wortmannin inhibits k562 lukemic cells by regulating pi3k/akt channel in vitro

J Huazhong Univ Sci Technol［Med Sci］ 29 (4): 2009

451

Wortmannin Inhibits K562 Lukemic Cells by Regulating PI3k/Akt Channel In Vitro*

Qing WU (吴青), Yan CHEN (陈燕), Guohui CUI (崔国惠), Yiquan CHENG (程亦荃)# Institute of Hematology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 China

Summary: The inhibitory effect of wortmannin on leukemic cells and the possible mechanisms were examined. K562 cells were treated with wortmannin of various concentrations (3.125–100 nmol/L) for 0–72 h. MTT assay was used to evaluate the inhibitory effect of wortmannin on the growth of K562 cells. Cell apoptosis was detected by both Annexin-Ⅴ FITC/PI double-labeled cytometry and transmission electron microscopy (TEM). The expression of p-Akt, T-p-Akt, NF-κBp65 and IKK-κB was determined by Western blotting and reverse transcription-polymerase chain reaction (RT-PCR). Our results showed that wortmannin obviously inhibited growth and induced apoptosis of K562 cells in vitro in a time- and dose-dependent manner. The IC50 value of wortmannin for 24 h was 25±0.14 nmol/L. Moreover, wortmannin induced K562 cells apoptosis in a dose-dependent manner. TEM re-vealed typical morphological changes of apoptosis in wortmannin-treated K562 cells, such as chro-matin condensation, karyopyknosis, karyorhexis and apoptotic bodies. Additionally, several important intracellular protein kinases such as p-Akt, NF-κBp65 and IKK-κB experienced degradation of vari-ous degrees in a dose-dependent manner both at protein level and transcription level when cultured with wortmannin, but the expression of total Akt showed no change. It is concluded that wortmannin can inhibit the proliferation and induce apoptosis of K562 leukemia cells possibly by down-regulating the survival signaling pathways (PI3K/Akt and NF-κB channels). Key words: wortmannin; K562 cell; p-AKT; NF-κB; IKK-κB

Leukemia is a kind of malignancy originating from haematopoietic system, and its pathogenesis and pro-gression have been proved to be closely related with many genetic alterations, in which cellular signaling transduction plays a crucial role in the development and progression of leukemia. In recent years, some studies have found that PI3K is abnormally expressed in many tumors with its main downstream gene being Akt. Akt allows tumor cells to escape from apoptosis by regulat-ing its downstream targets. PI3K/Akt pathway can in-hibit cell apoptosis[1–3] and promote cell cycle, prolif-eration as well as angiogenesis[4–6] in most cells. More-over, Akt exerts its apoptosis-inhibiting effect not only by direct modulation of pro-apoptotic molecule (Bad) and transcriptional factors (forkhead family) but also by indirect regulation of p53 and NF-κB[7], thereby making the cell growth out of control and subsequently result-ing in tumorigenesis. PI3K/Akt pathway plays a critical role in a wide array of solid tumors and leukemic dis-eases[8–10]. Therefore, PI3K/Akt pathway has a potential to be used as a novel target for cancer therapy. Wort-mannin is an inhibitor of PI3K/Akt pathway[11] and this study examined the effects of wortmannin on the pro-

Qing WU, E-mail: [email protected] #Corresponding author *This project was supported by a grant from the National Natural Sciences Foundation of China (No. 30671743).

liferation and apoptosis of K562 cells and explored the possible molecular mechanisms in vitro, with an at-tempt to provide experimental basis for its clinical ap-plication.

