soybean β-conglycinin-induced gut hypersensitivity reaction in a piglet model
TRANSCRIPT
This article was downloaded by: [Pennsylvania State University]On: 21 November 2014, At: 17:06Publisher: Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954 Registeredoffice: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Archives of Animal NutritionPublication details, including instructions for authors andsubscription information:http://www.tandfonline.com/loi/gaan20
Soybean β-conglycinin-induced guthypersensitivity reaction in a pigletmodelYue Hao a , Zhenfeng Zhan a , Pengfei Guo a , Xiangshu Piao a &Defa Li aa State Key Laboratory of Animal Nutrition , China AgriculturalUniversity , Beijing, P.R. ChinaPublished online: 09 Jun 2009.
To cite this article: Yue Hao , Zhenfeng Zhan , Pengfei Guo , Xiangshu Piao & Defa Li (2009)Soybean β-conglycinin-induced gut hypersensitivity reaction in a piglet model, Archives of AnimalNutrition, 63:3, 188-202
To link to this article: http://dx.doi.org/10.1080/17450390902860026
PLEASE SCROLL DOWN FOR ARTICLE
Taylor & Francis makes every effort to ensure the accuracy of all the information (the“Content”) contained in the publications on our platform. However, Taylor & Francis,our agents, and our licensors make no representations or warranties whatsoever as tothe accuracy, completeness, or suitability for any purpose of the Content. Any opinionsand views expressed in this publication are the opinions and views of the authors,and are not the views of or endorsed by Taylor & Francis. The accuracy of the Contentshould not be relied upon and should be independently verified with primary sourcesof information. Taylor and Francis shall not be liable for any losses, actions, claims,proceedings, demands, costs, expenses, damages, and other liabilities whatsoever orhowsoever caused arising directly or indirectly in connection with, in relation to or arisingout of the use of the Content.
This article may be used for research, teaching, and private study purposes. Anysubstantial or systematic reproduction, redistribution, reselling, loan, sub-licensing,systematic supply, or distribution in any form to anyone is expressly forbidden. Terms &Conditions of access and use can be found at http://www.tandfonline.com/page/terms-and-conditions
Soybean b-conglycinin-induced gut hypersensitivity reaction in a piglet
model
Yue Hao, Zhenfeng Zhan, Pengfei Guo, Xiangshu Piao and Defa Li*
State Key Laboratory of Animal Nutrition, China Agricultural University, Beijing, P.R. China
(Received 5 November 2008; accepted 16 February 2009)
Soybean is a major protein source in human and animal nutrition, but has alsobeen described as a source of allergenic reactions. The objective of this study wasto investigate anaphylactic reactions induced by purified soybean b-conglycinin in10-day old piglets, and to elaborate the molecular and cellular mechanisms ofintestinal injury resulting from soybean hypersensitivity. We investigated the oralallergy syndrome and anaphylactic reactions in piglets caused by soybean b-conglycinin with an intragastric feeding protocol without using an adjuvant.Physical symptoms, including lethargy, diarrhoea and respiratory distress weremonitored to determine the anaphylactic reactions. Immunological assessmentwas conducted through measurement of immunoglobulin E (IgE) antibodyconcentration. Jejunal tissue was assessed for morphologic changes after the oralchallenge, and histamine release, mRNA expression and endogenous productionof cytokines were analysed. The results showed that b-conglycinin reducedgrowth of piglets, and after oral challenge, sensitised piglets displayed signs ofallergic hypersensitivity. Furthermore, the levels of both total IgE and antigen-specific IgE in the sera were increased. Histological examination of jejunumrevealed intestinal morphology damage, higher levels of interleukin-4, interferon-g and significant levels of histamine were detected in the tissues. Our resultsindicate that purified b-conglycinin possesses intrinsic immune-stimulatingcapacity and can induce an allergic reaction, which was IgE mediated. Both Thelper2 and T helper1 responses may play important roles in the intestinal injuryresulting from soybean hypersensitivity.
Keywords: soybean protein; b-conglycinin, food allergies; histamine; IgE; piglets
1. Introduction
Because of their nutritional and functional benefits, soybean proteins are majorcomponents of the diet of food-producing animals (Hancock et al. 2000) and areincreasingly important in the human diet (Lusas and Riaz 1995). However, soybeanhas been also identified as an important allergenic source (Cordle 2004). With anincreasing use of soybean protein in feed industry, more and more people have beeninterested in its allergenicity because of its potential ability to cause hypersensitivityin young animals, such as neonatal piglets and young cattle (Li et al. 1991; Dreauet al. 1994; Lalles et al. 1996a). The typical symptoms are disorders of immunefunction and growth depression in animals.
*Corresponding author. Email: [email protected]
Archives of Animal Nutrition
Vol. 63, No. 3, June 2009, 188–202
ISSN 1745-039X print/ISSN 1477-2817 online
� 2009 Taylor & Francis
DOI: 10.1080/17450390902860026
http://www.informaworld.com
Dow
nloa
ded
by [
Penn
sylv
ania
Sta
te U
nive
rsity
] at
17:
06 2
1 N
ovem
ber
2014
b-conglycinin is a primary storage protein and it has been identified as one of themajor allergenic proteins in soybean (Ogawa et al. 1995; Lalles et al. 1999). Previousresults showed that soybean protein can destroy intestinal morphology andimmunologic function in early-weaned pigs (Li et al. 1990; Qiao et al. 2003) andrats (Li et al. 2003; Tang et al. 2006; Guo et al. 2007). But most research conductedon the allergenic effects of soybean b-conglycinin in animals has used soybean mealor whole soybean protein as the dietary protein source (Iwabuchi and Yamauchi1987; Li et al. 1991). With these ingredients, it is difficult to separate the effects ofsoybean b-conglycinin from the effects of other antinutritional factors (Grant et al.1995; Burrells et al. 1999), which made us investigate the role of purified soybean b-conglycinin in allergic reaction and its effects on immune function in piglets.
