spink1 status in colorectal cancer, impact on ... · published onlinefirst march 24, 2015; doi:...

Oncogenes and Tumor Suppressors

SPINK1 Status in Colorectal Cancer, Impact onProliferation, and Role in Colitis-AssociatedCancerSatoshi Ida1,2, Nobuyuki Ozaki2, Kimi Araki1, Kotaro Hirashima3, Yoko Zaitsu4,Katsunobu Taki1,2, Yasuo Sakamoto2, Yuji Miyamoto2, Eiji Oki4, Masaru Morita4,Masayuki Watanabe5, Yoshihiko Maehara4, Ken-ichi Yamamura1, Hideo Baba2, andMasaki Ohmuraya1

Abstract

Colorectal cancer is a major cause of deaths due to cancer;therefore, research into its etiology is urgently needed.Although it is clear that chronic inflammation is a risk factorfor colorectal cancer, the details remain uncertain. Serine pro-tease inhibitor, Kazal type 1 (SPINK1) is mainly produced inpancreatic acinar cells. However, SPINK1 is expressed in variouscancers and in inflammatory states, such as colon cancer andinflammatory bowel disease. There are structural similaritiesbetween SPINK1 and epidermal growth factor (EGF). Hence, itwas hypothesized that SPINK1 functions as a growth factorfor tissue repair in inflammatory states, and if prolonged, acts asa promoter for cell proliferation in cancerous tissues. Here,immunohistochemical staining for SPINK1 was observed in ahigh percentage of colorectal cancer patient specimens and

SPINK1 induced proliferation of human colon cancer cell lines.To clarify its role in colon cancer in vivo, a mouse modelexposed to the colon carcinogen azoxymethane and nongeno-toxic carcinogen dextran sodium sulfate revealed that Spink3(mouse homolog of SPINK1) is overexpressed in canceroustissues. In Spink3 heterozygous mice, tumor multiplicity andtumor volume were significantly decreased compared withwild-type mice. These results suggest that SPINK1/Spink3 sti-mulates the proliferation of colon cancer cells and is involvedin colorectal cancer progression.

Implications: Evidence suggests that SPINK1 is an importantgrowth factor that connects chronic inflammation and cancer.Mol Cancer Res; 13(7); 1130–8. �2015 AACR.

IntroductionColorectal cancer is a major cause of death in Japan. According

to 2012 statistics, colorectal cancer accounted for the largestnumber of deaths from malignant neoplasms in woman and thethird largest number in men. Research into the etiology anddevelopment of new treatment methods are needed to improvepatient outcome. Colorectal cancer is one of the most seriouscomplications of inflammatory bowel disease (IBD), includingulcerative colitis and Crohn's disease. The relative risk of colo-rectal cancer in patient with colitis is two to eight times that of thegeneral population (1). Although it is clear that chronic inflam-

mation is a risk factor of colorectal cancer, the pathogenesis ofcolitis-associated cancer (CAC) is still uncertain.

Serine protease inhibitor, Kazal type 1 (SPINK1; mouse homo-log; Spink3; ref. 2), which is also known as pancreatic secretorytrypsin inhibitor and tumor-associated trypsin inhibitor (3), ismainly produced in the acinar cells of the exocrine pancreas. Therole of SPINK1 is postulated to be the prevention of inadvertentproteolysis in the pancreas caused by intra-acinar prematureactivationof trypsinogen (4–6).However, it is known that SPINK1is widely expressed in extrapancreatic tissues, especially in thegastrointestinal and urinary tracts (7, 8), suggesting that SPINK1has additional functions in many tissues other than the pancreas.

In the normal gastrointestinal tract, SPINK1 is believed toplay aprotective role in both gastric (9) and colonic (10) mucosa.However, when the gastrointestinal tract is inflamed, SPINK1 isinvolved in the regenerative process at the gastric ulcer edge and isstrongly expressed within the ulcer-associated cell lineage inpatients with IBD (11, 12). In addition, we also observed Spink3in the large intestine at 11.5 days postconception, an earlier stageof development, thus Spink3 influences the proliferation of colon-ic epithelial cells (8). Furthermore,Ogawa and colleagues (13, 14)found elevated serum SPINK1 levels in patients with severesystemic inflammation.

SPINK1 is also produced in cancers of the colon (15, 16), lung(17, 18), liver (19), breast (20), prostate (21), and pancreas(20, 22). In colon cancer, Gouyer and colleagues (23) identifiedand characterized SPINK1 as a major proinvasive secreted factorfrom the conditioned medium of HT-29 5M21 human colon

1Institute of Resource Development and Analysis, Kumamoto Univer-sity, Kumamoto, Japan. 2Department of Gastroenterological Surgery,Graduate School of Medical Sciences, Kumamoto University, Kuma-moto, Japan. 3DepartmentofDigestiveandGeneral Surgery,GraduateSchool of Medical and Dental Sciences, Niigata University, Niigata,Japan. 4Department of Surgery and Science, Graduate School ofMedical Sciences, Kyushu University, Fukuoka, Japan. 5Departmentof Gastroenterological Surgery, Cancer Institute Hospital of JapaneseFoundation for Cancer Research, Tokyo, Japan.

Note: Supplementary data for this article are available at Molecular CancerResearch Online (http://mcr.aacrjournals.org/).

Corresponding Author: Masaki Ohmuraya, Kumamoto University, 2-2-1 Honjo,Chuo-ku, Kumamoto 860-0811, Japan. Phone: 81-96-373-6559; Fax: 81-96-373-6559; E-mail: [email protected]

doi: 10.1158/1541-7786.MCR-14-0581

�2015 American Association for Cancer Research.

