secuenciacion maxan

8/12/2019 Secuenciacion maxan

1/6

A New Method for Sequencing DNAAuthor(s): Allan M. Maxam and Walter GilbertSource: Proceedings of the National Academy of Sciences of the United States of America,Vol. 74, No. 2 (Feb., 1977), pp. 560-564Published by: National Academy of SciencesStable URL: http://www.jstor.org/stable/66230Accessed: 19/09/2008 15:34

Your use of the JSTOR archive indicates your acceptance of JSTOR's Terms and Conditions of Use, available at

http://www.jstor.org/page/info/about/policies/terms.jsp. JSTOR's Terms and Conditions of Use provides, in part, that unless

you have obtained prior permission, you may not download an entire issue of a journal or multiple copies of articles, and you

may use content in the JSTOR archive only for your personal, non-commercial use.

Please contact the publisher regarding any further use of this work. Publisher contact information may be obtained at

http://www.jstor.org/action/showPublisher?publisherCode=nas.

Each copy of any part of a JSTOR transmission must contain the same copyright notice that appears on the screen or printed

page of such transmission.

JSTOR is a not-for-profit organization founded in 1995 to build trusted digital archives for scholarship. We work with the

scholarly community to preserve their work and the materials they rely upon, and to build a common research platform thatpromotes the discovery and use of these resources. For more information about JSTOR, please contact [email protected].

National Academy of Sciencesis collaborating with JSTOR to digitize, preserve and extend access to

Proceedings of the National Academy of Sciences of the United States of America.

htt // j t
http://www.jstor.org/stable/66230?origin=JSTOR-pdfhttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/action/showPublisher?publisherCode=nashttp://www.jstor.org/action/showPublisher?publisherCode=nashttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/stable/66230?origin=JSTOR-pdf


2/6

Proc. Natl. Acad.Sci. USAVol.74, No. 2, pp. 560-564, February1977Biochemistry

A new method for sequencing DNA(DNAchemistry/dimethylsulfate cleavage/hydrazine/piperidinALLAN M. MAXAM AND WALTER GILBERTDepartment f Biochemistrynd MolecularBiology,HarvardUniversity,CambriContributedbyWalterGilbert,December9, 1976ABSTRACT DNA can be sequenced by a chemical proce-dure that breaks a terminally labeled DNA molecule partiallyat each repetitionof a base. The lengths of the labeled fragmentsthen identify the positions of that base. We describe reactionsthat cleave DNA preferentially at guanines, at adenines, at cy-tosines and thymines equally, and at cytosines alone. When theproducts of these four reactions are resolved by size, by elec-trophoresison a polyacrylamide gel, the DNA sequence can beread from the pattern of radioactive bands. The technique willpermit sequencing of at least 100 bases from the point of la-beling.We have developed a new technique for sequencing DNAmolecules. The procedure determines the nucleotide sequenceof a terminally labeled DNA molecule by breaking it at ade-nine, guanine, cytosine, or thymine with chemical agents.Partialcleavage at each base producesa nested set of radioactivefragments extending from the labeled end to each of the posi-tions of that base. Polyacrylamide gel electrophoresis resolvesthese single-stranded fragments; their sizes reveal in order thepoints of breakage.The autoradiographof a gel produced fromfour different chemical cleavages, each specific for a base ina sense we will describe, then shows a pattern of bands fromwhich the sequence can be read directly. The method is limitedonly by the resolving power of the polyacrylamide gel; in thecurrent state of development we can sequence inward about100 bases from the end of any terminally labeled DNA frag-ment.We attack DNA with reagents that first damage and thenremove a base from its sugar. The exposed sugar is then a weakpoint in the backbone and easily breaks; an alkali- or amine-catalyzed series of --eliminationreactions will cleave the sugarcompletely from its 3' and 5' phosphates. The reaction with thebases is a limited one, damaging only 1 residue for every 50 to100 bases along the DNA. The second reaction to cleave theDNA strand must go to completion, so that the molecules finallyanalyzed do not have hidden damages. The purine-specificreagent is dimethyl sulfate; the pyrimidine-specific reagent ishydrazine.The sequencing requires DNA molecules, either double-stranded or single-stranded, that are labeled at one end of onestrand with 32P. This can be a 5' or a 3' label. A restrictionfragment of any length is labeled at both ends-for example,by being first treated with alkaline phosphatase to removeterminal phosphatesand then labeled with 32pby transfer from'y-labeledATP with polynucleotide kinase. There are then twostrategies: either (i) the double-stranded molecule is cut by asecond restriction enzyme and the two ends are resolved on apolyacrylamide gel and isolated for sequencing or (ii) thedoubly labeled molecule is denatured and the strands are sep-arated on a gel (1), extracted, and sequenced.

