Tadamitsu Kishimoto and Keiko Yamauchi-TakiharaL. Eizirik, Tomoaki Osugi, Masahiro Izumi, Yuichi Oshima, Yoshikazu Nakaoka, Hisao Hirota, Shinji Negoro, Keita Kunisada, Yasushi Fujio, Masanobu Funamoto, Martine I. Darville, Décio

Upregulation of Manganese Superoxide DismutaseCardiomyocytes from Hypoxia/Reoxygenation-Induced Oxidative Stress Through the

Activation of Signal Transducer and Activator of Transcription 3 Protects

Print ISSN: 0009-7322. Online ISSN: 1524-4539 Copyright © 2001 American Heart Association, Inc. All rights reserved.

is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231Circulation doi: 10.1161/hc3401.095947

2001;104:979-981Circulation. 

http://circ.ahajournals.org/content/104/9/979World Wide Web at:

The online version of this article, along with updated information and services, is located on the

  http://circ.ahajournals.org//subscriptions/

is online at: Circulation Information about subscribing to Subscriptions: 

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

  document. Permissions and Rights Question and Answer this process is available in the

click Request Permissions in the middle column of the Web page under Services. Further information aboutOffice. Once the online version of the published article for which permission is being requested is located,

can be obtained via RightsLink, a service of the Copyright Clearance Center, not the EditorialCirculationin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:

by guest on February 23, 2013http://circ.ahajournals.org/Downloaded from

Activation of Signal Transducer and Activator ofTranscription 3 Protects Cardiomyocytes from

Hypoxia/Reoxygenation-Induced Oxidative Stress Throughthe Upregulation of Manganese Superoxide Dismutase

Shinji Negoro, MD, PhD; Keita Kunisada, MD, PhD; Yasushi Fujio, MD, PhD; Masanobu Funamoto, MD, PhD;Martine I. Darville, MD, PhD; Décio L. Eizirik, MD, PhD; Tomoaki Osugi, MD;

Masahiro Izumi, MD; Yuichi Oshima, MD; Yoshikazu Nakaoka, MD; Hisao Hirota, MD, PhD;Tadamitsu Kishimoto, MD, PhD; Keiko Yamauchi-Takihara, MD, PhD

Background—Mice with cardiac-specific overexpression of signal transducer and activator of transcription 3 (STAT3) are resistant todoxorubicin-induced damage. The STAT3 signal may be involved in the detoxification of reactive oxygen species (ROS).

Methods and Results—The effects of leukemia inhibitory factor (LIF) or adenovirus-mediated transfection of constitutively activatedSTAT3 (caSTAT3) on the intracellular ROS formation induced by hypoxia/reoxygenation (H/R) were examined using rat neonatalcardiomyocytes. Either LIF treatment or caSTAT3 significantly suppressed the increase of H/R-induced ROS evaluated by29,79-dichlorofluorescin diacetate fluorescence. To assess whether ROS are really involved in H/R-induced cardiomyocyte injury, theamount of creatine phosphokinase in cultured medium was examined. Both LIF treatment and caSTAT3 significantly decreasedH/R-induced creatine phosphokinase release. These results indicate that the gp130/STAT3 signal protects H/R-induced cardiomyo-cyte injury by scavenging ROS generation. To investigate the mechanism of scavenging ROS, the effects of LIF on the inductionof antioxidant enzymes were examined. LIF treatment significantly increased the expression of manganese superoxide dismutase(MnSOD) mRNA, whereas the expression of the catalase and glutathione peroxidase genes were unaffected. This induction ofMnSOD mRNA expression was completely blocked by adenovirus-mediated transfection of dominant-negative STAT3. Moreover,caSTAT3 augmented MnSOD mRNA and its enzyme activity. In addition, the antisense oligodeoxyribonucleotide to MnSODsignificantly inhibited both LIF and caSTAT3-mediated protective effects.