MolecularCancerResearch

Mol Cancer Res; 13(7) July 20151130

on January 18, 2021. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst March 24, 2015; DOI: 10.1158/1541-7786.MCR-14-0581

http://mcr.aacrjournals.org/

cancer cells, which express a spontaneous invasive phenotype.However, the role of SPINK1 in malignant tumors remains to beelucidated, especially in tumor progression.

Here, we hypothesized that SPINK1/Spink3 is an importantfactor that connects chronic inflammation and cancer. In otherwords, we predicted that SPINK1/Spink3 would play a role as agrowth factor in tissue repair in inflammatory states, and ifprolonged, function as a promoter of cell proliferation in cancer-ous tissues.

We showed the function of SPINK1 as a growth factor forcolorectal cancer: (i) expression of SPINK1 in human coloncancer; (ii) the proliferative activity of SPINK1using human coloncancer cell lines; and (iii) the role of SPINK1 in the proliferation ofCAC in vivo.

Materials and MethodsImmunohistochemistry

A total of 226 patients were made available for immunohis-tochemical analysis with fully informed consent. All resections forcolorectal cancer were performed between 1994 and 2007 at theDepartment of Surgery and Science, Graduate School of MedicalSciences, Kyushu University Hospital, Fukuoka, Japan. Immuno-histochemical staining was performed according to a previouslydescribed protocol (22). Each sample was excised and fixed in10% buffered formalin for histologic examination. Immunohis-tochemistry was performed using rabbit anti-human SPINK1primary antibody, which was detected with a commercial bio-tin–streptavidin system (Vector Laboratories).

SPINK1 expression was scored by two independent investiga-tors (S. Ida and K. Hirashima). Immunoexpression scoring ofSPINK1 was performed using proportion scoring (24) and inten-sity scoring (25). First, a proportion score was assigned, whichrepresented the estimated proportion of positively stained tumorcells (score: 0, none; 1, <10%; 2, 10%–50%; 3, >50%). Next, anintensity score was assigned a value of score 0, none; 1, weak; 2,moderate; 3, strong. Theproportion and intensity scoreswere thenmultiplied to obtain a total score,with a range of 0 to 9. For furtheranalysis, the patients were divided into two groups: negative withscores 0 to 1 andpositivewith scores 2 to 9. Concordance betweentwo investigators was assessed using k coefficients.

Cell culture and growth stimulation studyColo205, HCT116, HT29, and SW620 human colon cancer cell

lines were obtained from the Riken BioResource Center Cell Bank,JapaneseCollectionof Research Bioresources Cell Bank, AmericanType Culture Collection, and DS Pharma Biomedical, respective-ly. They were seeded at 5� 104 cells in 6-well plates. HCT116 andSW620 cells were grown in DMEM, Colo205 cells were grown inRPMI 1640, andHT29 cells were grown inMcCoy's 5A (Modified)Medium; all were supplemented with 10% FBS, 100 U/mL pen-icillin, and 100 mg/mL streptomycin, and incubated at 37�C in 5%CO2. Cell numbers were determined using a hemocytometer(Erma). In the growth stimulation assay, growth medium wasremoved after 24-hour incubation, and the cells were washedtwice with PBS and then serum starved by culturing overnight inFBS-free medium.

RNA interferenceTwodifferent siRNAduplexes targeting SPINK1were purchased

from Invitrogen (Carlsbad). The sequenceswere as follows: siRNA#1: sense, UUACCAGAUAGACUCAACAGGGCCA, antisense,

UGGCCCUGUUGAGUCUAUCUGGUAA, and siRNA #2: sense,AUAUCUUGGUGCAUCCAUUAAGUUC, antisense, GAACUU-AAUGGAUGCACCAAGAUAU. A total of 50 nmol/L siRNA wastransfected using Lipofectamine 2000 (Invitrogen). The cells wereincubated at 37�C for 48hours and subsequently harvested for thefollowing studies. Negative control siRNA was also purchasedfrom Invitrogen.

SPINK1 minigene construction and transfectionThe human SPINK1 gene is approximately 7.5 kb long and

consists of four exons (26). The SPINK1 minigene contained allfour exons from the human gene; for ease of handling, the firstintron was shortened from 1.9 to 0.5 kb, the second from 1.5 to0.6 kb, and the third from3.3 to 0.5 kbbydeleting sequences fromthe center of the introns. We generated SPINK1-overexpressingtransient cells in which a minigene composed of the CAG pro-moter was coupled to the human SPINK1 gene. A total of 50nmol/L DNA was transfected using Lipofectamine 2000 (Invitro-gen). The cells were incubated at 37�C for 48 hours and weresubsequently harvested for the following studies. Empty vectorwas inserted in cells as a negative control.

Reverse-transcription PCRTotal RNA was obtained from each cell line using an RNeasy

Mini kit (Qiagen). cDNA was synthesized using a ThermoScriptone-step RT-PCR system (Invitrogen). RT-PCR analysis was per-formed using the primers 50-GAAGGTAACAGGCATCTTTC-TTCTC-30 and 50-TTGAATGAGGATAGAAGTCTGGCGT-30 forSPINK1 (221 bp) and 50-GAGTCAACGGATTTGGTCGT-30 and50-TGCTGATGATCTTGAGGCTG-30 for GAPDH (426 bp). Thetemperature protocol for PCR amplifications was as follows:initial denaturation at 95�C for 15 minutes, followed by 30amplification cycles of 30 seconds at 95�C, then 30 seconds at63�C and 30 seconds at 72�C, followed by final extension at 72�Cfor 7 minutes. Amplified PCR products were separated by 2.5%agarose gel electrophoresis and visualized by ethidium bromidestaining. Saline was used as a negative control in each analysis.