2. Materials and methods
2.1. Preparation of b-conglycininPurified b-conglycinin suspension was donated from the Food Institute of ChinaAgricultural University (Patent number, 200410029589.4, China). After lyophilisa-tion, protein content was determined by the Kjeldahl method (Association of OfficialAnalytical Chemists [AOAC] 1997) and b-conglycinin purity was analysed bysodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) followed byCoomassie Brilliant Blue (CBB) R-250 staining (Laemmli 1970). The proteinconcentration in the gel was measured on a Syngene GeneGenius gel documentationand analysis system (Syngene, Cambridge, UK) (Guo et al. 2007). The content of b-conglycinin in the extract was determined by a BCA Protein Assay Kit (Pierce,Rockford, IL, USA) according to the manufacturer’s instructions.
2.2. Endotoxin content
The endotoxin content of the b-conglycinin (85.9 mg/ml in PBS) was assessed usinga Limulus amebocyte lysate (LAL) gel-clot test (Pyrotell, STV, Cape Cod,Falmouth, MA, USA) with a sensitivity limit of 0.03 EU/ml following themanufacturer’s instructions. Previous studies have shown that levels of endotoxinless than 100 EU/mg of protein appear to be without marked effect onimmunoglobulin E (IgE) anti-protein responses (Dearman and Kimber 2007).
2.3. Animals, diets and experimental design
Eighteen newly weaned (10 d of age) barrows (Large White 6 Landrace) with aninitial body weight (BW) of 3.84 (+0.06) kg were selected from a commercial pigfarm (Beijing, China) and transported to China Agricultural University. All pigletswere individually housed in 1.3 6 1.2 m pens with slatted stainless steel floors. Themechanically ventilated nursery room was supplied with 16 h light:8 h dark and thetemperature was maintained at 25–278C. Water and feed were available ad libitum.Piglets were fed a soybean and peanut-free diet, which was based on skimmed milkpowder and casein as the major protein sources. The basal diet was formulated tomeet the nutrient requirements suggested by the National Research Council (NRC1998) and contained no antibiotics (Table 1).
The BW and feed consumption of individual pigs were determined at thebeginning and end of the trial in order to calculate average daily gain (ADG),
Archives of Animal Nutrition 189
Dow
nloa
ded
by [
Penn
sylv
ania
Sta
te U
nive
rsity
] at
17:
06 2
1 N
ovem
ber
2014
average daily feed intake (ADFI), and gain:feed (G:F). The experiment wasconducted at the Ministry of Agriculture Feed Safety and Bio-AvailabilityEvaluation Center (Beijing, P.R. China) and all procedures were approved by theChina Agricultural University Animal Care and Use Committee.
Piglets were randomly allotted to three treatments according to litter and initialBW; each treatment had six replicates with one piglet per pen. Piglets were sensitisedby means of oral gavage with 2 g (equivalent to 1% of average daily intake) or 6 g(equivalent to 3% ADFI) purified b-conglycinin dissolved in phosphate-bufferedsaline (PBS, pH 7.4) daily from day 0 to 6. Three weeks after the initial sensitisation(day 21), piglets were boosted by means of oral gavage with 8 g (low dose) or 24 g(high dose) purified b-conglycinin dissolved in PBS. On day 28, piglets werechallenged with oral gavage with 12 g (low dose) or 36 g (high dose) b-conglycinindissolved in PBS divided into two doses at 30–40 min intervals (80 ml/piglet). Thecontrol group was gavaged with equal volume of PBS using the same schedule. Threehours after the second challenge dose, all piglets were slaughtered with anintracardial injection of sodium pentobarbital (50 mg/kg BW) followed by jugularexsanguination.
2.4. Assessment of hypersensitivity reactions
Anaphylactic symptoms were evaluated for 30–180 min after the second challengedose on day 28 using a five point scoring system modified slightly from previousreports (Helm et al. 2002): 0, no symptoms; 1, scratching and rubbing around thenose and head; 2, coughing, gagging, evidence of stomach contractions, reducedactivity, tendency to lie down, easily activated to movement, minor rashes; 3,vomiting, lethargy/malaise, tremors, diarrhoea, convulsions, reduced activity that
Table 1. Composition and nutrient levels of the basal diets (as-fed basis).
Content
Ingredient [%]Corn 60.50Skimmed milk powder 4.00Whey powder 14.00Casein 13.50Spray dried porcine plasma 4.50Limestone 0.90Dicalcium phosphate 1.30Salt 0.30Premix* 1.00Total 100.00
Chemical analysis#
Crude protein [%] 22.74Lysine [%] 1.61Calcium [%] 0.92Phosphorus [%] 0.75DE [MJ/kg] (calculated) 14.59
*Provided per kg diet: vitamin A, 10,000 IU; vitamin D3, 1,500 IU; vitamin E, 30 IU; vitamin K3, 2.5 mg;vitamin B1, 1.5 mg; vitamin B2, 10 mg; vitamin B6, 10 mg; vitamin B12, 0.05 mg; folic acid, 1 mg; biotin,0.5 mg; niacin, 30 mg; pantothenic acid, 20 mg; Cu, 20 mg; Fe, 100 mg; Zn, 110 mg; Mn, 40 mg; Se,0.3 mg; I, 0.54 mg; #Analysed value.
190 Y. Hao et al.
Dow
nloa
ded
by [
Penn
sylv
ania
Sta
te U
nive
rsity
] at
17:
06 2
1 N
ovem
ber
2014
could not be activated by prodding; 4, wheezing, respiratory distress and symptomsrequiring epinephrine; 5, death. Scoring of symptoms was performed by threeindividuals unaware of the treatments the animals were on.