Conclusions—The activation of STAT3 induces a protective effect on H/R-induced cardiomyocyte damage, mainly byinducting MnSOD. The STAT3-mediated signal is proposed as a therapeutical target of ROS-induced cardiomyocyteinjury. (Circulation. 2001;104:979-981.)

Key Words: antioxidantsn hypoxia n signal transduction

I n the heart, it has been reported that reactive oxygen species(ROS) contribute to cardiac dysfunction and myocardial damage

under a variety of conditions, such as ischemia-reperfusion, conges-tive heart failure, and doxorubicin-induced cardiomyopathy.1–3 Re-cent studies have shown that gp130-mediated signals transducedboth cytoprotective and hypertrophic responses in the heart.4 Thesignal transducer and activator of transcription-3 (STAT3) is a keymolecule downstream of gp130, which is activated under variousstressful conditions, such as pressure-overload and myocardialinfarction.4 Transgenic mice with cardiac-specific overexpression ofthe STAT3 gene are protected against doxorubicin-induced cardio-myopathy.5 Therefore, the activation of STAT3 might induce aprotective effect against oxidative stress–induced cardiomyocytedamage by scavenging ROS.

In the present study, we explored whether the gp130/STAT3 signal has a protective function against hypoxia/reox-ygenation (H/R)–induced cardiomyocyte damage.

Methods

Cell Culture and H/R ExperimentsPrimary cultures of neonatal rat cardiomyocytes were prepared fromthe ventricles of 1-day-old Sprague-Dawley rats (Kiwa DobutsuWakayama, Japan), as previously described.6 Hypoxia was createdby incubating cells in an airtight Plexiglas chamber with,1% O2

and 5% CO2/95% N2 at 37°C for 2 hours using Gas Pak Plus (BBL).By replacing the medium saturated with 95% air and 5% CO2, thecells were exposed to normoxic atmosphere (reoxygenation). Anti-sense oligodeoxyribonucleotides (ODN) corresponding to the initi-ation sites of manganese superoxide dismutase (MnSOD) translation

Received April 30, 2001; revision received July 9, 2001; accepted July 10, 2001.From the Department of Molecular Medicine, Osaka University Graduate School of Medicine, Osaka, Japan (S.N., K.K., Y.F., M.F., T.O., M.I., Y.O.,

Y.N., H.H., T.K., K.Y.-T.), and the Gene Expression Unit, Diabetes Research Center, Vrije Universiteit, Brussels, Belgium (M.I.D., D.L.E.).Correspondence to Keita Kunisada, MD, PhD, Department of Molecular Medicine, Osaka University Graduate School of Medicine, 2-2 Yamadaoka,

Suita, Osaka 565-0871, Japan. E-mail: kunisada@imed3.med.osaka-u.ac.jp© 2001 American Heart Association, Inc.

Circulation is available at http://www.circulationaha.org

979 by guest on February 23, 2013http://circ.ahajournals.org/Downloaded from

(22 mer: CACGCCGCCCGACACAACATTG; 1.0mmol/L) orsense ODN at the same site (22 mer: CAATGTTGTGTCGGGCG-GCGTG; 1.0mmol/L) were added to the cultured medium 18 hoursbefore hypoxia until 24 hours after reoxygenation.7

Generation of Recombinant Adenovirus andProtocol of Adenovirus InfectionThe recombinant replication-defective adenovirus expressing adominant-negative form of STAT3 and constitutively activatedSTAT3 (caSTAT3), which were kindly provided by Drs J.F. Brom-berg and J.E. Darnell, Jr (Laboratory of Molecular Cell Biology, TheRockefeller University, New York, NY),8 were prepared as de-scribed previously.6,9,10 Adenovirus vector expressingb-galactosidase (b-gal) was used as a control.