56

e)

Ige,Massachusetts2138

THE SPECIFIC CHEMISTRYA Guanine/Adenine Cleavage (2). Dimethyl sulfatemethylates the guanines in DNA at the N7 position and theadenines at the N3 (3). The glycosidic bond of a methylatedpurine is unstable (3, 4) and breakseasily on heating at neutral

pH, leaving the sugar free. Treatment with 0.1 M alkali at 90?then will cleave the sugar from the neighboring phosphategroups. When the resulting end-labeled fragments are resolvedon a polyacrylamide gel, the autoradiographcontains a patternof dark and light bands. The dark bands arise from breakageat guanines, which methylate 5-fold faster than adenines (3).This strong guanine/weak adenine pattern contains almosthalf the information necessary for sequencing; however, am-biguities can arise in the interpretation of this pattern becausethe intensity of isolated bands is not easy to assess.To determinethe bases we compare the information contained in this columnof the gel with that in a parallel column in which the breakageat the guanines is suppressed, leaving the adenines apparentlyenhanced.An Adenine-Enhanced Cleavage. The glycosidic bond ofmethylated adenosine is less stable than that of methylatedguanosine (4); thus, gentle treatment with dilute acid releasesadenines preferentially. Subsequent cleavage with alkali thenproduces a pattern of dark bands corresponding to adenineswith light bands at guanines.Cleavage at Cytosines and Thymines. Hydrazine reactswith thymine and cytosine, cleaving the base and leaving ri-bosylurea (5-7). Hydrazine then may react further to producea hydrazone (5). After a partial hydrazinolysis in 15-18 Maqueous hydrazine at 20?, the DNA is cleaved with 0.5 M pi-peridine. This cyclic secondaryamine, as the free base, displacesall the products of the hydrazine reaction from the sugars andcatalyzes the /-elimination of the phosphates.The final patterncontains bands of similar intensity from the cleavages at cy-tosines and thymines.Cleavage at Cytosine. The presence of 2 M NaCl prefer-entially supresses the reaction of thymines with hydrazine.Then, the piperidine breakage produces bands only from cy-tosine.

AN EXAMPLEConsider a 64-base-pair DNA fragment, cut from lac operonDNA by the Alu I enzyme from Arthrobacter luteus, whichcleaves flush at an AGCT sequence between the G and the C(8). After dephosphorylation, the two 5' ends of this fragmentwere labeled with 32P.The autoradiographin Fig. 1 shows thatthe two strands separate during electrophoresis, after dena-turation,on a neutral polyacrylamide gel (1); they can be easilyexcised and extracted. For each strand, aliquots of the four

0


3/6

Biochemistry:Maxamand Gilbertcleavagereactions strongG/weak A,strongA,strongC, andC + T) wereelectrophoresed t 600-1000 V on a 40-cm20polyacrylamide/7 M urea gel. Twelve hours ater,a secondportionof eachsamplewasloadedon thegel andelectropho-resiswas continued.Fig. 2 displaysautoradiographshowingtwo regionsof the sequenceof each strandderived from thissinglegel:onecloseto the labeledendof the molecule n thosesamples hat hadbeen electrophoresedn a shorttime,and aregionfurther nto the moleculeexpandedby electrophoresisfor a longertime. The sequencecan easilybe readfrom thepatternof bands. The spacingbetween fragmentsdecreases(roughlyasaninverse quare) romthe bottom oward he topof the gel. The slightvariationsn the spacingaresequence-specific and reflect the last nucleotideadded, a T or G de-creasing he mobilitymorethan anA or C. Thefragmentsonthe gel end with the basejustbeforethe one destroyedby thechemicalattack;helabelson the bands n thefigurerepresentthe attackedbases.In Fig. 2, 62 basescan be read for bothstrands,helast2 basesatthe two5' endsnotbeingdeterminedby thisgel. Thesequenceof eachstrandsconsistentwithandconfirms hatof the other:pXXGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGT(

GACCGTGCTGTCCAAAGGGCTGACCTTTCGCCCGTCAFig. 3 is an expansionof one regionof the sequencinggel toshowthe basespecificityof the cleavagereactions.