2.5. Measurement of serum total IgE, and b-conglycinin-specific IgE levels
To monitor serum IgE antibody response, blood was obtained weekly from precavalvein, before sensitisation, during the sensitisation period, and 1 h before challenge.Serum was collected and stored at 7808C. All samples were individually tested.Total IgE antibodies were determined by using the swine IgE ELISA Kit (USCNLifeScience, Double Lake, Missouri city, USA) according to the instructions of themanufacturer.
The levels of b-conglycinin specific IgE were measured by ELISA following theprocedures described by Li et al. (1999) with slight modifications. Briefly, ImmulonII 96-well microplates (Dynatech Laboratories, Inc, Chantilly, VA, USA) werecoated with 20 mg/ml purified b-conglycinin in coating buffer, pH 9.6 (Sigma, StLouis, MO, USA), and incubated for 3 h at 378C. Then plates were washed threetimes with PBS/0.05% Tween-20 and blocked with 1% bovine serum albumin(BSA)-PBS overnight at 48C. After three washings, serum samples were diluted 5-fold in 1% BSA-PBS and incubated for 2 h at 378C. Plates were washed extensively,and 100 ml of biotinylated anti-pig IgE monoclonal antibody (USCNLife Science,Double Lake, Missouri city, USA, 1:100 dilution) was added to each well. The plateswere incubated for 2 h at 378C. After six washings, 100 ml of streptavidin peroxidase(USCNLife Science, Double Lake, Missouri city, USA, 1:100 dilution) was addedfor an additional 1 h at 378C. After eight washings, the reaction was developed withtetramethylbenzidine (TMB) for 30 min at room temperature, stopped with theaddition of 1 N H2SO4, and read at 450 nm (Tecan, Austria).
All analyses were performed in triplicate, and coefficients of variation of greaterthan 10% were repeated to ensure a high degree of precision. Specific antiserum toswine immunoglobulin G1 (IgG1) and immunoglobulin G2a (IgG2a) are notcommercially available; therefore, we did not detect the b-conglycinin- specific IgG1and IgG2a in the blood sera.
2.6. Histology
Three hours after the second challenge dose, all piglets were slaughtered with anintracardial injection of sodium pentobarbital (50 mg/kg BW) followed by jugularexsanguination. Standard histological procedure was performed as previouslydescribed with some slight modification (Li et al. 1999; Nakajima-Adachi et al.2006). Briefly, longitudinal sections of jejunum tissue (3 cm obtained from themiddle of the jejunum) were obtained and flushed with 5 ml of cold 0.9% NaClsolution. The tissues were then fixed in 3–5 volumes of 4% phosphate-bufferedformaldehyde (pH 7.2) and embedded in paraffin; six cross sections were obtainedfrom each formalin-fixed segment and processed for histological examination usingthe standard hematoxylin and eosin method. Villus height and crypt depth weremeasured according to Wu et al. (1996) under a light microscope (CK-40, OlympusCo., Japan). Ten villus height and crypt depth measurements were taken from eachsection on randomly-selected microscopic fields. The histological analysis wasperformed by an investigator who was unaware of the origin of tissue sections.
Archives of Animal Nutrition 191
Dow
nloa
ded
by [
Penn
sylv
ania
Sta
te U
nive
rsity
] at
17:
06 2
1 N
ovem
ber
2014
2.7. Histamine and cytokine levels in tissue homogenates of whole gut
To measure histamine and cytokine concentrations in the small intestine after oralchallenge, 4 cm sections of the jejunum were collected and processed according tothe method of van Halteren et al. (1997). Protein lysates of the jejunum wereprepared with a cocktail of proteinase inhibitors and centrifuged at 10,000 g at 48Cfor 10 min. Supernatants were collected for determination of histamine levels by anenzyme immunoassay kit (USCNLife Science, Double Lake, Missouri City, USA) asdescribed by the manufacturer. Concentrations of Interleukin-4 (IL-4) andInterferon-g (IFN-g) were also assessed by ELISA according to the manufacturer’sinstructions (Biosource, Camarillo, CA, USA). Histamine and cytokine contentswere standardised to the weight of jejunum tissue in each sample (Nakajima-Adachiet al. 2006).
2.8. Total RNA isolation and reverse transcription (RT)
Total RNA was isolated from the jejunum using RNeasy Plus Mini Kit (Qiagen,Hilden, Germany) according to the manufacturer’s protocol. The extracted RNAwas dissolved in RNA-free water and quantified using UV-clear microplates(Corning, Beijing, China) at OD260. An RNA aliquot was verified for its integrity byelectrophoresis in a 1% agarose gel stained with ethidium bromide. Then, 2 mg oftotal RNA was reverse-transcribed in a 25 ml reaction mixture using random primerOligo-dT18 (Sangon, Shanghai, China) and M-MLV reverse transcriptase (Promega,Madison, WI, USA) as described by Lai et al. (2005). The RT products (cDNA)were stored at 7808C until analysis of selected gene mRNA levels by Real-TimePCR.
2.9. Quantitative real-time PCR
Real-Time PCR was performed using DNA Engine Opticon-2 (MJ Research;Waltham, MA, USA) and DyNAmo SYBR Green qPCR commercial kits(Finnzymes, Finland), in which SYBR Green I was a double-stranded DNA-specificfluorescent dye. b-actin was used as the reference gene. The primers of the selectedgenes are listed in Table 1. The PCR reaction system consisted of 5.0 ml SYBR GreenqPCR mix, 1.0 ml of cDNA, 3.6 ml double distilled H2O and 0.4 ml of primer pairs(25 mmol/l forward and 25 mmol/l reverse) in a total volume of 10 ml. Cyclingconditions were 508C for 2 min, followed by 958C for 5 min, and by 35 cycles thetemperature was set at 958C for 30 sec, with the corresponding annealed temperatureslisted in Table 2. The melting curve program was 65–958C with a heating rate of 0.18Cper second and a continuous fluorescence measurement. All samples were measured intriplicate. The relative mRNA levels of target genes were determined using the relativestandard curve method as described previously (Lai et al. 2005).
