer hair cell function. J. Neurosci. 27: 2163–2175.

31. Self, T., Sobe, T., Copeland, N.G., Jenkins, N.A., Avraham, K.B., and Steel, K.P. 1999. Role of myosin VI in the differentiation of cochlear hair cells. Dev. Biol. 15: 331–341.

32. Vollrath, M.A., Kwan, K.Y., and Corey, D.P. 2007. The micromachinery of mechanotransduction in hair cells. Annu. Rev. Neurosci. 30: 339–365.

33. Zheng, L., Sekerková, G., Vranich, K., Tilney, L.G., Mugnaini, E., and Bartles, J.R. 2000. The deaf jerker mouse has a mutation in the gene encoding the espin actin-bundling proteins of hair cell stereocilia and lacks espins. Cell 102: 377–385.


Supplementary Table 1. Microsatellite markers for genotyping developed in this study

Marker name Primer sequence (5’–3’) Ensembl position (bp) Product size (bp)

D9Nok5 F: CACAAGCAAGTACACATTCTAAC 79,234,168 319 R: CCTTGAAACAGCCTAAGGAG 79,234,485D9Nok11 F: CTGGAAGAGAAACTTGAGCAC 79,432,876 371 R: CTGCCTTCACCTATGTTGG 79,433,245D9Nok12 F: GTACAGGATTGGGAGTGTAAC 80,014,625 127 R: CTCCAGTACCCAGGGCCTCAC 80,014,750D9Nok13 F: CCACTAATCCTTTCCTGTTC 80,077,864 130 R: GATGAGGTGCCCACACTCCTG 80,077,992D9Nok14 F: CTTATTGTGATCTAGTGAAC 80,148,582 125 R: CAAGCATCGGGCTCAATATAG 80,148,705D9Nok15 F: GTCATCTATACCCAATGCCAGCAG 82,709,157 345 R: CTGGACAGATCATTAGGGACTGATATCAGC 82,709,500D9Nok16 F: CTATTCACAAGGTATTATTCTAAAATTCTATC 82,798,957 217 R: GATATGGTATTTTATGTTTTATTCTAGCCATC 82,799,172D9Nok18 F: GCACCTCTCACTTCACCCCTACTGCT 82,987,811 243 R: GGTGTGTGCTAAGGCTGAGTCACAC 82,988,052D9Nok21 F: CATTCTGAGAAACCGGACACTGGTAG 86,406,765 278 R: CTCTATGACCACTTCATCAGGCTGG 86,407,041

Supplementary Table 2. List of PCR primers for amplification of 35 exons and the promoter region of Myo6

Primer set Primer name Sequence (5’–3’) Ensembl position (bp)

A M6F1 GTGTACTGGGTCCTTCCATTAATTAATTCC 80,010,835 M6R1 GCTACTGTATTAAAGAGCAACAATCTAGCTC 80,015,443B M6E2-F GAGGAGCAAGAGGTAGTGAGCACAATTG 80,065,257 M6E3-R CACATGGGATGCAGTAACCAACTCGG 80,069,034C M6E4-F GCAGTGTACCCCAAATGGATTTGTCC 80,073,805 M6E5-R GAGCACAGGGTGTGAGGGATGGCACGG 80,076,971D M6E6-F GCTCAGTGCGGAGACAATCTAGCTC 80,089,771 M6E9-R GTGTCCTCCTCCAGAGGTGCTCTC 80,094,554E M6E10-F GTGTATGCCAGGCTGATCCTGG 80,099,392 M6E11-R GCTAGTAATTTGTTCATGGCCATGTAGC 80,103,016F M6E12-F GGTTTCCTGTTGAACTTGC 80,106,030 M6E12-R GTTGGAAGCACAGAATCC 80,106,521G M6E13-F CCCATATAGACACTACATACAAGAGTTGG 80,108,315 M6E16-R GCTGCTGCACTCGACTAAAACTGTATCACC 80,114,282H M6E17-F GTTTCTTGTGTGGTAGGTGTGCACGTGTG 80,117,180 M6E20-R GGTTCACCAGGGACATGTTCGTAGCTG 80,124,388I M6E21-F GGATTTCACATGGGGTTTCCTCATGGCTTC 80,129,042 M6E25-R CTCTGGAGGGTAATATTTTGCCTAACAAC 80,134,435J M6E26-F CCACAGCTAGTTCAAGGTCACCCCAGC 80,135,577 M6E28-R CAAGCAGGATGCTTAAGAAAGCCCAGGAC 80,140,349K M6.seq16-1F GTGAGAGGTATATGCTTTCTGTATAAGGAG 80,140,935 M6.seq16-1R CGTCCTCATCCCATCAGGATGAGATTGAAG 80,144,734L M6E29-F GTTTACTTCTTTGATACCCAAGAGGCAG 80,146,731 M6E31-R CTGACAGGTGACGCCATTGTGTGGTC 80,151,314M M6E32-F CTCTGAATTGGATTCATTAACAGGC 80,154,598 M6.seq3-1R CTACCAACAGTGTGACAACTTGCACCCTGGA 80,159,591


