TEE JOURNAL OF BIOLCGICAL CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc

Vol. 269, NO. 51, Issue of December 23, pp. 3245132456, 1994 Printed in U.S.A.

Structural Organization of the Human Oxytocin Receptor Gene*

(Received for publication, July 13, 1994)

Tomoko Inoue, Tadashi KimuraS, Chihiro Azuma, Johji Inazawas, Masahiko Takemura, Tomoyuki Kikuchi, Yasue Kubota, Kazuhide Ogita, and Fumitaka Saji From the Department of Obstetrics and Gynecology, Osaka University Medical School, Suita City, 565 Osaka, Japan, and the $Department of Hygiene, Kyoto Prefectural University of Medicine, 602 Kyoto, Japan

We isolated and charactarized the human oxytocin receptor gene. Southern blots indicated that the human genome has a single copy of the gene. Chromosomal lo- calization by fluorescence in situ hybridization also showed that the gene was a single copy, assigned to 3p26.2 of the human chromosome. The gene spans ap- proximately 17 kilobases and contains 3 introns and 4 exons. Exons 1 and 2 correspond to the B'-non-coding region, followed by exons 3 and 4 encoding the amino acids of the receptor. Intron 3, which is the largest at 12 kilobases, separates the coding region immediately after the putative sixth transmembrane-spanning domain.

The transcription start sites, demonstrated by primer extension analysis, lie 618 and 621 base pairs upstream of the methionine initiation codon. Near these putative transcription start sites, we found a TATA-like motif and a potential SP-1 binding site at about 30 and 65 base pairs, respectively. We also found other known binding sites of transcription regulating factors, such as AP-1, AP-2, GATA-1, Myb, nucleofactor-interleukin 6 binding consensus sequence, and an acute phase reactant-re- sponsive element. No estrogen-responsive element was observed except three half-palindromic estrogen-re- sponsive element motifs. Our findings of the oxytocin receptor gene structure should help to elucidate the mechanism by which the gene expression is induced drastically at parturition in the uterus and how the gene is regulated in other organs such as the mammary gland or central nervous system.

Oxytocin (OT)' is a nonapeptide hormone secreted mainly from the posterior pituitary gland. The major endocrine func- tion of OT is uterotonic action at parturition and milk ejection (1). In addition to these major actions, OT is thought to affect

Research 04454417, 05454449, 05454450, 04671002, and 04671003 * This work was supported in part by Grants-in-aid for Scientific

from the Ministry of Education, Science and Culture of Japan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "aduertise- ment" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequencefsl reported in this paper has been submitted to the GenBankmIEMBL Data Bank with accession number(s) X80282.

$ To whom all correspondence should be addressed: Dept. of Obstet- rics and Gynecology, Osaka University Medical School, 2-2 Yamadaoka, Suita City, Osaka 565, Japan.

The abbreviations used are: OT, oxytocin; OTR, OT receptor; kb, kilobase(s); bp, base paifis); VZR, vasopressin V2 receptor; ERE, estro- gen-responsive element; NF IL-6, nucleofactor interleukin 6; PIPES, 1,4-piperazinediethanesulfonic acid.

the regulation of ovarian function (2) and to play a role in the central nervous system (3) and other organs. The physiologi- cal effect of OT is mediated via its specific receptor (OTR). The structure of OTR was deduced from a human OTR cDNA that we cloned (4). The cDNA encodes a 391-amino acid protein and according to the sequence, OTR is a member of the G- protein-coupled, seven-transmembrane domain receptor superfamily.

The expression of OTR has been investigated conventionally using a radioligand binding assay (5) and more recently by Northern blot hybridizaion and in situ histochemistry (6, 7). OTR has been detected in many organs; however, the most interesting aspect of its expression occurs in the uterus at par- turition. At this time, OT is thought to be crucial in its initia- tion; however, the concentration of OT in maternal plasma during spontaneous parturition does not change significantly before and during labor (8,9). On the other hand, the number of OT binding sites in the pregnant uterus increases dramati- cally at parturition (10, 11). We also revealed that the amount of OTR mRNA in the myometrium at parturition is more than 100 times that in non-pregnant myometrium (4,12). Therefore, the effectiveness of OT should depend on the expression of i ta receptor, which should be regulated mainly at the gene tran- scription level in an organ- and time-specific manner. To ana- lyze the unique mechanism of this induction, it was necessary to investigate the structure of the OTR gene. Here we cloned and characterized of the gene for human OTR and mapped it on a chromosome.

MATERIALS AND METHODS Isolation of Human OTR Genomic Clones-The OTR gene was iso-

lated from two human genomic libraries constructed in EMBL3SP6PT7 using placental DNA (Clontech, Palo Alto, CAI and in Charon4A using DNA from mononuclear cells in peripheral blood (a gift from Dr. T. Maniatis, Harvard University). About 2.5 x lo6 clones were screened with random primer-labeled restriction fragments of human OTR cDNA, namely a XhoIIPstI fragment (-367 - +711 of cDNA when the translational start site (ATG) was designated as +1) and a PstIIPstI fragment (+1195 - +2821 of the cDNA), by standard plaque hybridiza- tion (12). Four positive clones were further characterized by restriction mapping, subcloned into the pBluescript I1 KS' vector (Stratagene, La Jolla, CA), and sequenced by dideoxy chain termination methods (Se- quencing High kit, Toyobo, Osaka, Japan). The sequence was analyzed using the Genetix version 9.0 program (Software Development Co., Ltd., Tokyo, Japan).