Animals and chemicalsMale C57BL/6N mice (2 months old and weighing 20–25 g)

were obtained from Charles River Japan. Mice were housed in aclimate-controlled room on a 12-hour light–dark cycle. Azoxy-methane (AOM), a colonic carcinogen, was purchased fromSigma-Aldrich (St Louis). Dextran sodium sulfate (DSS), a non-genotoxic carcinogen with a molecular weight of 36,000 to50,000, which is widely used to produce colitis in rodents, waspurchased from ICN Biochemicals. All procedures were approvedby the Animal Care andUseCommittee of KumamotoUniversity.

Experimental procedureColitis and colonic neoplasia were induced using previously

established methods (27, 28). Colitis was induced by 2% DSS indrinking water for 7 days. Mice were sacrificed on days 0, 1, 3, 5, 7,10, 14, 21, and 60.

Colonic neoplasia was induced by a single intraperitonealinjection of AOM (10 mg/kg) at the beginning of the experimentand followed by administration of 2%DSS in drinkingwater for 7days starting at 1 week after AOM injection. Mice were killed at 12weeks, and colon tissues were rapidly extracted and prepared forthe following studies. The number of tumors was counted mac-roscopically. Measurements of the longest perpendicular tumor

SPINK1 Promotes Colon Cancer Cell Proliferation

www.aacrjournals.org Mol Cancer Res; 13(7) July 2015 1131




diameters were made using a digital caliper, and tumor volumeswere estimated using the following formula:V¼ L�W�D�p/6,whereV is the tumor volume, L the length,W the width, andD thedepth (29).

Evaluation of clinical colitisDisease activity index was scored according to changes in weight,

hemoccult positivity, or gross bleeding, and stool consistency ondays 0, 1, 3, 5, 7, 10, 14, 21, and 28 as described previously (30).

Histologic analysisThe large intestine was divided into three equal segments (prox-

imal, middle, and distal). The distal colon was cut open longitu-dinally along the main axis and washed with PBS. It was fixed by10% buffered formalin for 24 hours, embedded in paraffin, sec-tioned, and stainedwithhematoxylin and eosin (H&E). Colitis wasevaluated on H&E-stained sections, according to the morphologiccriteria described by Cooper and colleagues (30)

Western blot analysisConventional Western blot analysis was performed as previ-

ously described (22). Rabbit anti-mouse Spink3 antibody (CellSignaling Technology) and rabbit anti-mouse actin antibody(Sigma-Aldrich) were used at 1:1,000 and 1:2,000, respectively.Anti-rabbit IgG antibody conjugated with horseradish peroxidase(Amersham Biosciences) was used. The band intensities werequantified by densitometry using ImageJ software (http://ima-gej.nih.gov/ij/), and normalized by the actin signals (n ¼ 3).

X-gal staining for b-galactosidase activityWe previously generated a Spink3lacZ/þ knock-in mouse using a

Cre recombination strategy (8). To determine Spink3 promoteractivity, we detected the activity of b-galactosidase produced bythe knock-in lacZ reporter gene in colon tissues. The protocol of

X-gal staining has been described previously (8). For each exper-iment, rigorous controls were carried out simultaneously inSpink3 wild-type mice to assay background endogenous b-galac-tosidase activity.

Figure 1.Immunohistochemical analysis of SPINK1 in human colorectal cancer. SPINK1 staining in (A) normal colon tissue and (B–E) colorectal cancer. (B) Negative, (C) weak,(D) moderate, and (E) strong staining patterns. Scale bars, 50 mm.

Table 1. Characteristics of patients with colorectal cancer andclinicopathological factors related to recurrence after surgical resection

SPINK1 (�) SPINK1 (þ)n ¼ 102 (45.1%) n ¼ 124 (54.9%) P

Age 66.2 � 1.3 65.3 � 1.2 0.63Sex (M; F) 52; 50 83; 41 a<0.05Tumor location(colon; rectum)

58; 44 61; 63 0.22

Tumor (T) stage0 0 (0) 4 (3.2)1 4 (3.9) 7 (5.7)2 12 (11.8) 21 (16.9)3 57 (55.9) 78 (62.9)4 29 (28.4) 14 (11.3) b<0.01

Lymph node (N) stage0 45 (44.1) 67 (54.0)1 36 (35.3) 27(21.8)2 17 (16.7) 29 (23.4)3 4 (3.9) 1 (0.8) a<0.05

TNM stage0 0 (0) 2 (1.6)1 9 (8-8) 18 (14.5)2 28 (27.5) 41 (33.1)3a 32 (31.4) 24 (19.4)3b 10 (9.8) 28 (22.6)4 23 (25.6) 11 (8.9) b<0.01

Histologic typeWell, Mod 80 (78.4) 118 (95.2)Por, Sig. Muc 22 (21.6) 6 (4.8) c<0.001

Abbreviations: Mod,moderately differentiated adenocarcinoma; Muc, mucinousadenocarcinoma; Por, poorly differentiated adenocarcinoma; Sig, signetring cell carcinoma; TNM, tumor–node–metastasis; Well, well-differentiatedadenocarcinoma.

Ida et al.

Mol Cancer Res; 13(7) July 2015 Molecular Cancer Research1132




Statistical analysisAll data are expressed as mean � SE. The survival curves were

plotted according to the Kaplan–Meier method. Statistical anal-yses were performed using JMP version 10.0 statistical softwarepackage (SAS Institute). A two-sided significance level of P < 0.05was used for all the statistical analyses.