DISCUSSIONThe chemicalsequencingmethodhas certainspecificadvan-tages.First, he chemical reatment seasytocontrol;he idealchemicalattack, ne basehitperstrand,produces rather vendistribution f labeled materialacross he sequence.Second,each base sattacked,o that na runof any singlebaseall thosearedisplayed.The chemicaldistinctionbetween the differentbasesis clear, and, as in our example, the sequenceof bothstrandsprovidesa more-than-adequateheck.We have chosen this specific set of chemical reactions oprovidemore hanenough nformationorthesequencing.TheTechniques ectiondescribes nother eaction hatdisplaysheGsaloneas well as an alternative eactionorbreaking t AsandCs.However, t is more usefulto have a strongG/weak A dis-play, in which there is generallyenoughinformation o dis-tinguish oth he GsandtheAs, han ustapureGpattern lone,becauseredundant nformation ervesas a checkon the iden-tifications. n principle,one couldsequenceDNA with threechemicalreactions,each of single-base pecificity, usingtheabsenceof a band to identifythe fourthposition.Thiswouldbe a nonredundantmethod n whicheverybit of informationwasrequired. uchanapproachssubjectoconsiderablerror,and any hesitation n the chemistrywould be misinterpretedasa differentbase. For thatreasonwe have chosenredundantdisplays,whichincreaseone'sconfidence n the sequencing.5-Methylcytosineand N6-methyladenineare occasionallyfound in DNA. 5-Methylcytosine an be recognizedby ourmethodbecause hemethylgroup nterfereswith theactionofhydrazine [thymine reacts far more slowly than does uracil (5)];thus,a 5-methylcytosine leavagedoesnotappear n the pat-tern,producinga gapin the sequenceoppositea guanine(ob-served in this laboratoryby J. Tomizawa and H. Ohmori).However,we do notexpect o recognize nN6-methyladenine;the glycosidicbond should not be unstable,and an earliermethylationof adenine at the N6position houldnot preventthe latermethylationat N3.These methods work equally well on double- or single-

Proc. Natl. Acad. Sci. USA 74 (1977) 561stranded DNA. There are sequence-specificeffects on themethylationreactionwith double-strandedDNA thatdo notappearwith single-strandedDNA:in the sequenceGGAthereactivityof themiddleGissuppressed;n thesequenceAAAthe reactivityof the centralA isenhanced.Sincetheseeffectsare absentwithsingle-stranded NA,they mustarise hroughsterichindrance rstackingnteractions;owever, heydo notinterfere with sequencingbecausethey appearequivalentlyinbothdisplaysof the base.Althoughnsingle-strandedDNAthe NI of adenine sexposed omethylationandshouldmeth-ylateasreadilyastheN7 ofguanine,methylation tthispositiondoesnotdestabilize denineonthesugar.Underourconditionsthe methylgroupwillmigrate o the N6 positionand theextrachargewill disappear 3).The sequencingmethod is limited only by the resolutionattainable n the gel electrophoresis.On 40-cm gels we can,withoutambiguities, equenceout to 100 bases romthepointof labeling.If there is otherinformationavailable o supportthe sequencing, uch as an aminoacidsequence,onecanoftenread urther.Theavailabilityfrestrictionndonucleasess nowsuch thatany DNA molecule,obtainable rom a phage,virus,orplasmid,can be sequenced.

IAGCGCAACGCAATTAATGTGAGTTAGITCGCGTTGCGTTAATTACACTCAAXXp

TECHNIQUES['y-32P]ATP Exchange Synthesis (9). The specific activityroutinely attains 1200 Ci/mmol. Dialyze glyceraldehyde-3-