Southern Hybridization ofthe OTR Gene-High molecular DNAfiom the human placenta was isolated using SDS and phenolkhroloform. Ten micrograms of DNAwas digested with BgZII, EcoRI, PstI, and XbaI. The digest samples were separated on 0.8% agarose gel and transferred to a nylon membrane (Biodyne A, Pall, New York, NY). The membrane was hybridized with a 32P-labeled OTR cDNA BamHIIPstI fragment (-67 - +711 of the cDNA) in 10 x Denhardt's solution, 5 x SSC, 0.1% SDS, and 100 pg/ml denatured, fragmented salmon sperm DNA at 65 "C (50 x

32451

32452 Structure of Human OTR Gene

-13 -10 0 10 20 22 Kb

I "

0 9 (a) genomic

4 8 clones

E 1 7 3 E E E d H H E

(b) OTR gene

ATG I I I 111 IV V VI VI1 TGA U lOObp

(c) OTR cDNA I-VI1 ; transmembrane domain

kb upstream of the translation start site to 22 kb downstream. The 7.4-kb EcoRI fragment containing exons 1-3, the 3.9-kb HindIII fragment, and FIG. 1. Organizaton of the human oxytocin receptor gene. a, four overlapping genomic clones (phage 1 ,8 ,9 , and 13) span 35 kb from 13

the 1.2-kb HindIIIIEcoRI fragment containing exon 4 were subcloned into pBluescript I1 KS' and sequenced. b, a diagram of the OTR gene. Exons are represented by closed boxes and are numbered. The restriction sites ( E , EcoRI; H, HindIII) are indicated by vertical lines. c, the structure of OTR cDNA. The regions encoding the membrane-spanning domains are represented by closed boxes and numbered. The regions encoding extracellular and intracellular domains are shown by hatched boxes. The translation start (ATG) and termination sites (TGA) are indicated. The adenosine of start site is designated as + l .

TABLE I Exon-intron organization of the hOTR

Lowercase letters correspond to the intron sequence, and uppercase letters to the exon sequence. The deduced amino acid sequence is shown below the nucleotide sequence. The sequences are numbered sequentially from the first nucleotide of the methionine initiation codon.

5' splice donor Intron (size) 3' splice acceptor

-1044 . . . GTGCAGgtagc . . .

-380 . . . GAGGAGgtacc . . . +922

. . . AGGAAGgtagc . . . GluA

Intron 1 (639 bp)

Intron 2 (166 bp)

Intron 3 (-12 kb)

-404 . . . cccagTGGAAG . . . -142 . . . ttcagGGTGGA . . .

. . . ctcagCCTCGG . . . +923

laSerAla

Denhardt's contains 5% (w/v) of Ficoll, 5% (wh) polyvinylpyrrolidone, and 5% (w/v) bovine serum albumin; 1 x SSC is 0.5 M NaCI, 15 mM sodium citrate, pH 7.0). Thereafter, the membrane was washed at 60 "C in 0.5 x SSC and 0.1% SDS for 30 min and exposed to Kodak XAR film with two image intensifiers for 16 h a t -70 "C.

Chromosomal Mapping of the OTR Gene by Fluorescence in Situ Hybridization-Fluorescence in situ hybridization proceeded as de- scribed (14). Metaphase chromosomes were prepared by thymidine syn- chronization and bromodeoxyuridine release technique for chromosome banding. The 4.1-kilobase (kb) full-length OTR cDNA was labeled with biotin-l,g-dUTP (Boehringer Mannheim) by nick-translation. The la- beled probe was precipitated with salmon sperm DNA and Escherichia coli tRNA, then dissolved in 20 pl of formamide. The mixture was denatured at 75 "C for 5 min and mixed with an equal volume of 4 x SSC containing 20% dextran sulfate. The hybridization mixture was placed on denatured slides, covered with Parafilm, and incubated in a humid box at 37 "C for 16 h. After being washed in 50% formamidd4 x SSC, 2 x SSC, and 1 x SSC (37 "C, 15 min each), hybridization signals were detected with fluorescein isothiocyanate-avidin (Boehringer Mannheim) and biotinylated anti-avidin (Vector Laboratories Inc., Burlingame, CAI as described (15).

Primer Extension-Primer extension was performed using the syn- thetic oligonucleotide PE-l5'-tgcactatcgcacgggtccg-3' (corresponding to the antisense cDNA sequence from -521 to -540), and PE-2 5"tgcct- ggggctgaggctgcactatcgcacgggtccgctag-3' (-505 to -544). These primers were labeled with [y-3zPlATP and approximately 0.5 pmol of the primers were annealed to 300 ng of poly(A)' RNA from human uterine myome- trium a t term. Ten microliters of the mixture was hybridized at 65 "C for 6 h in 0.4 M NaCl, 10 mM PIPES (pH 6.4), and primers were extended with murine leukemia virus reverse transcriptase (Life Technologies, Inc.) in the presence of deoxyribonucleotide triphosphates a t 42 "C for 1 h. As a negative control, 0.5 pmol of labeled PE-1 was mixed with the RNA and before the hybridization the primer was extended. The ex- tended products were separeted on a 7 M urea, 8% polyacrylamide gel and analyzed by autoradiography. The sizes of the resulting labeled, primer-extended products were inferred from migration compared with

that of a sequencing ladder, which was obtained using the same primer described above. Sequence-specific oligonucleotides were synthesized using a DNA synthesizer (model 381A, Applied Biosystems).