ResultsSPINK1 expression in human colon cancer tissues

We examined expression of SPINK1 in human colorectal can-cer. SPINK1 expression in normal human colon tissues wasobserved at the basal side of normal crypts (Fig. 1A). In colorectalcancer tissues, SPINK1 was expressed in the cell membrane andcytoplasm of the mucosa (Fig. 1C–E, no staining in B). Inimmunohistochemical staining of colorectal cancer tissues, pos-itive expression (scores 2–9) of SPINK1 in the primary tumor wasobserved in 124 (%) of the 226 samples. SPINK1 immunoreac-tivity was negative in 102 (45.1%), with scores 0 and 1 in 75(33.2%) and 27 (11.9%), respectively. The concordance betweenthe two observers was 0.86 (k ¼ 0.71), indicating substantialagreement. SPINK1 was positively associated significantly withhistologic type. The value of SPINK1 immunoreactivity in well/moderately differentiated adenocarcinoma and undifferentiatedtumors was 2.8 � 0.2 and 1.3 � 0.5, respectively (P < 0.01).Significantly higher expression of SPINK1 was observed inadvanced tumors (P<0.01; Table 1).Weanalyzed the relationshipbetween overall survival and expression of SPINK1. SPINK1 wasnot significantly associated with overall survival (log rank, P ¼0.34; Supplementary Fig. S1).

SPINK1 plays a role in proliferation of colon cancer cell linesTo analyze the growth stimulation in colorectal cancer of

SPINK1, we used four typical human colon cancer cell lines:Colo205, HCT116, HT29, and SW620. Under normal condi-tions, SPINK1 was clearly detected by RT-PCR in Colo205 andHT29 cells. However, SPINK1 expression was weak in HCT116and SW620 cell lines (Fig. 2A). We examined the growth-stimulating activity of SPINK1 using Colo205 cells. To assaythe effects of silencing of SPINK1, Colo205 and HT29 cells weretransiently transfected with two different types of siRNAs(SPINK1 siRNA #1 and #2) that target SPINK1 mRNA fordegradation. siRNA#1 and siRNA#2 both inhibited SPINK1mRNA in the respective cell lines. The number of Colo205cells transfected with SPINK1 siRNA#1 and #2 was significantlyreduced as compared with mock-transfected cells (P <0.05; Fig. 2B). Otherwise, HT29 cells were also transfected withSPINK1 siRNA #1 and #2 tended to reduce as compared withmock-transfected cells. To assay the effects of overexpression ofSPINK1 on cell proliferation, Colo205 cells were transientlytransfected either with empty vector or SPINK1 expression(SPINK1 was driven by CAG promoter) vector. Compared withempty vector, the number of transfected cells with SPINK1expression vector was significantly increased (P < 0.05;Fig. 2C). Furthermore, we transfected SPINK1 expression vectorinto HCT 116 cells, which showed weak expression of SPINK1.The number of transfected cells with SPINK1 expression vectorwas also significantly increased (P < 0.01; Fig. 2D). These resultssuggest that SPINK1 functions in the proliferation of humancolon cancer cells.

Figure 2.Proliferation of colon cancer cell lines. A, expression pattern of SPINK1 mRNA in four colon cancer cell lines. Saline was used as a negative control. B, inhibition ofcell proliferation by silencing of SPINK1 in Colo205 and HT29 cells. Untreated (growth medium only) and mock-treated (negative control of siRNA) cells.Effect of overexpression of SPINK1 on Colo205 (C) and HCT116 (D) cell proliferation. Untreated (growth medium only), empty vector (negative control), andoverexpression of SPINK1 (CAG-SPINK1). The number of cells in the untreated group is shown as 100%. Data represent mean � SE. � , P < 0.05; �� , P < 0.01.






Spink3 expression is overexpressed at the regenerative stage incolitis

Weexaminedwhether the expressionof Spink3differed accord-ing to each segment of the colon in normal conditions. In theWestern blotting analysis, Spink3 expression in the proximalcolon tissue was weak, and was strongest in the distal colon (Fig.3A). The tumor tends to arise in the distal colon in the AOM-DSScolon cancer model; therefore, we used distal colon tissue forsubsequent studies.

To analyze the reaction with DSS, we examined the severity ofthe colitis (n ¼ 3). The disease activity index was highest at day 7(8.7 � 0.3), and this score gradually decreased during the study(Fig. 3B). Histologically, infiltration of inflammatory cells andshortening and loss of the basal one third of the actual crypts wereobserved fromday 3 (Fig. 3D), and entire cryptswere destroyed by

day 7 (Fig. 3E), compared with the normal colon tissue (Fig. 3C).Formation of new surface epithelium and crypts was observedafter day 10 (Fig. 3F–H), especially on days 10 and 14. Thus, wedefined days 1 to 7 as the acute colitis stage, and after day 8 as theregenerative stage. The level of Spink3 expression reached its peakat days 10 to 14 and declined by day 60 (Fig. 3I). These resultssuggest that Spink3 is overexpressed at the regenerative stage incolitis induced by DSS, and therefore might play a role in the cellproliferation of the colonic epitheliumduring the healing process.

Spink3 expression is upregulated in colon cancerUsing the AOM-DSS model, flat, nodular, or polypoid colonic

tumorswere identifiedmacroscopically in the distal colon ofmicethat received AOM andDSS (n¼ 6; Fig. 4A). Histopathologically,they were tubular adenocarcinoma (Fig. 4B). None of the mice

Figure 3.Time course of Spink3 expression in DSS colitis. A, expression pattern of Spink3 protein in normal colon. B, time course of disease activity index. C–H, histologicchanges of colitis, followed by colonic regeneration. The histologic changes were as follows: day 0 (no treatment; C), day 3 (D), day 7 (E), day 10 (F), day 14(G), and day 60 (H). Scale bars, 50 mm. I, time course of expression pattern of Spink3 protein.