phosphate dehydrogenase against 3.2 M ammonium sulfate,pH 8/50 mM Tris-HCl,pH 8/10 mM mercaptoethanol/1 mMEDTA/0.1 mM NAD+; and dialyze 3-phosphoglycerate kinase(ATP:3-phospho-D-glycerate1-phosphotransferase,EC 2.7.2.3)against the same solution minus NAD+ (enzymes from Cal-biochem). Combine 50 uAlf the dialyzed dehydrogenase and25 Alof the dialyzed kinase, sediment at 12,000 X g, and re-dissolve the pellet in 75 ,tl of twice-distilled water to removeammonium sulfate. Dissolve 25 mCi (2.7 nmol) of HCl-free,carrier-free 32Pi in 50 Alof 50 mM Tris-HCl, pH 8.0/7 mMMgC12/ 0.1 mM EDTA/2 mM reduced glutathione/1 mMsodium 3-phosphoglycerate/0.2 mM ATP (10 nmol); add 2 Alof the dialyzed, desalted enzyme mixture, and allow to reactat 25?. Follow the reaction by thin-layer chromatography onPEI cellulose in 0.75 M sodium phosphate, pH 3.5, by autora-diography of the plate. At the plateau, usually 30 min, add 250Al1 f twice-distilled water and 5 tl of 0.1 M EDTA, mix, andheat at 90? for 5 min to inactivate the enzymes. Then chill, add700 ,l of 95 ethanol, mix well, and store at -20?. The theo-retical limit of conversion is 79 , and if this is achieved the[y-32P]ATP would have a specific activity near 2000 Ci/mmol.Labeling 5' Ends. 5'-Phosphorylation (10, 11) includes aheat-denaturation in spermidine which increases the yield15-fold with flush-ended restriction fragments. Dissolve de-phosphorylated DNA in 75 Alof 10 mM glycine-NaOH, pH9.5/1 mM spermidine/O.l mM EDTA; heat at 100? for 3 minand chill in ice water. Then add 10 Alof 500 mM glycine-NaOH, pH 9.5/100 mM MgC12/50mMdithiothreitol,10Alof ['y-32P]ATP100pmolormolarequivalentof DNA5'ends,1000Ci/mmol), andseveralunitsof polynucleotidekinase oa finalvolumeof 100A1.Heatat37? for30 min;add 100Alof4 Mammoniumacetate,203g of tRNA,and600A1 f ethanol,mix well,chill at -70?, centrifugeat 12,000X g, removethesupernatant hase,rinse hepelletwithethanol,anddryundervacuum.


4/6

562 Biochemistry:MaxamandGilbert

0A..

ORIGIN -

'XC

SLOW

FAST :

FIG. 1. Strandseparationof a restriction ragment:1.5jg of a64-base-pairDNAfragment 75pmolof5'ends)wasphosphorylatedwith[y-32P]ATP800Ci/mmol)andpolynucleotide inase,denaturedinalkali,ayeredntoa0.3cmX3cmsurfacefan8 olyacrylamideslabgel(seeunderTechniques),ndelectrophoresedt200V(reg-ulated)and20mA(average), ntil the xylenecyanol XC)dyemoved9 cm.Thegelononeglassplatewas hen ightly overed ithSaranWrap ndexposedoKodakXR-5x-ray ilm or10min.Labeling 3' Ends. To adenylatewith [a-32P]ATPnd ter-minaltransferase 12),dissolveDNA in 70 Alof 10 mMTris-HCI,pH7.5/0.1 mMEDTA,heat at 100?for 3 min,and chillat 0?.Thenadd, norder,10 tl of 1.0 Msodium acodylate pH6.9),2 Alof 50 mMCOC12, ix,2Alof 5 mMdithiothreitol,10Alof [a-32P]ATP500pmol,100Ci/mmol), andseveralunitsof terminalransferaseoa finalvolumeof 100Al.Heatat 37?forseveralhours,add100Alof 4 Mammoniumacetate,20 Agof tRNA,and 600 A1of ethanol,and precipitate,centrifuge,rinse,anddrythe DNAasdescribedabove.Dissolve hepelletin 40 Alof 0.3 M NaOH/1 mMEDTA,heatat 37? for 16 hr,andeitheraddglycerolanddyesforstrand eparation rneu-tralize,ethanolprecipitate,and renature he DNA for secon-daryrestriction leavage.Strand Separation. Dissolvethe DNA in 50 Alof 0.3 MNaOH/10 glycerol/l mM EDTA/0.05 xylene cyanol/0.05 bromphenol blue. Load on a 5-10 acrylamide/0.16-0.33 bisacrylamide/50mMTris-borate,H8.3/1 mMEDTAgelandelectrophorese.Theconcentration f DNAen-teringthe gel iscriticalandmustbe minimizedto preventre-naturation.Use thickgelswith wide slots(0.3- to 1-cm-thickslabswith 3-cm to full width slots),and runcool (at25?).Gel Elution.Insertan excised egmentof thegelintoa 1000Al(blue)Eppendorf ipette ip,plugged ightlywithsiliconized