RESULTS AND DISCUSSION

Structure of the Human OTR Gene-We screened 2.5 x lo6 recombinants of human genomic libraries and isolated four independent clones. Restriction mapping revealed that these clones overlapped and span over 35 kb, from 13 kb upstream of the translation start site to 22 kb downstream of this position. All four clones contain the coding region of this gene (Fig. 1). Compared with the cDNA structure, the gene spans about 17 kb and consists of 4 exons and 3 introns. As shown in Table I, the GT-AG sequence (16) is conserved in all splice donor and acceptor sites of exodintron boundaries. Exons 1 and 2 contain the 5'-non-coding region. Up to 367 bp upstream from ATG codon, the sequence of these exons completely matches OTR cDNA. Introns 1 and 2 are relatively short (639 and 166 bp). Exon 3 starts 142 bp uptream from the adenosine of the ATG initiation codon and spans 922 bp downstream encoding be- yond the sixth transmembrane domain of the receptor. Intron 3 is the largest, being about 12 kb. Exon 4 contains the sequence encoding the seventh transmembrane domain, the C terminus, and the entire 3'-non-coding region, including the polyadenyl- ation signals (Fig. 2).

We compared the structure of the OTR gene with other G- protein-coupled, seven-transmembrane domain receptors (Fig. 3). Although many receptors in this family have an intronless gene structure, the genes for human vasopressin V2 receptor (V2R) (17), thromboxane4 receptor (181, endothelin-Areceptor (19) and a,,-adrenergic receptor (20) contain an intron at the

Structure of Human OTR Gene 32453 -1680 ctgctaaagccyctacatcaaqctgyaygtgtyyggyyagagaaaagcctgaaaattaacatcatttttgygaaataatcagtttaaatqcttttgtaacttcatcactatctacccgqq -1560 gaagaacattattattcaaycctcctatgtgtctcggagtcaagagcttctaaaccaagaaaqgaayaaacgggcgqgttattqacyagttccctccctctcgcagttttaaaccactgc

-1320 AGCCCCAGGCACAGCGCCGCATCCAGACGCCGTCCGCGCGCGCAGCCTGGGAGGCGCTCCTCGCTCGCCTCCTGTACCCATCCAGCGACCAGCCAGGCTGCGGCGAGGGGATTCCMCCG -1440 aaaataaacccattTGTTMGGCTCTGGGACCMCGCTGGGCGMCCAGCTCCGCTCCGGAGGGGTCTGCGCGGCTGGCCTCGCCCGCCCCCTAGCGGACCCGTGCGATAGTGCAGCCTC

-1080 GGAGTCMCTTTAGGTTCGCCTGCGGACTCGGTGCAGgtayctgggtyctaagcaygggtggacgggatggctaygyccqgtggagccatcqggacccgagtqgaggtggtygggtycct -1200 AGGCTCCAGTGAGAGACCTCAGCTTAGCATCACATTAGGTGCAGCCGGCAGGCCATCCCMCTCGGGCCGGGAGCGCACGCGTCACTGGGGCCGTCAGTCGCCGTGCMCTTCCCCGGGG

. *

-960 cgcactccttgttcctygaggagctcgqggtgttccgayagattgtaaagtgacttctcgggattgagactcayagtccttgattatctgygtccaaagcgcaagtcaggggttccayaa -840 ctttcgaggctgccgggctygyyaggagccccgcgygaggtgtctatgccagggtctggyaacaycgcttgqycatcttqggctttqagycaggggttcccccagcaygyactycagaac -720 cgggtttccaccgaagcaygtgcctccatgtggaagttcagggagtgacggccg~ccgtcttayaaaayygggttayacgggqaaygaccagayctggggtttcccaggcaagtg~tatttqgg -600 gatttccyqaygaagtacttgaattaatgtttactaygagaggggctggtttggyggtcccgcgqcaggtgqatatyctgagggtcggaycctygygcgagtaygtagtttygagattcc

-360 TGGGCTTGTGGCCGGTAGAGGATTCCCGCTCATTTGCAGTGGCTCAGAGGAGgtacctccaacgygyatttctyyggtygcggctqagcaacccgagyccggcggttgtgccctgttgtt -480 ctcgyggaggtyatttygttttayattcccactcccggaygaacgttgctgattttgaccctcccttctcccccagTGGMGCCGCTGMCATCCCGAGGMCTGGCACGCTGGGGGCTC

-240 tcaqatga~tgygttcctyqyaatgygacaagcacyccctacccgcgtcygaagagaaacgcgqcggtctcctcacggccctcccggtttgtttcagGGTGGACTCAGCAGATCCGTCC -120 GTGGAGTCTCCAGGAGTGGAGCCCCGGGCGCCCCTACACCCTCCGACACGCCGGATCCGGCCCAGCCGCGCCMGCCGTAMGGGCTCGMGGCCGGGGCGCACCGCTGCCGCCAGGGTC