2.10. Statistical analysis
All statistical analysis was performed using SAS statistical version 8.2. Dataobtained from scoring of systemic anaphylaxis was analysed by Chi-square test. Allother data were expressed as means + SEM. Statistical analyses were performedusing the one-way ANOVA followed by the Duncan Multiple Range test where
192 Y. Hao et al.
Dow
nloa
ded
by [
Penn
sylv
ania
Sta
te U
nive
rsity
] at
17:
06 2
1 N
ovem
ber
2014
appropriate. Differences between means were considered statistically significant forvalues of p5 0.05.
3. Results
3.1. Characterisation of systemic anaphylaxis reaction after oral challenge
Systemic anaphylaxis symptoms consisted primarily of cutaneous reactions withscratching and rubbing around the nose and head, minor rashes, reduced activity,diarrhoea, or both followed by respiratory reactions. Piglets sensitised with the lowdose of b-conglycinin showed more severe reactions than the higher dose group(Figure 1). Naive piglets did not show any symptoms of anaphylaxis. These findingsdemonstrate that the antigen dose influences the intensity of response to oralsensitisation and challenge.
Table 2. Primer sequences used for quantitative real-time PCR.
Gene Primers
Amplifiedfragmentlength [bp]
Annealedtemperature
[8C]
IFN-g Sense 50 GTGGACCTCTTTTCTTAG 30 315 55Antisense 50TCCGCTTTCTTAGGTTAG 30
IL-4 Sense 50 CGGACACAAGTGCGACATCA 30 207 66Antisense 50 CCGCTCAGGAGGCTCTTCAT 30
CD4 Sense 50 GAAAGGTCCAGGGAATAAAAGC 30 189 58Antisense 50 TGGTCCCCTTCCTTCACATAGA 30
CD8 Sense 50 GTGGAAGGGCTGAACTGAAT 30 391 62Antisense 50 CGAGCACGCATTTCTTGTAC 30
b-actin Sense 50 TGCGGGACATCAAGGAGAAG 30 216 64Antisense 50 AGTTGAAGGTGGTCTCGTGG 30
Figure 1. Soybean b-conglycinin-induced systemic anaphylaxis. Score: 0, no symptoms; 1,scratching and rubbing around the nose and head; 2, coughing, gagging, evidence of stomachcontractions, reduced activity, tendency to lie down, easily activated to movement, minorrashes; 3, vomiting, lethargy/malaise, tremors, diarrhoea, convulsions, reduced activity thatcould not be activated by prodding; 4, wheezing, respiratory distress and symptoms requiringepinephrine; 5, death. *p 5 0.05 versus naive piglets.
Archives of Animal Nutrition 193
Dow
nloa
ded
by [
Penn
sylv
ania
Sta
te U
nive
rsity
] at
17:
06 2
1 N
ovem
ber
2014
3.2. Growth performance
The effects of soybean b-conglycinin on ADG, ADFI and G:F are shown in Table 3.Compared with naive piglets, ADG in 1% group significantly decreased (p ¼ 0.046);ADG in 3% group also decreased but no obvious difference was found during theentire 28-day study period. Although sensitised piglets of both groups had lowerADFI and G:F, difference was not obvious among the every group, which were518 g/d vs. 474 g/d. Maybe the diet was firstly used to maintain the normal immunefunctions of the body; then was used for growth.
3.3. Serum IgE level after oral b-conglycinin sensitisation and challenge
To determine the role of humoral immunity in the development of hypersensitivity tob-conglycinin, serum total IgE and b-conglycinin-specific IgE were detected weekly.Piglets sensitised with the low dose demonstrated significant increases in total andantigen-specific IgE by three weeks, which peaked at four weeks after the initialsensitisation (Figure 2). Significantly lower levels of antigen-specific IgE wereinduced by the higher dose compared with the lower dose. IgE level of the naivepiglets kept at a low level throughout the experiment. In a preliminary study, we
Table 3. Body weight gain and food intake in rats fed different levels of b-conglycinin*.
b-conglycinin levels
SEM p-value0 1% 3%
Body weight gain [g/d] 376a 303b 320ab 0.020 0.046Feed intake [g/d] 518a 474a 474a 0.018 0.162Gain:feed [g/g] 0.729a 0.640a 0.675a 0.036 0.247
Note: *Means + SEM, 6 piglets per group.
Figure 2. Time response of total (A) and b-conglycinin specific (B) serum IgE antibodylevels. Sera from different groups of piglets were obtained at day 0 and weekly after soybean b-conglycinin sensitisation. Data are expressed as means + SEM. Values with different symbolsare significantly different (p 5 0.05, n ¼ 6).
194 Y. Hao et al.
Dow
nloa
ded
by [
Penn
sylv
ania
Sta
te U
nive
rsity
] at
17:
06 2
1 N
ovem
ber
2014
found that sensitising doses of 0.125% and 0.25% of b-conglycinin (as a percentageof intake) failed to induce b-conglycinin-specific IgE response at any time pointbetween week 1 and 4 after sensitisation, while sensitising doses of 0.5% of b-conglycinin developed b-conglycinin-specific IgE response after the initial sensitisa-tion, but the level was significantly lower than the 1% group (data not shown). Inthis study we found that although both the low and high dose of b-conglycinin couldinduce b-conglycinin-specific IgE, the low dose of b-conglycinin sensitisation was amore effective dose. And in our passive cutaneous anaphylaxis test, resultsdemonstrated that IgE was the reagenic antibody in this model but not the IgG1(data not shown).