Proc. Natl. Acad. Sci. USA 74 (1977)glass wool and heat-sealed at the point. Grind the gel to a pastewith a siliconized 5-mm glass rod, add 0.6 ml of 0.5 M ammo-nium acetate/0.01 M magnesium acetate/0.1 sodium dodecylsulfate/0.1 mM EDTA (and 50 Agof tRNA carrier if the DNAhas already been labeled); seal with Parafilm and hold at 37?for 10 hr. Cut off the sealed point, put the tip in a siliconized10 X 75 mm tube, centrifuge for a few minutes, rinse with 0.2ml of fresh gel elution solution, and alcohol precipitatetwice.

Partial Methylation of Purines. Combine 1 ulof sonicatedcarrier DNA, 10 mg/ml, with 5 Agof 32P-end-labeled DNA in200 Al f 50 mM sodium cacodylate, pH 8.0/10 mM MgCI2/0.1mM EDTA. Mix and chill in ice. Add 1 tl of 99 (10.7 M) di-methyl sulfate, mix, cap, and heat at 20? for 15 min. To stopthe reaction, add 50 Alof a stop solution (1.0 M mercaptoeth-anol/1.O M Tris-acetate,pH 7.5/1.5 M sodium acetate/0.05 Mmagnesium acetate/0.001 M EDTA), 1 mg/ml of tRNA, andmix. Add 750 Al (3 volumes) of ethanol, chill, and spin.Reprecipitate from 250 Alof 0.3 M sodium acetate, rinse withalcohol, and dry.Strong Guanine/Weak Adenine Cleavage. Dissolvemethylated DNA in 20 Al of 10 mM sodium phosphate, pH7.0/1 mM EDTA, and collect the liquid on the bottom of thetube with a quick low-speed spin. Close the tube and heat in awater bath at 90? for 15 min. Chill in ice and collect the con-densate with a quick low-speed spin. Add 2 Alof 1.0 M NaOH,mix, and draw the liquid up into the middle of a pointed glasscapillary tube, seal with a flame, and hold at 90? for 30 min.Open the capillary and empty into 20 Alof urea-dye mixture,heat, and layer on the gel.Strong Adenine/Weak Guanine Cleavage. Dissolvemethylated DNA in 20 Al of distilled water. Chill to 0?, add 5Alof 0.5 M HCI, mix, and keep the sample at 0? in ice, mixingoccasionally.After 2 hr, add 200 Alof 0.3 M sodium acetate and750 Atl f ethanol, chill, spin, rinse,and dry. Then dissolve in 10

Alof 0.1 M NaOH/1 mM EDTA and heat at 90? for 30 min ina sealed capillary. Add contents to urea-dye mixture, heat, andlayer.An Alternative Guanine Cleavage. Dissolve methylatedDNA in 20 Alof freshly diluted 1.0 M piperidine. Heat at 90?for 30 min in a sealed capillary. [This reaction opens 7-MeGadjacent to the glycosidic bond (13), displaces the ring-openedproduct from the sugar, and eliminates both phosphates tocleave the DNA wherever G was methylated.] Return thecontents of the capillary to the reaction tube, lyophilize, wetthe residue, and lyophilize again. Finally, dissolve the last res-idue in 10 Alof 0.1 M NaOH/1 mM EDTA and prepare for thegel.An Alternative Strong Adenine/Weak Cytosine Cleavage.

Combine 20 Alof 1.5 M NaOH/1 mM EDTA with 1 1Alf son-icated carrier DNA (10 mg/ml) and 5 Al of.32P end-labeledDNA, and heat at 90? for 30 min in a sealed capillary. [Thestrong alkali opens the adenine and cytosine rings (13); then,the ring-opened products can be displaced and phosphateseliminated with piperidine.] Rinse the capillary into 100 ,l of1.0 M sodium acetate, add 5 ul of tRNA (10 mg/ml), add 750Alof ethanol,chill,spin,rinse,anddry.Dissolve he pellet in20 A1f freshlydiluted1.0 Mpiperidine, ndheat at 90?for30min in a sealedcapillary.Lyophilizetwice, dissolvethe lastresidue n 10A1 f 0.1 MNaOH/l mMEDTA, andaddurea-dye mixture.Cleavage at Thymine and Cytosine. Combine 20 Al ofdistilledwater,1 A1 f sonicated arrierDNA (10mg/ml), and5 Alof 32pend-labeledDNA. Mixandchill at 0?. Add 30A1 f