+1

+121

+241

+36l

+481

+601

+721

+841

+961

+lo81

ATGGAGGGCGCGCTCGCAGCCMCTGGAGCGCCGAGGCAGCCMCGCCAGCGCCGCGCCGCCGGGGGCCGAGGGCMCCGCACCGCCGGACCCCCGCGGCGCMCGAGGCCCTGGCGCGC MetGluGlyAlaLeuAlaAlaAsnTrpSerAlaGluAlaAlaA6~laSerAl~laProProGlyAlaGluGlyAsnAryThrAlaGlyProProArqArgAsnGluA~aLeuA~aArg

GTGGAGGTGGCGGTGCTGTGTCTCATCCTGCTCCTGGCGCTGAGCGGGMTGCGTGTGTGCTGCTGGCGCTGCGCACCACACGCCAGMGCACTCGCGCCTCTTCTTCTTCATGMGCAC valGluValAlaValLeuCysLeuIleLeuLeuLcuZllaLeuSerGlyA~nAlaCysVa1LeuLeuAlaLeuArgThrThrArgO1nLysHisSerArgLeuPhePhePheMetLysHis

CTMGCATCGCCGACCTGGTGGTGGCAGTGTTTCAGGTGCTGCCGCAGTTGCTGTGGGACATCACCTTCCGCTTCTACGGGCCCGACCTGCTGTGCCGCCTGGTCMGTACTTGCAGGTG """"""-1"""""""""""""""""""""""""""- """""""""

LeuSerIlcAlaA6pLeuVa1ValAlaValPheGlnVa1LeuProGlnLeuLeuTr~6pIleThrPheAryPhcTyrGlyProAspLeuLeuCy~ArgLeuValLysTyrLeuGlnVa~

GTGGGCATGTTCGCCTCCACCTACCTGCTGCTGCTCATGTCCCTGGACCGCTGCCTGGCCATCTGCCAGCCGCTGCGCTCGCTGCGCCGCCGCACCGACCGCCTGGCAGTGCTCGCCACG """""""-11""""""""""""""""" "_ ValGlyMetPh~laSerThrTyrIwuLeuLauLeuHatSerLeuAa~gCysLeuZllaIleCysGlnProLeuArgSerLeuArgArgArgThrAspArgLeuAlaValLeuAlaThr """""""""-111""""""""""""""""""""- TGGCTCGGCTGCCTGGTGGCCAGCGCGCCGCAGGTGCACATCTTCTCTCTGCGCGAGGTGGCTGACGGCGTCTTCGACTGCTGGGCCGTCTTCATCCAGCCCTGGGGACCCMGGCCTAC TrpLeuGlyCysLeuValAlaSerAlaProGlnValHisIlePheSerLeuArgG~uValAlaAspDlyVa1Ph~6~ysTrpAlaValPheIleGlnProTrpDlyProLysA~aTy """"-1v""""""""""""""""" ATCACATGGATCACGCTAGCTGTCTACATCGTGCCGGTCATCGTGCTCGCTGCCTGCTACGGCCTTATCAGCTTCMGATCTGGCAGMCTTGCGGCTCMGACCGCTGCAGCGGCGGCG IleThrTrpIleThrLeuAlaValTyrIleValProValIleValLeuAlaAlaCysTyGlyLeuIleSerPheLysIleTrpOlnAsnLeulVyLeuLysThrAlaAlaA~aA~aAla

GCCGAGGCGCCAGAGGGCGCGGCGGCTGGCGATGGGGGGCGCGTGGCCCTGGCGCGTGTCAGCAGCGTCMGCTCATCTCCMGGCCMGATCCGCACGGTCMGATGACTTTCATCATC

"""

"""""""-

""""""""""""v"""""""""""""""""""""""-

AlaGluAlaProGluGlyAlaAlaAlaGlyA6~lyOlyAr~a~~aLeuAl~~alSerSerValLy6LeuIleSerLy6AlaLy6Il~qThrValLysMetThrPheIleIle

GTGCTGGCCTTCATCGTGTGCTGGACCCCTTTCTTCTTCGTGCAGATGTGGAGCGTCTGGGATGCCMCGCGCCCMGGMGgtayccaggyctgqgaqacccaqqaqgagqgagcctyg ValLeuAlaPheIleValCysTrpThrProPhePhePheValGlnMetTrpSerVa1TrpAsplllaA~~laProLysGluA """"""-VI"""""""""""""- tqgctgqyygaaycccttatcttgctycctcagaatgtccagyygtctgtyqacttcctgqqggataagcqggtttgaaatcccacagagtcactgctctgtcatcccttqaccaagtqa cttagggaaattaacctccctgagcctccactccactttctcttctgtaagtgc ............................. intron 3) ................................. ...... aagtcagataygtctgyaagtqgctccagtgttaattaatycccttttctcctttctcctgcccccaccccctcagCCTCGGCCTTCATCATCGTCATGCTCCTGGCCAGCCTC

leSerAlaPheIleIleValMetLeULeuAlaserLeu

"""""""-

""""""""""""""""- MCAGCTGCTGCMCCCCTGGATCTACATGCTGTTCACGGGCCACCTCTTCCACGMCTCGTGCAGCGCTTCCTGTGCTGCTCCGCCAGCTACCTGMGGGCAGACGCCTGGGAGAGACG AsnSerCysCysAsnProTrpIleTyrMetLeuPheThrGlyHi6~uPheHisDluIwuVa1GlnArgPheLeuCysCyeSerAlaSerTyrLcuLysGlyArgArgLeuGlyOluThr