3.4. Changes of morphologic structure in the jejunum of sensitised piglets
To investigate the effect of b-conglycinin on the small intestine after challenge,changes in the morphologic structure of the jejunum were observed. Analysis ofjejunum histology indicated that inflammation associated with morphologic changeswas noticeable in the jejunum from both the low and high dose groups (Figure 3).Changes to the jejunal tissue consisted of villous atrophy, crypt elongation andmucus depletion. The severity of the morphologic changes was reflected by thesignificant decrease in the villous height (335.17 mm vs. 407.22 mm) and thickenedcrypt depth (234.53 mm vs. 169.58 mm) in the low dose group. In contrast, theinflammation was moderate in the high dose group, showing only partial villousatrophy (Table 4).
3.5. Jejunum histamine level after challenge of sensitised piglets
Mast cells are thought to play a crucial role in the induction of allergic reactions tofood. The local mast cell population was studied by measuring the amount ofhistamine in the small intestine specimens on the day of challenge. Local histamine
Figure 3. Histologic assessments of different levels of b-conglycinin in the jejunummorphology. HE. 10 6 20. (A) Non-sensitised control piglets; (B) low dose b-conglycinin-sensitised piglets; (C) high dose b-conglycinin-sensitised piglets.
Archives of Animal Nutrition 195
Dow
nloa
ded
by [
Penn
sylv
ania
Sta
te U
nive
rsity
] at
17:
06 2
1 N
ovem
ber
2014
levels in jejunal tissue were significantly increased in the low dose of b-conglycinin-sensitised piglets after challenge compared with the high dose and naıve piglets(Figure 4). These results suggested that histamine is one of the major mediatorsinvolved in the anaphylaxis in this model.
3.6. Allergen-induced cytokine responses and mRNA levels in jejunum
Local cytokine production analysis in the jejunum showed higher levels of IL-4 in thelow dose group compared with the high dose group and naive piglets (Figure 5).Significant differences in IL-4 production were not observed between 3% group andnaive animals. There were also significantly higher levels of IFN-g both the low andhigh dose groups compared with naive piglets (Figure 5). The expressions of cytokinemRNA levels were similar to protein levels (Figure 6). These results suggested that amixed T helper1/T helper2 (Th1/Th2) response may play an important role in theintestine lesions in this model.
4. Discussion
There has been much research on the effects of soybean protein on performance andimmune function in animals. High levels of soybean protein (including b-conglycinin) has been shown to depress growth, destroy the integrity of the intestineand suppress immune function in young animals (Lalles et al. 1996a; Burrells et al.
Table 4. Effects of different doses of b-conglycinin on jejunum morphology.
b-conglycinin levels
SEM p-value0 1% 3%
Villus height [mm] 407.2a 335.2b 361.0b 10.07 0.0005Crypt depth [mm] 169.6b 234.5a 206.1a 10.20 0.0016
Note: Different superscripts indicate significant differences between treatments (p 5 0.05).
Figure 4. Jejunal histamine level. Values are expressed as means + SEM (n ¼ 6).
196 Y. Hao et al.
Dow
nloa
ded
by [
Penn
sylv
ania
Sta
te U
nive
rsity
] at
17:
06 2
1 N
ovem
ber
2014
1999; Minehira et al. 2000). In this study we established a swine model forinducing allergic reaction to examine whether the purified b-conglycinin depressedgrowth performance and destroyed the immune function by intragastric gavagewith purified b-conglycinin. We found that b-conglycinin-induced allergicresponses, including growth depressions, disorders of immune function anddestroyed the integrity of the intestine in piglets. In this study, a decrease inADG was observed in piglets fed b-conglycinin. These results are in agreementwith reports in other studies (Li et al. 1991; Qiao et al. 2003). Nishi et al. (2003)reported that soybean b-conglycinin suppressed food intake and gastric emptyingby increasing plasma cholecystokinin levels in rats. In our study, the decrease trendwas observed on ADFI.
Figure 5. Th2 (A, IL-4) and Th1 (B, IFN-g) type cytokine levels detected in the jejunumtissue from b-conglycinin-sensitised piglets and control piglets. The results are expressed asmeans + SEM. Bars with different letters mean p 5 0.05 between groups (n ¼ 6).
Figure 6. Cytokine and lymphocyte mRNA expression in jejunum tissue. The results areexpressed as means + SEM. Bars with different letters mean p 5 0.05 between groups(n ¼ 6).
Archives of Animal Nutrition 197
Dow
nloa
ded
by [
Penn
sylv
ania
Sta
te U
nive
rsity
] at
17:
06 2
1 N
ovem
ber
2014
This model exhibited the characteristics of type 1 hypersensitivity reactions, inwhich IgE was the reagenic antibody. We found that lower doses of b-conglycinin-induced higher IgE levels and more severe reactions than higher sensitising doses.Different responses to high and low antigen doses in this model were consistent withother researchers’ studies showing that high antigen doses induce tolerance (Li et al.1999, 2000). However, low and high doses are relative, and our previous studyshowed that very low doses also fail to induce an IgE response.
The epithelial barrier of the gut represents a unique environment that is exposedthroughout life to a limitless variety of antigens, and its main task is to provide anefficient barrier against pathogens and macromolecules (Chambers et al. 2004).Abrogation of the barrier might promote food allergy and may be associated withintestinal pathology (Chehade and Mayer 2005). Intestinal anaphylaxis was found toincrease the release of goblet cell mucus into the lumen (Lake et al. 1980) and todecrease the absorption of salicylic acid perfused in situ through the entire smallintestine (Nakamura et al. 1982). It is possible that the patterns of lesions and thevariability of distribution are related to the local content of mast cells and to the localrelease of mediators in response to antigen challenge (Levine and Saltzman 1998).