Analysis of Intracellular ROS GenerationThe fluorescent probe, 29,79-dichlorofluorescin diacetate (DCF-DA),was used to assess intracellular ROS formation in cultured ratcardiomyocytes, as previously described.11

Northern Blot Analysis and Western Blot AnalysisNorthern and Western blotting were performed as previously de-scribed.6 Specific cDNA probes for the detection of MnSOD, catalase,and glutathione peroxidase gene transcripts were reported previously.12

Measurement of MnSOD ActivityMnSOD activity was determined by the nitroblue tetrazoliummethod.7

Measurement of Creatine PhosphokinaseCreatine phosphokinase (CPK) activity in the culture medium wasmeasured by the MERCK-1-TEST CK kit (Kantou Kagaku Co).13

Statistical AnalysisStatistical analysis was performed by Student’st test and 1-wayANOVA followed by Bonferroni collection for multiple groupcomparisons.P,0.05 was considered significant.

Results

Activation of Gp130/STAT3 Protects Cardiomyocytesfrom H/R Injury by Scavenging ROSTo examine the effects of leukemia inhibitory factor (LIF) orcaSTAT3 on the intracellular ROS formation induced by H/R,DCF-DA was used as a fluorescent probe. Both LIF treatmentand caSTAT3 significantly suppressed the generation of ROSinduced by H/R (Figure 1A). Furthermore, they both signifi-cantly decreased H/R-induced CPK release (Figure 1B). These

results indicate that the gp130/STAT3 signal protects H/R-induced cardiomyocytes injury by scavenging ROS generation.

The Protective Effects of STAT3 Are Involved inthe Upregulation of MnSODTo explore the mechanism of protection against ROS, theeffects of LIF on the induction of 3 important myocardialantioxidant enzymes (ie, MnSOD, catalase, and glutathioneperoxidase) were examined. LIF treatment resulted in asignificant increase of MnSOD mRNA level from 1 hour thatcontinued for up to 24 hours, whereas the expressions ofcatalase and glutathione peroxidase mRNAs were unchangedthroughout the time points examined (Figure 2A). Figure 2Bshows the dose-dependent effect of LIF on the induction ofMnSOD mRNA expression. These effects of LIF wereinhibited by dominant-negative form of STAT3 (Figure 2C).Furthermore, significant enhancement of MnSOD mRNAexpression was detected with caSTAT3, and this was accom-panied by an increase in its enzyme activity. Thus, STAT3 isconsidered essential for LIF-induced MnSOD expression.

To evaluate whether the increase in MnSOD activity isindeed directly related to the protective effect of STAT3,antisense ODN against the MnSOD gene were used. Anti-sense ODN completely cancelled both LIF and caSTAT3-induced MnSOD activities, and sense ODN did not affect ourexperiments (data not shown). As shown in Figure 2D, thesebeneficial effects of LIF and caSTAT3 on CPK release weresignificantly decreased in the presence of antisense ODN.Thus, the protective effects of STAT3 against H/R are mainlyrelated to the induction of MnSOD activity.

DiscussionThe major new finding in the present study is that STAT3 activationprotects cardiomyocytes against ROS caused by H/R through theupregulation of the MnSOD gene and its enzyme activity.

Endotoxin and cytokines such as tumor necrosis factor-a,interleukin-1b, and interluekin-6 are known to induce MnSOD, andseveral studies have confirmed the cardioprotective role of Mn-SOD.14–16 In view of the transcriptional regulation, 3 interferon-gactivation site motifs (TTCCTCTAA, TTCCTCAA, and TTA-CATCAA) that are bound with activated STAT3 were identified inthe region spanning from –2505 to –1104 in the MnSOD promoterregion.17,18This suggests that LIF induce MnSOD mRNA expres-sion mainly via the STAT3 binding cis-element in cardiac myo-

Figure 1. Activation of gp130/STAT3 protects cardio-myocytes from H/R injury by scavenging ROS. A, LIF-treated (preincubated with 103 units/mL LIF for 6 hours)or caSTAT3-transfected cardiomyocytes were sub-jected to H/R (2 hours of ischemia and 24 hours ofreoxygenation), and incubated with DCF-DA (5 mmol/L)for 30 minutes. Two fields were randomly selected ineach well and were examined for each condition. Rep-resentative cardiomyocytes observed by laser confocalmicroscopy are shown. Con indicates control. B, Cardi-omyocytes were treated with LIF (preincubated with 103

units/mL of LIF for 6 hours) or transfected with b-gal orcaSTAT3. CPK activity in the culture medium was mea-sured after H/R. Data are mean6SEM from 3 experi-ments. *P,0.05 vs b-gal without H/R; #P,0.05 vsb-gal with H/R.