1 MATERIALS AND METHODS

1.1 Leukemic Cells Line and Reagents Human leukaemia K562 cells were obtained from

the China Center for Typical Culture Collection (Wuhan, China) and cultured in RPMI-1640 medium (Sigma, USA) containing 10% fetal bovine serum (Sijiqing Co. Ltd., Hangzhou, China) in 5% CO2 incubator at 37°C. Wortmannin was purchased from the Calbiochem (San Diego, CA, USA) with a purity of more than 98%. It was initially dissolved in dimethlyl sulfoxide (DMSO), stored at –20°C, and thawed before use. Anti-nucleophosmin antibody was procured from Zymed (San Francisco, CA, USA). Antibodies specific to T-p-Akt, p-Akt, NF-κB and IKK-κB glyceraldehyde-3 phosphate dehyrogenase and horseradish peroxidase-conjugated secondary antibodies were bought from Santa Cruz Biotech Ltd., CA, USA). 3-(4, 5-imethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) was from Janssen Chumica Co., USA). Annexin-Ⅴ-fluorescein isothiocyanate (FITC) detection kit was obtained from BD Biosciences, USA). Chemilu-minescence (ECL) reagent kits were purchased from Pierce Biotechnology, USA). Reverse transcrip-

29(4):451-456,2009J Huazhong Univ Sci Technol［Med Sci］ DOI 10.1007/s11596-009-0412-x


452

tion-polymerase china reaction (RT-PCR) kit was prod-uct of Fermentas, Lithuania). 1.2 Proliferation Assay

Logarithmically growing K562 cells were seeded in triplicate at a concentration of 5×105 cells/mL onto cul-ture medium, and then exposed to various concentrations (0, 6.25, 12.5, 25, 50 and 100 nmol/L) of wortmannin for 0, 24, 48 and 72 h in triplicate in 96-well plates. There-after, 20-μL MTT solution [5 mg/mL in phosphate buff-ered saline (PBS)] was added to each well and the cells were incubated for 4 h at 37°C. Then DMSO (150 μL/well) was added and the optical density (A value) at 570 nm was measured on 96-well multiscanner auto-reader (Biotech Instruments, USA). The following formula was used for the calculation of inhibited cell proliferation:

Cell proliferation inhibited (%)=[1–(A value of the experimental samples/A value of the control)]×100% (n=3, ±s). The IC50 was the concentration that caused 50% inhibition of cell proliferation. 1.3 Annexin-Ⅴ -FITC Staining for Evaluation of Apoptosis

By following the instructions of the An-nexin-Ⅴ-FITC detection kit, cells (1×106) exposed to various concentrations of wortmannin (0, 6.25, 12.5, 25 nmol/L) were re-suspended in 100 μL of binding buffer after 24-h culture. Afterwards, cells were stained with 5- μL Annexin-Ⅴ-FITC solution and 15-μL propidium io-dode solution for 15 min at room temperature in the dark. Then the samples were diluted with 300 μL of binding buffer and flow cytometrically examined (FACsirt BD Biosciences, USA). 1.4 TEM Observation of Apoptosis of K562 Cells

Cells at log phase were treated medium containing 0, 12.5 and 25 nmol/L wortmannin for 24 h. And then the medium was removed and cells were collected into a 1.5- mL EP and centrifuged at 1800 r/min. The supernatant was add to 4°C pre-cooled glutaraldehyde and fixed for 2 h, washed with PBS three times, and dehydrated with graded ethanol, epoxy resin-embedded, sectioned, stained and observed under a electron microscope. 1.5 RNA Isolation and RT-PCR

Total cellular RNA was extracted using Trizol re-agent (Invitrogen, USA). RT-PCR was performed with the appropriate primers (table 1), by following the pro-tocol of Fermentas kit. PCR reaction mixture (20 mL) was initially amplified at 94°C for 5 min, followed by 10 cycles at 94°C for 30 s, and 60°C for 1 min, then 30 cy-cles at 94°C for 30 s, 58°C for 40 s, and 72°C for 1 min, finally with a extension at 72°C for 7 min. The amplified PCR products were separated by electrophoresis on a 1.5% agrose gel, and quantitated by relative intensities of the bands as compared to those of β-actin using Smart View Bio-Electrophoresis Image Analysis software package (Shanghai Invitrogen Biotechnology Co., China). 1.6 Western Blotting for Protein Expression