Tissue mast cells play an important role in allergic inflammation; they are theprimary effector cells of immediate-type allergic reactions (Bradding et al. 2006).Tissue mast cells bind IgE on their surface by expressing the high-affinity Fc receptorfor IgE (FceRI), and then exert their biological effects by releasing preformed and denovo-synthesised mediators (Bischoff 2007). Histamine is considered as an importantmediator of immediate hypersensitivity, as animals with food allergy show elevatedhistamine release from the intestine following antigen challenge (Nakajima-Adachiet al. 2006; Guo et al. 2008).
Immune response is controlled by a complex network of cytokines andchemokines. It has been shown that histamine can exert a differential effect onCD4 T cell subsets, which is explained by their distinct receptor expression, the H1subtype being predominant in the Th1 population, whereas Th2 cells preferentiallyexpress H2R (Dy and Schneider 2004). Histamine enhances Th1-type responses bytriggering the histamine receptor type 1(H1R), while both Th1 and Th2 responses arenegatively regulated by H2R through the activation of different biochemicalintracellular signals (Jutel et al. 2001). The balance between Th1 and Th2 cellresponses is important, and this balance is partly determined by the type of antigen-presenting cells and the factors produced (Rupa and Mine 2006).
In the current study, we found a mixed Th1/Th2 response detected in jejunumtissues of piglets after oral challenge, in which both IFN-g and IL-4 were up-regulation. It is known that IFN-g in the gut induces up-regulation of majorhistocompatibility complex class II on epithelial cells in the small intestine (Zhangand Michael 1990) and induces changes in epithelial permeability (Adams et al.1993), which might facilitate sensitisation responses. Rowe et al. (2004) suggestedthat IFN-g may play a dual role in the pathogenesis of atopic disease. It mayantagonise the disease process by limiting Th2 differentiation during the early stageof priming of allergen-specific Th memory cells. However, once sensitisation isachieved, coexpression of Th1 immunity at lesional sites may directly or indirectlyamplify Th2-driven tissue inflammation and thus contribute to the persistence andseverity of the disease.
Our finding was consistent with other workers who have described increasedIFN-g in intestine (Hauer et al. 1997; Perez-Machado et al. 2004). However, their
198 Y. Hao et al.
Dow
nloa
ded
by [
Penn
sylv
ania
Sta
te U
nive
rsity
] at
17:
06 2
1 N
ovem
ber
2014
studies measured cytokine production by flow cytometry, immunohistochemistry orELISPOT, respectively. It has been reported that the percentages of IL-4 and IFN-g-positive T cells detected by flow cytometry are not correlated to cytokine levelsmeasured in the supernatant (Tay et al. 2007). Therefore, different types of cytokineassays to measure cytokine production in parallel may be required to obtain a moreprecise picture of Th1/Th2 skewing. Therefore, further studies will be required toexamine IL-4 and IFN-g-positive T cells, CD4þ and CD8þ cells in our model.
In addition, we think that the differences between the present and previousstudies may also be explained by the use of adjuvant. To our knowledge, adjuvantcan increase gut permeability, thereby enhancing allergen uptake and stimulatesstrong responses to mucosal delivered antigens (Xu-Amano et al. 1993; Marinaroet al. 1995). Although co-administration of adjuvant will increase the sensitivity ofdetection of IgE antibody responses to proteins, the use of adjuvant maycompromise the ability to discriminate between proteins with respect to allergenicpotential, possibly generating false positives and conferring the appearance ofsensitising potential on non-allergens (Dearman and Kimber 2007; de Jonge et al.2007). Oral administration of the antigen without adjuvant is preferable to imitatethe natural route of antigen exposure (Untersmayr and Jensen-Jarolim 2006) and forthat reason no adjuvant was used in this trial.
In conclusion, the data presented in this study suggest that dietary soybean b-conglycinin can depress growth, destroy the integrity of the intestine and induceimmediate-type hypersensitivity reactions in the neonatal swine model, which wasIgE mediated. Our results also suggested that histamine was a major mediatorreleased during the anaphylactic reactions, and both Th2 and Th1 cytokines mayplay important role in the development of gut hypersensitivity.
5. Implications
Immune responses to antigenic soybean protein have been postulated to beresponsible for digestive disturbances and decreased growth performance in early-weaned pigs. Potential allergic immunopathogenesis mechanisms involved inhypersensitivity to soybean b-conglycinin in early-weaned pigs remains to beconfirmed. However, identification of responsible soybean-proteins, associated witha better knowledge of the reactions in the small intestine, will provide theopportunity to prevent post-weaning digestive disturbances in young farm animalsand infants. Further, due to similarities in digestive function and dysfunction, pigscould be a good model to improve our knowledge on gut hypersensitivity reactionsto food antigens that occur in different infant gastrointestinal pathologies.
Acknowledgements
The investigation was financially supported by the National Natural Science Foundation ofP.R. China (No. 30430520) and 2006BAD12B05.
References
Adams RB, Planchon SM, Roche JK. 1993. IFN-g modulation of epithelial barrier function.Time course, reversibility, and site of cytokine binding. J Immunol. 150:2356–2363.
Association of Official Analytical Chemists. (AOAC). 1997. Official Methods of Analysis. 16thed. Arlington (VA): AOAC.
Archives of Animal Nutrition 199
Dow
nloa
ded
by [
Penn
sylv
ania
Sta
te U
nive
rsity
] at
17:
06 2
1 N
ovem
ber
2014
Bischoff SC. 2007. Role of mast cells in allergic and non-allergic immune responses:Comparison of human and murine data. Nat Rev Immunol. 7:93–104.