980 Circulation August 28, 2001

by guest on February 23, 2013http://circ.ahajournals.org/Downloaded from

cytes. It remains to be identified which motifs of the 3 discussedabove are the most important for the induction of the MnSOD gene.

To clarify the role of MnSOD in H/R, we used an antisensestrategy to suppress MnSOD induction.7 The responses to thepretreatment with antisense ODN in caSTAT3- or LIF-treated cellswere different. The protective effects observed in caSTAT3 trans-duction were nearly completely abolished with antisense ODN,whereas the protective effects by LIF were not completely abolishedwith antisense ODN. These results suggest that induction of Mn-SOD by caSTAT3 is essential for caSTAT3-induced protection inH/R. The genes related to cardiac protection, such as the atrialnatriuretic factor and vascular endothelial growth factor genes,increased in the hearts with cardiac-specific overexpression ofSTAT3; however, these genes have little effect on this condition.5

However, LIF stimulation induces other anti-apoptotic molecules,such as Bcl-xL and Bcl-2, and also activates phosphatidylinositol 3kinase-Akt and mitogen-activated protein kinase pathways, whichwould be involved in a protective effect against ROS.4,19,20There-fore, LIF presents more protective effects than STAT3 by inducingother protective factors besides MnSOD.

We propose that the activation of STAT3 could be a thera-peutic strategy for cardiac protection against ROS-mediatedcytotoxicity in several pathological conditions.

AcknowledgmentsThis study was supported by a Grant-in-Aid for Scientific Research fromthe Ministry of Education, Science, and Culture of Japan; grants from theMinistry of Health and Welfare of Japan; and the Takeda Science Founda-tion. We thank Jurei Hironaka for her secretarial assistance.

References1. Bolli R. Oxgen-derived free radicals and postischemic myocardial dys-

function “stunned myocardium”.J Am Coll Cardiol. 1988;12:239–249.2. Singh N, Dhalla AK, Seneviratne C, et al. Oxidative stress and heart failure.

Mol Cell Biochem. 1995;147:77–81.3. Myers CE, McGuire WP, Liss RH, et al. Adriamycin: the role of lipid

peroxidation in cardiac toxicity and tumor response.Science. 1984;226:466–468.

4. Yamauchi-Takihara K, Kishimoto T. Cytokines and their receptors in car-diovascular diseases-role of gp130 signaling pathway in cardiac myocytegrowth and maintenance.Int J Exp Pathol. 2000;81:1–16.

5. Kunisada K, Negoro S, Tone E, et al. Signal transducer and activator oftranscription 3 in the heart transduces not only a hypertrophic signal but aprotective signal against doxorubicin-induced cardiomyopathy.Proc NatlAcad Sci U S A.2000;97:315–319.

6. Kunisada K, Tone E, Fujio Y, et al. Activation of gp130 transduces hypertrophicsignals via STAT3 in cardiac myocytes.Circulation. 1998;98:346–352.

7. Yamashita N, Nishida M, Hoshida S, et al. Induction of manganesesuperoxide dismutase in rat cardiac myocytes increases tolerance to hypoxia24 hours after preconditioning.J Clin Invest. 1994;94:2193–2199.

8. Bromberg JF, Wrzeszczynska MH, Devgan G, et al. STAT3 as an oncogene.Cell. 1999;98:295–230.

9. Fujio Y, Guo K, Mano T, et al. Cell cycle withdrawal promotes myogenicinduction of Akt, a positive modulator of myocyte survival.Mol Cell Biol.1999;19:5073–5082.