After treatment, cells were harvested and lysed in 100 μL of lysis buffer (10 nmol/L Tris-HCl (pH 7.5), 1 mmol/L EDTA, 1% Triton X-100, 150 nmol/L NaCl, 1 mmol/L dithiothreitol, 10% glycerol, 0.2 nmol/L phenylmethylsulfonyl fluoride, and protease inhibitors) by incubation on ice for 30 min, and then the extracts

were centrifuged at 29,000 g for 15 min to remove cell debris after the addition of 5×loading buffer. Protein samples were electrophoresed on a 12.5% sodium dode-cyl sulfate-polyacrylamide gel and then transferred onto nitrocellulose membraned. The membranes were then immunoblotted with primary antibodies directed against-T-Akt, p-Akt, NF-κB, and IKK-κB. After over-night incubation at 4°C, the blots were exposed to the horseradish peroxidase-labeled secondary antibodies at a final dilution of 1:1500 and washed with Tween 20 solu-tion. Finally, the blotting of the bands was carried out by using the Quantity One densitometric analysis software (Bio-Rad, USA). 1.7 Statistical Analysis

Results were expressed as ±s. Student’s t-test and single-factor ANOVA were used to compare quan-titative data. A P<0.05 was considered to be statistically significant unless otherwise specified.

2 RESULTS 2.1 Inhibitory Effects of Wortmannin on the Prolif-eration of K562 Cells

The cytotoxicity of wortmannin on K562 cells was calculated from the loss of cell viability using MTT as-say. As shown in fig. 1, wortmannin inhibited the prolif-eration of K562 cells in a time- and dose-dependent manner. The IC50 value at 24 h, 48 h, and 72 h was 25±0.10 nmol/L, 12.5±0.08 nmol/L, and 6.25±0.11 nmol/L (P<0.01), respectively.

Fig. 1 Effects of wortmannin on inhibition of proliferation of

K562 cells treated with various concentrations of wort-mannin (0-100 nmol/L) for 24–72 h

2.2 Effects of Wortmannin on Apoptosis of K562 Cells

To address the role of wortmannin in conferring sensitivity to apoptosis, K562 cells were exposed to in-creasing concentrations of wortmannin, and then de-tected with Annexin-Ⅴ-FITC/PI double-labeled flow cytometry. As a consequence, 24-h exposure of K562 cells to growth-suppressing concentrations of wortman-nin (6.25–25 nmol/L) led to obvious apoptotic cell death (fig. 2A) and in a dose-dependent manner. The apoptotic cell death was quantified as the percentage of the an-nexin-Ⅴ-FITC-positive cells. There was little binding of annexin-Ⅴ-FITC in untreated K562 cells. However, apoptosis was evident early at the beginning of the treatment with 12.5 nmol/L wortmannin. Apoptotic bod-ies containing nuclear fragments were found in the


453

wortmannin-treated cells, in which the chromatin became condensed, marginalized, the nuclear envelope appeared

karyopyknotic and the cytoplasm were shrunken as compare with normal K562 (fig. 2B).

Table 1 Polymerase chain reaction primers

Primers Accession no DNA sequence Size (bp) NF-κB NM-002542 F: ATGCTTACTGGGTGCCAAAC

R: GGCAAGTCACTCAGCCTTTC 265

IKK-κB NM-002625 F:TGCCTCTGCGCTTAGATACC R:GACCTAGTCCC GTCAGAAAC

150

p-Akt NM-001634 F:ATGAATGAGGTGTCTGTCATCAAAGAAGGC R:TGCTTGAGGCTGTTGGCGACC

330

β-actin NM-001010 F:CCACCCATGGCAAATTCCATGGCA R:TCTAGACGGCAGGTCAGGTCCACC

163

F: forward; R: reverse,

Fig. 2A Effects of wortmannin on apoptosis of K562 cells

K562 cells were treated with 6.25–25 nmol/L wortmannin for 24 h Fig. 2B Transmission electron microscopy (TEM)