Bradding P, Walls AF, Holgate ST. 2006. The role of the mast cell in the pathophysiology ofasthma. J Allergy Clin Immunol. 117:1277–1284.
Burrells C, Williams PD, Southgate PJ, Crampton VO. 1999. Immunological, physiologicaland pathological responses of rainbow trout (Oncorhynchus mykiss) to increasing dietaryconcentrations of soybean proteins. Vet Immunol Immunopathol. 30:277–288.
Chambers SJ, Wickham MS, Regoli M, Bertelli E, Gunning PA, Nicoletti C. 2004. Rapid invivo transport of proteins from digested allergen across pre-sensitized gut. BiochemBiophys Res Commun. 325:1258–1263.
Chehade M, Mayer L. 2005. Oral tolerance and its relation to food hypersensitivities. J AllergyClin Immunol. 115:3–12.
Cordle CT. 2004. Soy protein allergy: Incidence and relative severity. J Nutr. 134:1213S–1219S.Dearman RJ, Kimber I. 2007. A mouse model for food allergy using intraperitoneal
sensitization. Methods 41:91–98.Dreau D, Lalles JP, Philouze RV, Toullec R, Salmon H. 1994. Local and systemic
immune responses to soybean protein ingestion in early-weaned pigs. J Anim Sci.72:2090–2098.
Dy M, Schneider E. 2004. Histamine–cytokine connection in immunity and hematopoiesis.Cytokine Growth Factor Rev. 15:393–410.
Grant G, Dorward PM, Buchan WC, Armour JC, Pusztai A. 1995. Consumption of dietscontaining raw soya beans (Glycine max), kidney beans (Phaseolus vulgaris), cowpeas(Vigna unguiculata) or lupin seeds (Lupinus angustifolius) by rats for up to 700 days: Effectson body composition and organ weights. Brit J Nutr. 73:17–29.
Guo PF, Piao XS, Ou DY, Li DF, Hao Y. 2007. Characterization of the antigenic specificityof soybean protein b-conglycinin and its effects on growth and immune function in rats.Arch Anim Nutr. 61:189–200.
Guo PF, Piao XS, Cao YH, Ou DY, Li DF. 2008. Recombinant soybean protein b-conglycinin a0-subunit expression and induced hypersensitivity reaction in rats. Int ArchAllergy Immunol. 145:102–110.
van Halteren AG, van der Cammen MJ, Biewenga J, Savelkoul HF, Kraal G. 1997. IgE andmast cell response on intestinal allergen exposure: A murine model to study the onset offood allergy. J Allergy Clin Immunol. 99:94–99.
Hancock JD, Cao H, Kim IH, Li DF. 2000. Effects of processing technologies and geneticmodifications on nutritional value of full-fat soybeans in pigs. Asian-Aust J Anim Sci.13(Special Issue):356–375.
Hauer AC, Breese EJ, Walker-Smith JA, MacDonald TT. 1997. The frequency of cellssecreting IFN-g and IL-4, -5, and -10 in the blood and duodenal mucosa of children withcow’s milk hypersensitivity. Pediatr Res. 42:629–638.
Helm RM, Furuta GT, Stanley JS, Ye J, Cockrell G, Connaughton C, Simpson P, BannonGA, Burks AW. 2002. A neonatal swine model for peanut allergy. J Allergy ClinImmunol. 109:136–142.
Iwabuchi S, Yamauchi F. 1987. Determination of glycinin and ß-conglycinin in soybeanprotein by immunological methods. J Agric Food Chem. 35:200–205.
de Jonge JD, Knippels LM, Ezendam J, Odink J, Penninks AH, van Loveren H. 2007. Theimportance of dietary control in the development of a peanut allergy model in BrownNorway rats. Methods 41:99–111.
Jutel M, Watanabe T, Klunker S, Akdis M, Thomet OA, Malolepszy J, Zak-Nejmark T,Koga R, Kobayashi T, Blaser K, Akdis CA. 2001. Histamine regulates T-cell andantibody responses by differential expression of H1 and H2 receptors. Nature 413:420–425.
Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head ofbacteriophage T4. Nature 227:680–685.
Lai CH, Yin JD, Li DF, Zhao LD, Qiao SY, Xing JJ. 2005. Conjugated linoleic acidattenuates the production and gene expression of proinflammatory cytokines in weanedpigs challenged with lipopolysaccharide. J Nutr. 135:239–244.
Lake AM, Bloch KJ, Sinclair KJ, Walker WA. 1980. Anaphylactic release of intestinal gobletcell mucus. Immunology 39:173–178.
200 Y. Hao et al.
Dow
nloa
ded
by [
Penn
sylv
ania
Sta
te U
nive
rsity
] at
17:
06 2
1 N
ovem
ber
2014
Lalles JP, Dreau D, Salmon H, Toullec R. 1996a. Identification of soya bean allergens andimmunemechanisms of dietary sensitivities in preruminant calves. Res Vet Sci. 60:111–116.
Lalles JP, Tukur HM, Salgado P, Clare Mills EN, Morgan MRA, Quillien L, Levieux D,Toullec R. 1999. Immunochemical studies on gastric and intestinal digestion of soybeanglycinin and b-conglycinin in vivo. J Agric Food Chem. 47:2797–2806.
Levine S, Saltzman A. 1998. Distribution of small intestinal lesions in anaphylaxis of rats. IntArch Allergy Immunol. 115:312–315.
Li DF, Nelssen JL, Reddy PG, Blecha F, Hancock JD, Allee GL, Goodband RD, KlemmRD. 1990. Transient hypersensitivity to soybean meal in the early weaned pig. J Anim Sci.68:1790–1799.