10. Becker TC, Noel RJ, Coats WS, et al. Use of recombinant adenovirus formetabolic engineering of mammalian cells.Methods Cell Biol. 1994;43:161–189.

11. Luo JD, Xie F, Zhang WW, et al. Simvastatin inhibits noradrenaline-inducedhypertrophy of cultured neonatal rat cardiomyocytes.Br J Phamacol. 2001;132:159–164.

12. Dieterich S, Bieligk U, Beulich K, et al. Gene expression of antioxidativeenzymes in the human heart: increased expression of catalase in the end-stagefailing heart.Circulation. 2000;101:33–39.

13. Gerhardt W. Creatine kinase. In: Bergmeyer HU, ed.Methods of EnzymaticAnalysis. 3rd ed. Weinheim: Verlag Chemie; 1983:508–539.

14. Shiki Y, Meyrick BO, Brigham KL, et al. Endotoxin increased superoxidedismutase in cultured bovine pulmonary endothelial cells.Am J Physiol.1987;252:C436–C440.

15. Tsan MF, White JE, Treanor C, et al. Molecular basis for tumor necrosisfactor-induced increase in pulmonary superoxide dismutase activities.Am JPhysiol. 1990;259:L506–L512.

16. Masuda A, Longo DL, Kobayashi Y, et al. Induction of mitochondrial manganesesuperoxide dismutase by interleukin 1.FASEB J. 1988;2:3087–3091.

17. Dougall WC, Nick HS. Manganese superoxide dismutase: a hepatic acutephase protein regulated by interleukin-6 and glucocorticoids.Endocrinology.1991;129:2376–2384.

18. Ihle JN. STATs: signal transducers and activators of transcription.Cell.1996;84:331–333.

19. Wang X, McCullough KD, Franke TF, et al. Epidermal growth factorreceptor-dependent Akt activation by oxidative stress enhances cell survival.J Biol Chem. 2000;275:14624–14631.

20. Aikawa R, Komuro I, Yamazaki T, et al. Oxidative stress activates extra-cellular signal-regulated kinase through Src and Ras in cultured cardiacmyocytes of neonatal rats.J Clin Invest. 1997;100:1813–1821.

Figure 2. LIF and caSTAT3 protect from cardio-myocyte injury after H/R through the induction ofMnSOD. A, Cardiomyocytes were treated with LIF(103 U/mL) and harvested at the indicated timepoints. MnSOD, catalase (Cat), and glutathioneperoxidase (GPX) mRNA expressions were exam-ined by Northern blot analysis. 18S indicates 18Sribosomal RNA. The results are representative of 3similar experiments. B, Cardiomyocytes were stim-ulated with various concentrations of LIF for 3hours. MnSOD mRNA expression was examinedby Northern blot analysis. The results are represen-tative of 3 similar experiments. C, Cardiomyocyteswere transfected with adenovirus vectors express-ing a dominant-negative form of STAT3 (dnSTAT3),caSTAT3, or b-gal and stimulated with LIF (103

U/mL) for 3 hours. MnSOD mRNA expression wasexamined by Northern blot analysis. After cardio-myocytes were stimulated with LIF (103 U/mL) for 6hours, MnSOD enzyme activity was determined asdescribed in Methods. Data are presented asmean6SEM from 3 samples. *P,0.05 vs b-galwithout LIF stimulation; #P,0.05 vs b-gal with LIFtreatment. D, Sense or antisense ODN (1.0 mmol/L)

were applied to LIF-treated (preincubated with 103 U/mL LIF for 6 hours) or b-gal– or caSTAT3-transfected cardiomyocytes for18 hoursbefore H/R. CPK activity in the culture medium was measured after H/R. Data are mean6SEM from 3 experiments. *P,0.05 vs LIFwith sense ODN; #P,0.05 vs caSTAT3 with sense ODN.

Negoro et al LIF induces MnSOD via STAT3 981

by guest on February 23, 2013http://circ.ahajournals.org/Downloaded from