Supplementary Table 3. List of primers for sequencing of genomic regions including 35 exons and the promoter region of the Myo6

Primer name Sequence (5’–3’) Ensembl position (bp)

M6F3 GGCAATCTTGGAGCTAC 80,011,286M6F6 GAGGAGTTGTTTCTCTCC 80,011,714M6F7 TCTGCATGGGAGGCTAG 80,012,131M6F8 TGCAGGGATGCGGTCGG 80,012,409M6F2 ACTGGCCAATGAAGACC 80,012,726M6F4 AGCGGGGCTCCTGTCAC 80,013,132M6F5 CCGGCATAAAGTATGTAGG 80,013,517M6R3 CACTACTAAATCGCCAGC 80,014,890M6R2 TGGGCAAAGGAGGAGAG 80,015,085M6E7-F CGGCTTGCAAATGTAATTCC 80,092,749M6E8-F CCTGTCCACTTGTCAATC 80,093,210M6E14-F GGACAAGGTATTTCTGATACC 80,109,910M6E15-F GGCTGCAAGGGTCTAAACTTAG 80,111,998M6E17-sF CCTTATGAGTTTCGGTTAC 80,117,335M6E18-R GCAATTAAGATATTTAGCAC 80,117,980M6E19-F GCCATTTTGCATGATGC 80,121,554M6E22-F GAGCCTCGTTCCATGAACTC 80,129,313M6E23-F GGACCATGACATGTAGTC 80,131,080M6E24-F CCAGGACAGTTGGGTAACAAC 80,133,291M6E27-F CTGTCAGGGCTCAATGCTAC 80,137,453M6.seq16-1sF CTCTGGAGTCTGCACTGTG 80,315,791M6.seq-8sF CCAAGTTTCCTGCGTGC 80,318,728M6E29-sF CTGACACATCTAACCTC 80,146,829M6.seq3-1F CTCCAATCCATGAGAATTGTTGGGTGTTCGG 80,155,385M6.seq3-5sF CCTGCTCAAGTAGACCGC 80,155,665M6.seq3-1sF GCAGTGTGCTTAGCGCC 80,156,192M6.seq3-1sR GAGCCGCCTATGCTGAGC 80,156,295M6.seq3-6sF CTCCTGATCAGATGTCAG 80,156,728M6.seq3-3sR GGAGTGTGAAGAATAG 80,156,878M6.seq3-2sF CATGCTCAGAAGCCTTGG 80,156,934M6.seq3-7sF GTGGCGTGTCAGCTTAGC 80,157,312M6.seq3-3sF CATAGCACCCAGAGCCTCC 80,157,636M6.seq3-8sF GATTGAGCCCCTTCACTG 80,158,071M6.seq3-4sF ATGCCTTTGCTCTAGCCG 80,158,681M6.seq3-2sR CTCCACTGTTAGAGTGTC 80,158,839


Supplementary Table 4. List of primers for sequencing of Myo6 cDNA

Primer name Sequence (5’–3’) Position (ENSMUST00000035889)

Myo6F1 CCGGGAGATAGTGGATAACCTCCTTCA 187Myo6R11 GTTAAGCTGTCAGGGCCAATATCCAC 304Myo6R2 CTGACTCGAAGATCATCTTGGTCCAAG 1381Myo6F4 GTCTCTTGAATCCTTGATATGTGAGTC 2024Myo6R6 AAGTTGGGTTTGATGCAGCGGATGAAG 2233Myo6F7 AAAGCTCAGAAGATCTCCTCAGTGCAC 2926Myo6F9 ATTGAGCTCCTGGCAGCTTGCAGAG 3495Myo6R10 CATAATCAGTAACCGAC 3624Myo6F2 CATGCTGCAGAACCTGCTCAAGTAG 4046Myo6R5 TTCTACCAGGAGCAAGGAAGTGGTGAG 4152Myo6R3 AGTCTTGTCCTTGACAATACTCAGC 4384Myo6F6 TGGTGTTCTGTGACTCTATTGGACTG 4838Myo6R4 CTGTCCGAAGCAGTACAC 4964Myo6R1 CAGTAACTACACCTCTGCCATCAATCAC 5564

Supplementary Table 5. List of primers for sequencing of Slc17a5 cDNA

Primer name Sequence (5’–3’) Position (ENSMUST00000052441)

Slc17a5F TGCCGAGAGCTAGGTTGGCCAAGCAACG 5Slc17a5R1 AGAGCCGAGAATCCACC 402Slc17a5R2 TATCACTGACTATCCAC 795Slc17a5F1 ATCCTCTGTGGTCAAGC 1087Slc17a5R3 CCTATAAATCCAGCCG 1218Slc17a5R CAGTAACTACACCTCTGCCATCAATCAC 1624

phenotypic and expression analysis of a novel...

Documents