Li DF, Nelssen JL, Reddy PG, Blecha F, Klemm R, Goodband RD. 1991. Interrelationshipbetween hypersensitivity to soy-bean proteins and growth performance in early-weanedpigs. J Anim Sci. 69:4062–4069.
Li XM, Schofield BH, Huang CK, Kleiner GI, Sampson HA. 1999. A murine model of IgE-mediated cow’s milk hypersensitivity. J Allergy Clin Immunol. 103:206–214.
Li XM, Serebrisky D, Lee SY, Huang CK, Bardina L, Schofield BH, Stanley JS, Burks AW,Bannon GA, Sampson HA. 2000. A murine model of peanut anaphylaxis: T- and B-cellresponses to a major peanut allergen mimic human responses. J Allergy Clin Immunol.106:150–158.
Li ZT, Li DF, Qiao SY, Huang CH. 2003. Anti-nutritional effects of a moderate dose ofsoybean agglutinin in the rat. Arch Anim Nutr. 57:267–277.
Lusas EW, Riaz MN. 1995. Soy protein products: Processing and use. J Nutr. 125:573S–580S.
Marinaro M, Staats HF, Hiroi T, Jackson RJ, Coste M, Boyaka PN, Okahashi N, YamamotoM, Kiyono H, Bluethmann H, Fujihashi K, McGhee JR. 1995. Mucosal adjuvant effect ofcholera toxin in mice results from induction of T helper 2 (Th2) cells and IL-4. J Immunol.155:4621–4629.
Minehira K, Inoue S, Nonaka M, Osada K, Yamada K, Sugano M. 2000. Effects ofdietary protein type on oxidized cholesterol-induced alteration in age-related modulationof lipid metabolism and indices of immune function in rats. Biochim Biophys Acta1483:141–153.
Nakajima-Adachi H, Ebihara A, Kikuchi A, Ishida T, Sasaki K, Hirano K, Watanabe H, AsaiK, Takahashi Y, Kanamori Y, Shimojo N, Matsuda H, Kohno Y, Hachimura S,Kaminogawa S. 2006. Food antigen causes TH2-dependent enteropathy followed by tissuerepair in T-cell receptor transgenic mice. J Allergy Clin Immunol. 117:1125–1132.
Nakamura J, Yamamoto A, Takada S, Kimura T, Sezaki H. 1982. Antigen-induced decreaseof salicylic acid absorption from the small intestine in actively immunized rats. JPharmacobiodyn. 5:278–284.
National Research Council (NRC). 1998. Nutrient requirements of swine. 10th ed.Washington (DC): National Academic Press.
Nishi T, Hara H, Tomita F. 2003. Soybean b-conglycinin peptone suppresses food intake andgastric emptying by increasing plasma cholecystokinin levels in rats. J Nutr. 133:352–357.
Ogawa T, Tsuji H, Bando N, Kitamura K, Zhu YL, Hirano H, Nishikawa K. 1995. Alpha-subunit of b-conglycinin, an allergenic protein recognised by IgE antibodies of soybean-sensitive patients with atopic dermatitis. Biosci Biotechnol Biochem. 59:831–833.
Perez-Machado MA, Ashwood P, Torrente F, Salvestrini C, Sim R, Thomson MA,Walker-Smith JA, Murch SH. 2004. Spontaneous TH1 cytokine production byintraepithelial but not circulating T cells in infants with or without food allergies.Allergy 59:346–353.
Qiao SY, Li DF, Jiang JY, Zhou HJ, Li JS, Thacker PA. 2003. Effect of moist extruded full-fatsoybeans on gut morphology and mucosal cell turnover rate (Time) of weanling pigs.Asian-Austral J Anim Sci. 16:63–69.
Rowe J, Heaton T, Kusel M, Suriyaarachchi D, Serralha M, Holt BJ, de Klerk N, Sly PD,Holt PG. 2004. High IFN-g production by CD8þ T cells and early sensitization amonginfants at high risk of atopy. J Allergy Clin Immunol. 113:710–716.
Rupa P, Mine Y. 2006. Engineered recombinant ovomucoid third domain can modulateallergenic response in Balb/c mice model. Biochem Biophys Res Commun. 342:710–717.
Archives of Animal Nutrition 201
Dow
nloa
ded
by [
Penn
sylv
ania
Sta
te U
nive
rsity
] at
17:
06 2
1 N
ovem
ber
2014
Tang SS, Li DF, Qiao SY, Piao XS, Zang JJ. 2006. Effects of purified soybean agglutinin ongrowth and immune function in rats. Arch Anim Nutr. 60:418–426.
Tay SS, Clark AT, Deighton J, King Y, Ewan PW. 2007. T cell proliferation and cytokineresponses to ovalbumin and ovomucoid detected in children with and without egg allergy.Clin Exp Allergy. 37:1519–1527.
Untersmayr E, Jensen-Jarolim E. 2006. Mechanisms of type I food allergy. Pharmacol Ther.112:787–798.
Wu GY, Meier SA, Knabe DA. 1996. Dietary glutamine supplementation prevents jejunalatrophy in weaned pigs. J Nutr. 126:2578–2584.
Xu-Amano J, Kiyono H, Jackson RJ, Staats HF, Fujihashi K, Burrows PD, Elson CO, PillaiS, McGhee JR. 1993. Helper T cell subsets for immunoglobulin A responses: Oralimmunization with tetanus toxoid and cholera toxin as adjuvant selectively inducesTh2 cells in mucosa associated tissues. J Exp Med. 178:1309–1320.
Zhang ZY, Michael JG. 1990. Orally inducible immune unresponsiveness is abrogated byIFN-g treatment. J Immunol. 144:4163–4165.
202 Y. Hao et al.
Dow
nloa
ded
by [
Penn
sylv
ania
Sta
te U
nive
rsity
] at
17:
06 2
1 N
ovem
ber
2014