Ida et al.





given AOM alone (n¼ 6), DSS alone (n¼ 6), or tap water (n¼ 6)had any colonic tumors (data not shown). Compared with theuntreated colon (control), Spink3 was increased in the tumortissues and surrounding non-neoplastic tissues (Fig. 4C). Spink3expression was increased significantly in tumors compared withthe untreated tissues and surrounding non-neoplastic tissues(P < 0.05; Fig. 4D).

Localization of Spink3 in colon cancer epitheliumWe examine the localization of Spink3 in colon tissues.

b-Galactosidase activity was little observed by X-gal staining inthe control (untreated colon of Spink3lacZ/þ mice; n ¼ 3; Fig. 5A).In other words, endogenous b-galactosidase activity in the coloncould be excluded. In AOMþDSS–treatedmice (n¼ 3), Spink3lacZ/þwas expressedhighly in the colon cancer epithelium(Fig. 5B and

Figure 4.Expression of Spink3 in CAC. A,macroscopic, scale is 1 mm.Histopathologic view (B) and (C)expression of Spink3 in tumor tissues(Tumor) and surrounding non-neoplastic tissues (nontumor), and (D)densitometric analysis of Spink3.� , P < 0.05. N.S., not significant.Scale bars, 100 mm.

Figure 5.Localizationof Spink3 in colon cancer epithelium. X-gal staining in the control (A), AOMþDSSmodel (B), tumor (C), andnontumor lesions (D). T, tumor; N, non-tumor.Scale bars, 100 mm.






C). Although expression of Spink3 also increased in the surround-ing non-neoplastic tissue, the expression did not occur in theentire crypt of the colon but was confined to particular areas(Fig. 5B and D).

Spink3 promotes development of colorectal cancerTo examine the role of Spink3 in vivo, we addressed whether the

absence of Spink3 altered the susceptibility to develop CAC.Previously, we generated Spink3 knockout mice; however, thesemice did not survive beyond 15 days postpartumbecause of acutepancreatitis (5). Hence, Spink3 heterozygote (Spink3lacZ/þ) andwild-type (Spink3þ/þ) mice were treated with AOM and DSS. Thelevel of Spink3 in Spink3lacZ/þ mice was decreased by up to 10%comparedwith that ofwild-typemice (Fig. 6A). Inwild-typemice,tumor incidence, multiplicity, and tumor volume were 100%(n ¼ 8): 4.6 � 0.8 per mouse, and 28.2 � 4.2 mm3, respectively(Fig. 6B and C). In contrast, tumor incidence, multiplicity, andvolume were significantly decreased (P < 0.05) in Spink3lacZ/þ

mice compared with wild-type mice. Only four of seven (57%)Spink3lacZ/þmice had tumors, and the multiplicity and volume oftumors were 1� 0.4 per mouse and 16.8� 1.9 mm3, respectively(Fig. 6B andC). These results suggest that Spink3plays a role in theprogression of CAC.

DiscussionIn this study, we showed that SPINK1/Spink3 is overexpressed

in colon cancer and mediates the proliferation of colon cancercells. This is believed to be the first study to show that SPINK1/Spink3 acts as a cell proliferative factor in colon cancer using an invivo model.

Previously, we showed that SPINK1/Spink3 is overexpressed inacute (31, 32) and chronic pancreatitis (33). An interestingquestion is the cause of the increased SPINK1 expression in theinflammatory state. The SPINK1 gene contains an IL6-responsiveelement in hepatoma cells, and expression of SPINK1 is inducedby IL6 and IL1, which are inducers of acute-phase reactions (34).

SPINK1 protein is secreted from the liver in the systemic circu-lation as one of the acute-phase proteins to inhibit trypsin activityin tissues. In addition, it has already been reported that IL6 isinduced in DSS colitis mice (35). In the current study, we showedthat Spink3 was overexpressed at the regenerative stage in DSScolitis and that it may have contributed to the proliferation andrepair of the colonic cells.

Several investigators have revealed that SPINK1 and trypsin,which actively contribute to tumor invasion and metastasis, arecoexpressed in colorectal adenocarcinoma. This supports a pro-tective role of SPINK1 against tumor invasion. However, SPINK1has been noted to play a role as a protease inhibitor and a growthfactor. There are some structural similarities between SPINK1 andthe potent growth factor EGF; both have similar numbers ofamino acid residues (56 and 53, respectively) and molecularweights (�6 kD), and both have three intrachain disulfide bridges(7, 36). There is a 50% gene sequence homology between SPINK1and EGF (37–39). Recently, we showed that SPINK1 binds to EGFreceptor (EGFR) to activate its downstream signaling, resulting inthe proliferation of pancreatic and breast cancer cells (22). In thecurrent study, we showed that tumor number and volume weresignificantly decreased in Spink3lacZ/þ compared with wild-typemice. Thesefindings revealed that SPINK1/Spink3haspotential asgrowth factors for colorectal cancer.

In the gastrointestinal tract, Spink3 ismost strongly expressed inthe sigmoid colon and rectum at the embryonic stage (8). Inaddition, we previously revealed that the epithelial of the duo-denum and small intestine in Spink3�/� mice were degenerated(5). Furthermore, SPINK1 expression in the human colon tissueswas observed at the basal side of the normal crypt, an importantsite for proliferation of the epithelium. Therefore, SPINK1/Spink3has a crucial role in the proliferation and integrity of the gastro-intestinal tract. Spink3 expression was increased in colon cancertissues and surrounding non-neoplastic tissues in Spink3lacZ/þ

mice and in Spink3 (cre);R26R mice (ref. 40, data not shown).Furthermore, its expression showed punctate distribution in thecrypt. Although the mechanisms by which SPINK1 is associated

Figure 6.Spink3 heterozygote mice havedecreased tumor incidence. A,comparison of Spink3 expression inwild-type (Spink3þ/þ) and Spink3heterozygote (Spink3lacZ/þ) mice.Spink3/actin densitometric value. B,tumor incidence; C, tumor multiplicity.Black bar indicates control Spink3þ/þ

mice, gray bar indicates Spink3lacZ/þ

mice. Data represent mean � SE.� , P < 0.05.