AGTGCCAGC~GAGCMCTCGTCCTCCTTTGTCCTGAGCCATCGCAGCTCCAGCCAGAGGAGCTGCTCCCAGCCATCCACGGCGTGACCCACCAGCCAGGGCCAGGGCTGCAGCCTG """"-yII""""""""""""

SerAlaSerLysLysSerAsnSerSerSerPheVa~LeuSerHisArgSerSerSerGlnArgSerCyeSerGlnProSerThrAla**~

+1201 AGGCTCAGGCTGTGCTGGCATMGTGCTCTGCTCCTAGGTGATGGCGTATGTTTGTGTATMGGTACCTATCAGTTTGTATCCCTCCCCTCCTTGGGGTGGCTTCAGTGGGGTGGAGAGT +1321 GGCCTCCATGATGGMGATGATAGGGGACTCAGCCATCAGACMCACCCTGGCCTCCTACACGTACTTCTACCACCCTGMCCCACTGCTGCCCTGGGCAGTGAGTGGCTTGTTTTTTCT +1441 CCTGGACTTGTMTTTCACTCCAGTATATTTTTACTTCTTCATTCTGGGATATTGTG~GCGGTAMTATAGGATTGGTGACCMTTGGGTCAGGMGTCCAGTGTTCTGGACTTGGG

+1681 GGTAGCCCTMGAGMGGGGATTACCTTGTMGACCATCTGGCGCAGTGGACCTATTAGMCTTGGGTT~TGTTTMGMGCTMTGTTTMGMGCATTTGGGAMG~GM +1561 GTMGCAGTGGGGTTGGGACCTCAGATGGGCMGGGTGGTGCTMGATCCTCCTGACCTCAMGTGTATTTGCCTTTMGCGMCAMTGCTGGGGTCCTTGGGGACCAGCTTGTCAGAG

+le01 ATAMTGTATCCAGATAGG-GMGMGT-CTATTTGCAGATGACACAGTTTTGTATATAG-TCCTMGGMCTCACACACACACACACACACACACACGCACACAGCTATT +1921 AGMCTMTMGCMGTTCCGCMGGTTTCMGATACMGATCMTATAC~TGMTTGTATTTCTTTATACTAGCMCAMCMTATG-CGMGTTAMTMTTCCATTTATA +2041 A T A C C A T C A G A M G M T ~ T A G G M T C M C T T M C ~ C M G T G C M G A C T G ~ C T A C ~ T T G G A M G A M T T A M G M G G C T T A M T A M T G G A M G A C A T C C T G T G T T C A T +2161 GGATCAGACTTAGTATTGTTMGATGGCMTACTATCCTMCTGACATGCAGATTCAGTGCMTCCTTATG~TCATAGCTGGCTTTTTTACAGAMTTGATMGCTAGTCCC~T

+2401 GGTTTMGGATAGACATACGGAGCA~GAGTACAGATATGMCACTTATACTTACGGTCMTTGATTTTTGACMGGTTCCCMGACMTTCMTAGAGAMGGAGAGTCTTTTC +2281 TCATAMGAMTGCMGGGACCCAGATATCCAMTMGCCTTG~GMCAMGTTGGTGGATTCACACTTCCTGATTTCATMTTTACGATAMGGTMTCAGCTCAGTGTGTTACT

+2521 MCAMTGGCACCGAGACMTGATATGCMGTGC-GMTGAGGTTGGACCTTTACTCACACTATGTGC~TCMCTC-CGCATCCMGATCTAMTATMGAGCTGAMCT +2641 AT~TCTTAGAMGAMCATAGGCATAGATCTTTGTMCCTTGMTTAGGCAGTGGTTTCTTAGATATGATACCAMGACACMGCMCCMTGG~TAGGTAMTTGGACTTM +2761 TCMGATTTGMGCTTTTGTGATTG~GACCCTATCMGMGGTG~GATMCCTGCAGMTGGGAG~TATTTGCGAGTCATATATATGATMGGGGCTTGTATCTGGMTAT +2881 ATAMTMCTCTTATMCACMCMTMGGAG~TAMTCMTTT~TGGGCTMCGGTTTGMTAGACATTTCTCCAMGMGATATGCAMTGGCTACTMGCACATGAM +3001 AMTACTCMCATTATTATTCATTAGGGAMTGCMGTC-TCACMTGAGATTCCAGTTTACMTCACTAGGATGGCTACMT~GATGGACMGMCGAGTGTCGGTGAGGAT +3121 GTAGAGAMCTGGTAGAMTTT~TTGTTGGTGGGMTGTAMTGGTGCACCTGCTTTG~CAGTTTGGCAGTACCTC~AMCGTAGAGTGACCATATGACCCAGGMT +3241 GCCACTCCTAGGTATTTACCCMGAGAMTGAMCGTACATACACAC-CTTGTACACCMTGTTCATAGCMCATTATTTGTMTAGCC~GTGGAMCMCCCAMTGTCTAC +3361 CMCTGATGMTGGGAMT~TGTGGTCTGTCCACGCMTGGMCATTATTAGACTCT~G~TGMGTACTCACACATGCCACMCATGGATGAGCCTTG~CTTGCTMG +3481 TGAMGMGCCAGGTGC~GCCCACATATTGTCTGACTGCATTGAMTGCMTGTCT~TGGACGMTCTATATAGAGTGMTATAGATTAGCGTTTGCCAGGGCCTGGAGGCTGT +3601 GAGAGATGAGGCATGACTACTMGGGTTTGGGGTTTCTTTTTCGGGTGATG~TGTTCTGAMTTACTGGTGATTGTGCACGATTTTGAGMTGTACT~CCMTGMCTTTAM +3721 -CA"ATTCMCAGATGMTTCGATATCMGCTT