5/6

Biochemistry:MaxamandGilbert

FAST STRAND

A>G G>A C C+TA>GG>A C C+T

TG GA 6

A AC6 '~A~~~~

AAAG

TC

FIG. 2. Autoradiographf a sequencinggelof the complementaryactions, are shown for each strand; cleavages proximal to the 5' end are aband in the second arises from an A;a strong band in the second columnand fourth columns is a C; and a band only in the fourth column is a T.panelandreadupwarduntil the bandsarenotresolved;hen,pickuptheof eachstrand, solatedfromthe gelofFig.1,wasusedfor eachof the befor 30 min to reactwithA andG;hydrazine reatmentwas 18Mfor 301C. After strand breakage, half of the products from the four reactions \slabgel,pre-electrophoresedt 1000V for2 hr.Electrophoresist 20 Wthe xylenecyanoldye had migratedhalfwaydownthe gel.Then the resthe new bromphenol blue dye moved halfway down. Autoradiography (95 30 M)hydrazine*,mix well, and keep at 0? for severalminutes. Close the tube and heat at 20? for 15 min. Add 200 1Alof cold 0.3 M sodium acetate/O.01 M magnesium acetate/O.ImM EDTA/0.25 mg/ml tRNA, vortex mix, add 750 Alof eth-anol, chill, spin, dissolve the pellet in 250 Alof 0.3 M sodiumacetate, add 750 Alof ethanol, chill, spin, rinse with ethanol, anddry. Dissolve the pellet and rinse the walls with 20 Alof freshlydiluted 0.5 M piperidine. Heat for 30 min at 90? in a sealedcapillary. Lyophilize twice, dissolve in 10 Alof 0.1 M NaOH/1mM EDTA, add urea-dye mixture, heat, and layer on gel.Cleavage at Cytosine. Replace the water in the hydrazino-lysis reaction mixture with 20 Al of 5 M NaCl, and increase thereaction time to 20 min. The freshness and the concentrationof the hydrazineare criticalforbase-specificity.Reaction Times. The reaction conditions provide a uni-formly abeledset of partialproductsof chain length1 to 100.To distribute he labelover a shorterregion, increase he re-actidntime,andvice versa.* CAUTION: Hydrazines a volatileneurotoxin.Dispensewith care na fumehood, nd nactivatet withconcentratederric hloride.

Proc.Natl. Acad. Sci. USA74 (1977) 563

SLOW STRAND

A>G G>A C C+T

A T

A>GG>A C C+T

A T7 . .A C

C C

T T

T . . ....C

C CA

T

,... *C

trandsof a 64-base-pairDNAfragment.Twopanels,eachwith four re-t he bottomon the left.Astrongband nthe first columnwith a weakerwitha weakerband nthe firstis a G;a bandappearingnboththe thirdTo derivethe sequenceof eachstrand,beginat the bottom of the leftpatternat the bottomof therightpanelandcontinueupward.One-tenth.se-modification eactions.The dimethylsulfatetreatmentwas 50mMainto react with C andT and 18 Mwith2 MNaCl for 40 minto cleavevere ayeredon a 1.5 X 330 X 400 mmdenaturing20 polyacrylamide(constant ower),800 V (average), nd 25mA(average)proceededuntilt of the sampleswere ayeredand electrophoresiswas continueduntilf the gel for8 hrproduced he patternshown.

Reaction Vessels. We use 1.5-ml Eppendorf conical poly-propylene tubes with snap caps, treated with 5 (vol/vol) di-methyldichlorosilane in CC14and rinsed with distilled water.Alcohol Precipitation, Wash, and Rinse. Unless otherwisespecified, the initial ethanol precipitation is from 0.3 M sodiumacetate/0.01 M magnesium acetate/0.1 mM EDTA, with 50tg of tRNA as carrier.Add 3 volumes of ethanol, cap and invertto mix, chill at -70? in a Dry Ice-ethanol bath for 5 min, andspin in the Eppendorf 3200/30 microcentrifuge at 15,000 rpm(12,000 X g) for 5 min. Reprecipitatewith 0.3 M sodium acetateand 3 volumes of ethanol, chill, and spin. Rinse the final pelletwith I ml of cold ethanol, spin, and dry in a vacuum for severalminutes.Gel Samples. All samples for sequencing gels are in 10 or 20A1cf 0.1 M NaOH/l mM EDTA to which is added an equalvolumeof 10 Murea/0.05 ylene cyanol/0.05 romphenolblue. Heat the sampleat 90? for 15 sec, then layer on thegel.Sequencing Gels. These are commonly slabs 1.5 mm X 330mm X 400 mm with 18samplewells 10 mmdeep and 13 mm