Ida et al.





with tumor progression in colorectal cancer are not clear, SPINK1/Spink3 may work as an autocrine- and/or paracrine-transformingfactor, potentially involved in cancer progression. The identity ofthe receptor for SPINK1 is controversial. SPINK1 can now beclassified as an EGFR ligand, but no specific SPINK1 receptor hasbeen identified. Niinobu and colleagues (41) reported that thebinding of human 125I–labeled SPINK1 to the same cells could bedisplaced by cold SPINK1 but not EGF, suggesting a separatereceptor. Recently, the monoclonal EGFR antibody cetuximabwas introduced to treat colon cancer successfully in wild-typeKRAS patients. In prostate cancer, cetuximab is effective forSPINK1-positive and ETS-negative populations (42). In thecurrent study, the rate of positive immunohistochemical stainingfor SPINK1 was 54.9%. It was almost equivalent to the resultof SPINK1-positive rate, 65% to 75%, reported in other studies(43, 44). These results provide a rationale for thedevelopment of ahumanized monoclonal antibody against SPINK1 and its use incombination with other tools for EGFR inhibition for the treat-ment of selected colon cancer patients.

Increased expression of SPINK1 in tumor tissue has beenreported in patients with poor survival (21, 25, 45–48) andfavorable prognosis (9, 24, 43). As shown above, SPINK1/Spink3 acts as a growth factor in colorectal cancer. However,it was shown that high tissue expression of SPINK1 correlateswith better prognosis in colorectal cancer. This discrepancycould be explained by the fact that SPINK1/Spink3 works aspromoting factors in the early period of tumor formation andmay have an inhibitory influence on tumor in the late period.Koskensalo and colleagues (24) revealed that concomitantexpression of EGFR and SPINK1 is an even better marker forimproved survival. They postulated that a favorable prognosisin colorectal cancer may result from binding of SPINK1, leadingto inhibition of the EGFR signaling cascade. SPINK1 binding toEGFR may inhibit the binding of stronger activating ligands.The relationship between SPINK1 function and prognosis hasmany obscure points.

In conclusion, SPINK1/Spink3 promotes the proliferation ofcolon cancer cells. Further studies are necessary to identifythe specific receptor for SPINK1 and to analyze its signaltransduction.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: S. Ida, K. Hirashima, H. Baba, M. OhmurayaDevelopment of methodology: S. Ida, M. OhmurayaAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): S. Ida, N. Ozaki, K. Araki, K. Taki, M. Watanabe,M. OhmurayaAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): S. Ida, Y. Zaitsu, M. Watanabe, K.-i. Yamamura,M. OhmurayaWriting, review, and/or revision of the manuscript: S. Ida, Y. Sakamoto,H. Baba, M. OhmurayaAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): M. Morita, M. OhmurayaStudy supervision: Y. Miyamoto, E. Oki, Y. Maehara, K.-i. Yamamura,M. Ohmuraya

AcknowledgmentsThe authors thank Yumi Otake, Michiyo Nakata, Yuko Kubota, and Keisuke

Miyake for their technical assistance.

Grant SupportThis work was supported by a grant-in-aid for Young Scientists (B)

(KAKENHI) (25861196) from the Japanese Society for the Promotion ofScience.

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

ReceivedOctober 27, 2014; revised February 9, 2015; acceptedMarch 5, 2015;published OnlineFirst March 24, 2015.

References1. ChambersWM,WarrenBF, JewellDP,MortensenNJ.Cancer surveillance in

ulcerative colitis. Br J Surg 2005;92:928–36.2. Kazal LA, Spicer DS, Brahinsky RA. Isolation of a crystalline trypsin

inhibitor-anticoagulant protein from the pancreas. J Am Chem Soc 1948;70:3034–40.

3. Stenman UH, Huhtala ML, Koistinen R, Seppala M. Immunochemicaldemonstrationof anovarian cancer-associatedurinary peptide. Int J Cancer1982;30:53–7.

4. Ohmuraya M, Hirota M, Araki K, Baba H, Yamamura K. Enhanced trypsinactivity in pancreatic acinar cells deficient for serine protease inhibitor kazaltype 3. Pancreas 2006;33:104–6.

5. Ohmuraya M, Hirota M, Araki M, Mizushima N, Matsui M, MizumotoT, et al. Autophagic cell death of pancreatic acinar cells in serineprotease inhibitor Kazal type 3-deficient mice. Gastroenterology 2005;129:696–705.

6. Paju A, Stenman UH. Biochemistry and clinical role of trypsinogens andpancreatic secretory trypsin inhibitor. Crit Rev Clin Lab Sci 2006;43:103–42.

7. Marchbank T, Freeman TC, Playford RJ. Human pancreatic secretorytrypsin inhibitor: distribution, actions and possible role in mucosal integ-rity and repair. Digestion 1998;59:167–74.

8. Wang J, Ohmuraya M, Hirota M, Baba H, Zhao G, Takeya M, et al.Expression pattern of serine protease inhibitor kazal type 3 (Spink3) duringmouse embryonic development. Histochem Cell Biol 2008;130:387–97.

9. Wiksten JP, Lundin J, Nordling S, Kokkola A, Stenman UH, Haglund C.High tissue expression of tumor-associated trypsin inhibitor (TATI) associ-ates with a more favourable prognosis in gastric cancer. Histopathology2005;46:380–8.