FIG. 2. The nucleotide sequences of OTR gene S'-flanking region, four exons, intron 1, intron 2, and exodintron boundaries of intron 3. The exon sequences are shown in uppercase letters. The intron and the flanking sequences are in lowercase. Nucleotides of downstream and upstream of the methionine initiation codon are numbered sequentially from the first nucleotide of the ATG codon. The transcription starting sites are indicated by asterisks (*). The polyadenylation signals are underlined. The deduced amino acid sequence is indicated below the nucleotide sequence. The positions of putative membrane spanning domains (I-VZZ) are indicated below the amino acid sequence.

same location after the sixth transmembrane domain. Human time-specific manner as observed in thromboxane 4 receptor V2R (21) and OTR have the highest homology in their amino (18). acid sequence (41%) among the seven-transmembrane recep- Genomic Southern Blotting and Chromosome Mapping- tors. The OTR gene has two introns before translation start Human placental genomic DNA was digested with four en- site, whereas the V2R gene has none. This might indicate the zymes (BgZII, EcoRI, PstI, and XbaI) and analyzed for OTR by more complicated gene regulation of OTR in an organ- and Southern blotting (Fig. 4). A BamHYPstI fragment of OTR

32454 Structure of Human OTR Gene

tfom of exoditron splice sites in G- FIG. 3. A comparison of the loca-

pmtein-coupled receptons. The loca- tions of exodintron splice sites were compared among the cDNAs for O m , V2R, thromboxane A, receptor ( Ix4&), endothelin A receptor (ETAR), and am- adrenergic receptor (ad). The splice sites are indicated by vertical lines and are numbered. The cDNAfor the receptors are described schematically in the upper portion, and transmembrane domains- (I-WZ) are represented by closed boxes.

kb

23.1 - 9.4 - 6.5 - 4.4 -

2.3 - 2.0 -

' 0.5-

Fro. 4. Southern blots of the OTR gene. Ten micrograms of human genomic DNA from the placenta, digested with BgZII, EcoRI, PstI, and B u I , were hybridized with a BumMlPstI fragment (-67 to +711) of

left. OTR cDNA corresponding to exon 3. The size ( in kb) is indicated on the

cDNA(-67 to +711), corresponding to exon 3, was hybridized to the membrane, and it produced a single band for each digested DNA sample. This evidence suggested that there is only a single gene for OTR. To determine the refined genetic map of the OTR gene, we localized it on the chromosome by means of fluorecence in situ hybridization. A total of 50 mataphase cells were examined. Of these, 8 exhibited twin-spot signals on both homologous chromosomes 3p26.2 (Fig. 5), and the other 19 cells had twin-spot signals on one of chromosomes 3p26.2 and a single spot on the other 3~26.2. Such specific accumulation of the signals was undetectable on any other chromosomes. These resulta indicated that OTR locates on chromosome 3~26.2. To our knowledge, this area is not associated with known genetic disorders.

The Determination of the lYanscriptiona1 Start Site and Analysis of the 5'-Flanking Region of the OTR Gene-To deter- mine the transcription initiation site, we performed primer extension using the different primers PE-1(-521 to -540; Fig. '6, panel A) and PE-2 (-505 to -544; Fig. 6, panel B) . After hy- bridization with human myometrial poly(A)+ RNA, the primer was extended with Moloney murine leukemia virus reverse transcriptase and the size of the product was compared with a

P

i .i

FIG. 6. Chromosomal assignment of the OTR gene on the hu- man chromosome. A, partial metaphase chromosome stained with propidium iodide, showing the twin-spot signals on the short arm of chromosome 3 (arrows). E , the Gbanding pattern of the same chromo- some was delineated through a UV-2Aflter (Nikon), indicating that the OTR gene locates on the region of chromosome 3~26.2.

sequence ladder primed with the same primer (lanes 1 and 3). In lane 2, PE-1 primer was extended before the hybridization reaction and no signal was emitted. This indicated that the signals shown in lanes 1 and 3 are from specific hybridization- primed products. Each product gave two major signals 618 and 621 bp upstream of the translational initiation site (Fig. 6).