6/6

564 Biochemistry: Maxam and Gilbert

T

TTAATT

~~* ACAC

T

F'(I. 3. I)etail of the sequence gel. The four lanes are (from leftto right) A > G, G > A, C, C + T; the dots show the position of thebromphenol blue dye marker, between fragments 9 and 10 long.wide separated by 3 mm (fitting on a 35.5 X 43 cm x-ray film).They are 20 (wt/vol) acrylamide (Bio-Rad)/0.67 (wt/vol)inethylene bisacrylamide/7 M urea/50 mM Tris-borate, pH8.3/1 mM EDTA/3 mM ammonium persulfate; 300 ml of gelsolution is polymerized with TEMED within 30 min (generally50 Al of TEMED). Age the gel at least 10 hr before using it.Electrophorese with some heating (30-40?), to help keep theDNA denatured, between 800 and 1200 V. Load successivelywhenever the previous xylene cyanol has moved halfway downthe gel. Bromphenol blue runs with 10-nucleotide-long frag-

Proc. Natl. Acad. Sci. USA 74 (1977)ments, xylene cyanol with 28. With three loadings at 0, 12, and24 hr, a 1000-V run for 36 hr permits reading more than 100bases. To sequence the first few bases from the labeled end, usea 25 acrylamide/0.83 bisacrylamide gel in the usual ureabuffer and pre-electrophorese this gel for 2 hr at 1000 V.

Autoradiography. Freeze the gel for autoradiography. Re-move one glass plate, wrap the gel and supporting plate withSaran Wrap, and mark the positions of the dyes with 14C-con-taining ink. Place the gel in contact with film in a light-tightx-ray exposure holder (backed with lead and aluminum) at-20? under pressure from lead bricks.Special Materials. Dimethyl sulfate (99 ) was purchasedfrom Aldrich Chemical Co., hydrazine (95 ) from EastmanOrganic Chemicals, and piperidine (99 )from Fisher Scien-tific; these were used without further purification.This work was supported by National Institute of General MedicalSciences,GrantGM09541.W.G. s anAmericanCancerSocietyPro-fessor of Molecular Biology.

1. HIayward,G. S. (1972) Virology 49, 342-344.2. Gilbert,W., Maxam,A. &Mirzabekov,A. (1976) n ControlofRibosome Synthesis, eds. Kjeldgaard, N. 0. & Maal0e, 0.(Munksgaard, Copenhagen), pp. 139-148.3. Lawley,P. 1). &Brookes,P. (1963)Biochem.J. 89, 127-1284. Kriek,E. & Emmelot,P. (1964) Biochimn. iophys.Acta 91,59-66.5. Temperli,A., Turler,II., Rust,P., Danon,A. &Chargaff,E.(1964)Biochim.Biophys.Acta 91, 462-476.6. Hayes, D. II. & HIayes-Baron,F. (1967) J. Chem. Soc., 1528-1533.7. Cashmore,A.R.&Petersen,G. B.(1969)Biochimn.iophys.Acta174, 591-603.8. Roberts,R.J., Myers, P. A., Morrison,A. &Murray, K. (1976) J.Mol. Biol. 102,157-165.9. Glynn, I. M. & Chappell, J. B. (1964) Biochem.J. 90, 147-149.10. van de Sande,J. H., Kleppe,K. &Khorana,HI.G. (1973)Bio-chemistry12,5050-5055.11. Lillehaug,J. R. & Kleppe,K. (1975)Biochemistry14, 1225-1229.12. Roychoudhury,R.,Jay,E. &Wu,R.(1976)NucleicAcids Res.3, 863-878.13. Kochetkov, N. K. &Budovskii, E. I. (1972) Organic Chemistryof Nucleic Acids(Plenum,New York),PartB,pp.381-397.

secuenciacion maxan

Documents