10. Soreide K, Janssen EA, Korner H, Baak JP. Trypsin in colorectal cancer:molecular biological mechanisms of proliferation, invasion, and metas-tasis. J Pathol 2006;209:147–56.

11. Marchbank T, Chinery R, Hanby AM, Poulsom R, Elia G, Playford RJ.Distribution and expressionof pancreatic secretory trypsin inhibitor and itspossible role in epithelial restitution. Am J Pathol 1996;148:715–22.

12. Playford RJ, Hanby AM, Patel K, Calam J. Influence of inflammatory boweldisease on the distribution and concentration of pancreatic secretorytrypsin inhibitor within the colon. Am J Pathol 1995;146:310–6.

13. Kitahara T, Takatsuka Y, Fujimoto KI, Tanaka S, Ogawa M, Kosaki G.Radioimmunoassay for human pancreatic secretory trypsin inhibitor:measurement of serum pancreatic secretory trypsin inhibitor in normalsubjects and subjects with pancreatic diseases. Clin Chim Acta 1980;103:135–43.

14. Matsuda K, Ogawa M, Shibata T, Nishibe S, Miyauchi K, Matsuda Y, et al.Postoperative elevation of serumpancreatic secretory trypsin inhibitor. AmJ Gastroenterol 1985;80:694–8.

15. HigashiyamaM,MondenT, TomitaN,MurotaniM, Kawasaki Y,MorimotoH, et al. Expression of pancreatic secretory trypsin inhibitor (PSTI) incolorectal cancer. Br J Cancer 1990;62:954–8.






16. Tomita N, Doi S, Higashiyama M, Morimoto H, Murotani M, Kawasaki Y,et al. Expression of pancreatic secretory trypsin inhibitor gene in humancolorectal tumor. Cancer 1990;66:2144–9.

17. Tomita N, Horii A, Yamamoto T, Ogawa M, Mori T, Matsubara K. Expres-sion of pancreatic secretory trypsin inhibitor gene in neoplastic tissues.FEBS Lett 1987;225:113–9.

18. Higashiyama M, Doi O, Kodama K, Yokouchi H, Tateishi R, Matsuura N,et al. Immunohistochemical analysis of pancreatic secretory trypsin inhib-itor expression in pulmonary adenocarcinoma: its possible participation inscar formation of the tumor tissues. Tumour Biol 1992;13:299–307.

19. Ohmachi Y, Murata A, Matsuura N, Yasuda T, Yasuda T, Monden M, et al.Specific expression of the pancreatic-secretory-trypsin-inhibitor (PSTI)gene in hepatocellular carcinoma. Int J Cancer 1993;55:728–34.

20. Ogawa M, Matsuura N, Higashiyama K, Mori T. Expression of pancreaticsecretory trypsin inhibitor in various cancer cells. Res Commun ChemPathol Pharmacol 1987;55:137–40.

21. Tomlins SA, Rhodes DR, Yu J, Varambally S, Mehra R, Perner S, et al. Therole of SPINK1 inETS rearrangement-negative prostate cancers. CancerCell2008;13:519–28.

22. Ozaki N, Ohmuraya M, Hirota M, Ida S, Wang J, Takamori H, et al. Serineprotease inhibitor Kazal type 1 promotes proliferation of pancreatic cancercells through the epidermal growth factor receptor. Mol Cancer Res2009;7:1572–81.

23. Gouyer V, Fontaine D, Dumont P, de Wever O, Fontayne-Devaud H,Leteutre E, et al. Autocrine induction of invasion and metastasis bytumor-associated trypsin inhibitor in human colon cancer cells. Oncogene2008;27:4024–33.

24. Koskensalo S, Louhimo J,Hagstrom J, LundinM, StenmanUH,HaglundC.Concomitant tumor expression of EGFR and TATI/SPINK1 associates withbetter prognosis in colorectal cancer. PLoS One 2013;8:e76906.

25. Gaber A, JohanssonM, StenmanUH,HotakainenK, Ponten F,Glimelius B,et al. High expression of tumour-associated trypsin inhibitor correlateswith liver metastasis and poor prognosis in colorectal cancer. Br J Cancer2009;100:1540–8.

26. Horii A, Kobayashi T, Tomita N, Yamamoto T, Fukushige S, Murotsu T,et al. Primary structure of human pancreatic secretory trypsin inhibitor(PSTI) gene. Biochem Biophys Res Commun 1987;149:635–41.

27. Suzuki R, Kohno H, Sugie S, Nakagama H, Tanaka T. Strain differences inthe susceptibility to azoxymethane and dextran sodium sulfate-inducedcolon carcinogenesis in mice. Carcinogenesis 2006;27:162–9.

28. Suzuki R, Kohno H, Sugie S, Tanaka T. Sequential observations on theoccurrence of preneoplastic and neoplastic lesions in mouse colon treatedwith azoxymethane anddextran sodiumsulfate.Cancer Sci 2004;95:721–7.

29. Hirashima K, Baba Y,WatanabeM, Karashima RI, SatoN, Imamura Y, et al.Aberrant activation of the mTOR pathway and anti-tumour effect ofeverolimus on oesophageal squamous cell carcinoma. Br J Cancer 2012;106:876–82.

30. Cooper HS,Murthy SN, Shah RS, Sedergran DJ. Clinicopathologic study ofdextran sulfate sodium experimental murine colitis. Lab Invest 1993;69:238–49.

31. Neuschwander-Tetri BA, Fimmel CJ, Kladney RD, Wells LD, Talkad V.Differential expression of the trypsin inhibitor SPINK3 mRNA and themouse ortholog of secretory granule protein ZG-16p mRNA in the mousepancreas after repetitive injury. Pancreas 2004;28:e104–11.