We sequenced 1.8 kb upstream of the translational start site and found a variety of nucleotide consensus sequences that are involved in transcriptional regulation in many genes (Fig. 7). Near the two transcriptional start sites, a TATA-like motif (22) (Tl'"N?AAA) was found 28 and 31 bp upstream. A potential Sp-1 binding site (23) is also present 35 bp upstream of the TATA-like motif. This alignment of the sequences would fulfill the requirements for the strong promotor activity needed to induce this gene. The 5'-flanking region also con- tains four invert GATA-1 motifs (24), one c-Myb binding site (251, one AP-2 site (26) and two AP-1 sites (27). We could not find the estrogen-responsive element (ERE) consensus se- quence (28) in this 5'-flanking region. Instead, there were two 5' half-palindromic 5'-GGTCA-3' motifs (-1778 to -1774, -1569 to -1565) and one 3' half-palindromic 5'-TGACC-3' mo- tif (-1631 to -1627) of ERE. Widely spaced half-palindromic ERE motifs can act synergistically in ovalbumin gene (29). OTR in uterus and in brain are induced by estrogen, which is antagonized or enhanced by progesterone (10, 30, 31). The

Structure of Human OTR Gene 32455

5' -630 A

7 C T C A

T y C

T

G T

A

-621 T

-618 T

-610 T 3'

A 1 2 B 3 "

0 '

W 0 -

FIG. 6. Primer extensions using oligonucleotides, PE-l(-521 to -540, panel A ) and PE-2 (-505 to -544,panel R ) . The end-labeled primers were hybridized with 300 ng of polylAY RNA from human myometrium a t term (lunes I and 3 ) and extended with Moloney mu-

end-labeled PE-1 primer was extended before hybridization ( lane 2) . rine leukemia virus reverse transcriptase. As a negative control, the

The primer extended producLq were separated on a 7 11 urea, 89 poly- acrylamide gel. Both primers gave signals at 618 and 621 bp upstream of the first nucleotide of the methioninr initiation codon ( lanes I and 3 ) indicated by arrows. Marker 1nnr.s A. G , C. and T (from lrf? to right)

OTR gene. indicate the sequence ladders of exon 1 and the 5'-flanking region of the

role of estrogen in the induction of OTR should be re-evalu- ated at the molecular level. We also found two nucleofactor in- terleukin 6 (NF IL6) binding consensus sequences (32) at -808, -1398, and -1437bp. Near the NF IL-6 consensus se- quence a t -1398 bp, there are two binding site sequences for an acute phase reactant-responsive element (33). These se- quences typically lie in the genes for acute phase proteins such as a,-macroglobulin and T kininogen, which are induced by infection or inflammation (34,35). Recently, the clinical re- lationship between latent intrauterine infection and preterm labor has been studied (36). Since i t is reported that OTR is induced even a t preterm delivery (ll), our data should help in understanding the mechanism of preterm labor that is still a central issue in perinatal health care. Although the functional characterization of the gene is necessary for comprehensive understanding of OTR gene induction which leads to physio- logical changes such as parturition and sexual behavior, our investigation of the OTR gene structure has laid the founda- tions for this study at the molecular level.

-1848

-1788

-1728

-1668

-1608

-1548

-1488

-1428

-1368

-1308

-1248

-1188

-1128

-1068

-1008

-948

-888

-828

-768

-708

-648

FIG. 7. Nucleotide sequence of the 5"flanking region of the OTR gene. The transcription start sites are indicated by rrstrrisks I. A TATA-like motif, potential SP-1 binding sites. SF IL-6 consensus sequences, acute phase reactant-responsive element motifs. AP-1 and AP-2 sites, Myb motif, inverted Sequences of GATA-1 motifs. and half- palindromic ERE motifs are enclosed by hoxrs.

Acknowledgments-We thank Dr. T. Maniatis for the gift of the human genomic library and Drs. H. Okayamn (Tokyo University), H. Nojima (Osaka University), and F. Matsuda (Kyoto University) for helpful discussion.

REFERENCES 1. Cuyton, A. C. (1991) Tkxfhook ofMrdical Physiology. 8th Ed.. pp. 91.5-928, W.

2. Holtorf. A. I?. Furuyn. ti., Ivell. R.. and Mdrdle, C. A. (19891 EndncrinoloR.v

3. Aqriolna. A,. and Gessn, C. L. (1991) Neurasci. Riokhau. Reu. IS. 217-231 4. Kim1rrn.T.. Tnnitnwn. 0.. Mori. K.. Rmwnatein. M. d.. nnd Oknynmn. H. (19921

5. Soloff, Y. S.. and Swr tz . T. L. (1974)J. Riol. Chem. 249. 1376-1381 6. Tnkrmurn, M., Kimurn. T., Nomurn. S.. Mnkino. Y.. Inoue. T.. Kikuchi. T..

SnJi, F., Kitnmurn. Y.. and Tnniznwn, 0. (19941 J. Clrn. Invrsl. 93. 2919- Kuhntn.Y.. Tnkugnwn. Y.. Nohunn-. T.. Knmiurn. S.. Onoue. H..Azumn, C.,

2323 7. Yoahrmurn. R.. Kiynma. H.. Kimura. T.. Arnki. T.. Mneno. H.. Tanitswe. 0..