32. Wang J, Ohmuraya M, Suyama K, Hirota M, Ozaki N, Baba H, et al.Relationship of strain-dependent susceptibility to experimentally inducedacute pancreatitis with regulation of Prss1 and Spink3 expression. LabInvest 2010;90:654–64.

33. Ida S, Ohmuraya M, Hirota M, Ozaki N, Hiramatsu S, Uehara H, et al.Chronic pancreatitis inmice by treatmentwith choline-deficient ethionine-supplemented diet. Exp Anim 2010;59:421–9.

34. Yasuda T, Ogawa M, Murata A, Ohmachi Y, Mori T, Matsubara K. Iden-tification of the IL-6-responsive element in an acute-phase-responsivehuman pancreatic secretory trypsin inhibitor-encoding gene. Gene 1993;131:275–80.

35. Matsumoto S,Hara T,MitsuyamaK, YamamotoM, TsurutaO, SataM, et al.Essential roles of IL-6 trans-signaling in colonic epithelial cells, induced bythe IL-6/soluble-IL-6 receptor derived from lamina propria macrophages,on the development of colitis-associated premalignant cancer in a murinemodel. J Immunol 2010;184:1543–51.

36. Fukuoka S, Fushiki T, Kitagawa Y, Sugimoto E, Iwai K. Competition of agrowth stimulating-/cholecystokinin (CCK) releasing-peptide (monitorpeptide) with epidermal growth factor for binding to 3T3 fibroblasts.Biochem Biophys Res Commun 1987;145:646–50.

37. Hunt LT, Barker WC, Dayhoff MO. Epidermal growth factor: internalduplication and probable relationship to pancreatic secretory trypsininhibitor. Biochem Biophys Res Commun 1974;60:1020–8.

38. Scheving LA. Primary amino acid sequence similarity between humanepidermal growth factor-urogastrone, human pancreatic secretory trypsininhibitor, and members of porcine secretin family. Arch Biochem Biophys1983;226:411–3.

39. Yamamoto T, Nakamura Y, Nishide J, Emi M, Ogawa M, Mori T, et al.Molecular cloning and nucleotide sequence of human pancreatic secretorytrypsin inhibitor (PSTI) cDNA. Biochem Biophys Res Commun 1985;132:605–12.

40. Sakata K, Ohmuraya M, Araki K, Suzuki C, Ida S, Hashimoto D, et al.Generation and analysis of serine protease inhibitor kazal type 3-cre drivermice. Exp Anim 2014;63:45–53.

41. Niinobu T, Ogawa M, Murata A, Nishijima J, Mori T. Identification andcharacterization of receptors specific for human pancreatic secretory tryp-sin inhibitor. J Exp Med 1990;1133–42.

42. Ateeq B, Tomlins SA, Laxman B, Asanganni IA, Cao Q, Cao X, et al.Therapeutic targeting of SPINK1-positive prostate cancer. Sci Transl Med2011;3:72ra17.

43. Koskensalo S, Hagstrom J, Louhimo J, Stenman UH, Haglund C. Tumor-associated trypsin inhibitor TATI is a prognostic marker in colorectalcancer. Oncology 2012;82:234–41.

44. Solakidi S, Tiniakos DG, Petraki K, Stathopoulos GP, Markaki I, Androu-lakis G, et al. Co-expression of trypsin and tumor-associated trypsininhibitor (TATI) in colorectal adenocarcinomas. Histol Histopathol2003;18:1181–88.

45. Lee YC, Pan HW, Peng SY, Lai PL, KuoWS, Ou YH, et al. Overexpression oftumor-associated trypsin inhibitor (TATI) enhances tumor growth and isassociated with portal vein invasion, early recurrence and a stage-inde-pendent prognostic factor of hepatocellular carcinoma. Eur J Cancer2007;43:736–44.

46. Tonouchi A, Ohtsuka M, Ito H, Kimura F, Shimizu H, Kato M, et al.Relationship between pancreatic secretory trypsin inhibitor and earlyrecurrence of intrahepatic cholangiocarcinoma following surgical resec-tion. Am J Gastroenterol 2006;101:1601–10.

47. Stenman UH. Tumor-associated trypsin inhibitor. Clin Chem 2002;48:1206–9.

48. Huhtala ML, Pesonen K, Kalkkinen N, Stenman UH. Purification andcharacterization of a tumor-associated trypsin inhibitor from theurine of a patient with ovarian cancer. J Biol Chem 1982;257:13713–6.


Ida et al.




2015;13:1130-1138. Published OnlineFirst March 24, 2015.Mol Cancer Res Satoshi Ida, Nobuyuki Ozaki, Kimi Araki, et al. Role in Colitis-Associated CancerSPINK1 Status in Colorectal Cancer, Impact on Proliferation, and

Updated version

10.1158/1541-7786.MCR-14-0581doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2015/03/25/1541-7786.MCR-14-0581.DC1

Access the most recent supplemental material at:

Cited articles

http://mcr.aacrjournals.org/content/13/7/1130.full#ref-list-1

This article cites 47 articles, 5 of which you can access for free at:

Citing articles

http://mcr.aacrjournals.org/content/13/7/1130.full#related-urls

This article has been cited by 1 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/13/7/1130To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-14-0581

http://mcr.aacrjournals.org/content/suppl/2015/03/25/1541-7786.MCR-14-0581.DC1

http://mcr.aacrjournals.org/content/13/7/1130.full#ref-list-1

http://mcr.aacrjournals.org/content/13/7/1130.full#related-urls

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/13/7/1130


spink1 status in colorectal cancer, impact on ... · published onlinefirst march 24, 2015; doi:...

Documents