8. Dnwnnd. 31. Y.. Yridorknls. K.. T w v d i , D.. and Fuchs. F. (19791 .I. Clin. nnd Tohysmn, M , I1W.7) Endncrinology 133.1239-124fi

Endncnnol. Mrtoh. 49, 429434 9. Lenkr. R. D.. Writzman. R. E.. Glnntz. T. H.. nnd Fisher. D. H. (1981) J. Clin.

10. Soloff. hl. S. .Alc~xnndm\~~. hl.. and Fematmm. M. J. (19791 Sriencf 204,1313- Endncrinol. Mrlah. FL?. 730-7:33

11. Fuchs. A. R.. Fuchs. E , Husslein. P.. and SnlolT, M. S. (19841 Am. J. Ohrlef. 1315

12. Kimurn. T.. Azumn. C.. Ssji. F.. 'Ikkemurn, M.. 'Ihkugnwn. Y.. Miki. M., Ono. (;ynecol. 160. 734-741

253-258 51.. Mori. K.. nnd Taniznwn. 0. 119921 J. Sfrrnid Rinchrm. Mol. Riol. 42.

13. Snmhmok. .J., Fritnch. E.. nnd Mnnintis. T. (1W2) Molecular CloninE': A Inhornlory Manrrol. 2nd Ed.. pp. 2.108-2.121, Cold Spring Hnrhnr Lnlnrn-

14. Innznwa. .I.. Snito. I{.. Ariynmn. T.,Ahe. T.. nnd Naknmurn. Y. (IWRIGnomics tory. Cold Spring Hnrhnr. h?'

17. 153-lfZ

R. Snundem, Philndclphin

125.2fi12-2620

'vnfrlrr 356. 5'26-529

32456 Structure of Human OTR Gene 15. Pinkel, D., Straume, T., and Gray, J. W. (1986) Proc. Natl. AcR~. Sei. U. S. A.

16. Breathnach, R., and Chambon, P. (1981) Annu. Reu. Biwhem. 60,349-383 17. Seibold,A., Brabet, P., Rosenthal, W., and Birnbaumer, M. (1992)Am. J. Hum.

18. Nusing, R. M., Hirata, M., Kakizuka, A,, Eki, T., Ozawa, K., and Narumiya, S.

19. Hosoda, K, Nakao, K, Tamura, N., Arai, H., Ogawa, Y., Suga, S., Nakanishi,

20. Ramarao, C. S., Denker, J. M. K, Perez, D. M., Gaivin, R. J., Riek, R. P., and

21. Brinbaumer, M., Seibold, A,, Glibert, S., Ishido, M., Barberis, C., Antaramian,

22. Wefald, F. C., Devlin, B. H., and Williams, R. S. (1990) Nature 344, 260-262 23. Briggs, M. R., Kadonaga, J. T., Bell, S. P., and Tjian, R. (1986) Science 234,

24. Orkin, S. H. (1990) Cell 63,665472 25. Howe, K. M., Reakes, C. F. L., and Watson, . RJ. (1990) EMBO J. 9,161-169 26. Williams, T., and Tjian, R. (1991) Genes & Deu. 5,670482

83,2934-2938

Genet. 51, 1078-1083

(1993) J. Biol. Chem. 288, 25253-25259

S., and Imura, H. (1992) J. Biol. Chem. 267, 18797-18804

Graham, R. M. (1992) J. Biol. Chen. 267,2193621945

A,, Barbet, P., and Rosenthal, W. (1992) Nature 367,333435

47-52

27. Lee, W., Mitchell, P., and Tjian, R. (1987) Cell 49,741-752 28. Peale, F. V., Ludwig, L. B., Zain, S., Hilf, R., and Bambara, R. A. (1988) Prw.

29. Kato, S., Tora, L., Yamauchi, J., Masushige, S., Bellard, M., and Chambon, P.

30. Ruzycky, A. L., and Crankshaw, D. J. (1988) Can. J . Physiol. Pharmacal. 66,

31. Schumacher,M., Coirini, H., PfalT, DW., andMcEwen, B. S. (1990)Science260,

32. Poli, V., Mancini, F. P., and Cortese, R. (1990) Cell 63, 643-653 33. Akira, S., Nishio, Y., Inoue, M., Wang, X., Wei, S., Matsusaka, T., Yoshida, K.,

Sudo, T., Naruto, M., and Kishimoto, T. (1994) Cell 77, 63-71 34. Hattori, M., Abraham, L. J., Northemann, W., and Fey, G. H. (1990) Proc. Natl.

Acad. Sci. U. S. A. 87, 2364-2368 35. Mann, E. A,, Croyle, M. L., and Lingrel, J. B. (1991) J. Bid. Chem. 266,

16931-16934 36. Romero, R., Avila, C., and Sepulveda, W. (1993) in Preterm Birth (Fuchs, A. R.,

Fuchs, F., and Stubblefield, P. G., eds) 2nd Ed., pp. 97-136, McGraw-Hill, New York

Natl. h a d . Sci. U. S. A. 86, 1038-1042

(1992) Cell 88, 731-742

10-14

691493