Morphological changes of wortmannin-induced apoptosis in K562 cells. Cells were treated with 12.5–25 nmol/L wortmannin for 24 h

2.3 Regulation on the Expression of T-Akt, p-Akt, NF-κB and IKK-κB by Wortmannin in K562 Cells

Our results reveal that the expressions of T-Akt, p-Akt, NF-κB and IKK-κB were significantly higher in K562 cells compared to wortmannin-treated cells. With the increase of wortmannin dosage (6.25–50 nmol/L), the content of p-Akt, NF-κB and IKK-κB gradually dropped from the peak to lowest point. On the other hand, p-Akt, NF-κB and IKK-κB proteins levels all declined in a dose-dependent manner compared to control cells in the presence of 6.25–50 nmol/L wortmannin for 24 h, and but the expression of total Akt did not showed any change.

Twenty-four hours after treatment with wortmannin, the mRNA levels of p-Akt, NF-κB and IKK-κB were reduced dramatically, whereas the effects were partially reversed (fig. 3A–3D). 3 DISCUSSION

Presently, it has been presumed that the underlying mechanisms for leukemogenesis involve multiple factors and genes. Among these factors, cellular signaling transduction plays an extremely vital role in the genesis and progression of leukemia. Influenced by a series of internal and external factors, PI3K/Akt signaling pathway


454

Fig. 3 Effects of wortmannin on the regulation of p-Akt, NF-κB and IKK-κB in K562 cells 1: NF-κB; 2: p-Akt; 3: IKK-κB; 4: Bar chart (RT-PCR was performed for 24 h.)

*P<0.05, control vs 12.5 mmol/L; **P<0.01, control vs 25–50 mmol/L).

Fig. 4 Western blotting evaluation of the expression of T-Akt, p-Akt, NF-κB and IKK-κB in untreated K562 cells or wortman-nin-treated K562 cells over a time period of 24 h

1: Western blot 2: Bar chart *P<0.05, control vs 12.5 mmol/L; **P<0.01, control vs 25–50 mmol/L

is activated to perform its fundamental cellular activities, including cell-cycle progression, proliferation and cell growth, apoptosis, differentiation, metabolism etc. In the process of tumor cell escaping killing by anti-tumor drugs, PI3K/Akt pathway plays a critical role[12–13]. Many researchers[14–16] reported that, compared with normal cells, Akt is persistently increased in the cells of de novo acute myeloid leukemia, and the AML cell survival rate was significantly decreased after treatment with PI3K inhibitors. Therefore, the suppression of tumor growth

can be achieved by inhibiting Akt expression, which sub-sequently upsets the balance between proliferation and apoptosis of cells[17]. Activated Akt can phosphorylate and activate IKK (IκB kinase) so as to indirectly activate NF-κB, which subsequently initiates the expression of a set of anti-apoptotic genes[18].

PI3K/Akt pathway can regulate the expression of its target genes at the both transcription and translation lev-els, thereby promoting proliferation and inhibiting apop-tosis. Our study showed that the cell proliferation could


455

be evidently inhibited by wortmannin in a dose-dependent manner and wortmannin could arrest cell cycle and induce cell apoptosis. Transmission electron microscopy (TEM) revealed the typical morphological changes of apoptosis of cells, including disappearance of microvilli on cell membrane, presence of bubbles on nuclear and cellular membranes, and formation of chro-mosome condensation and apoptotic bodies. And the changes become more obvious with the increase of con-centration. These morphological changes further demon-strate that wortmannin can induce apoptosis of K562 cells. Additionally, cytometry and TEM further demon-strated the cell proliferation inhibition, as shown by MTT, was related to the apoptosis of K562 cells induced by wortmannin. Moreover, a lower concentration of wort-mannin didn’t induce apoptosis. However, if the concen-tration was raised to a higher level, the effect of wort-mannin on cell apoptosis was more evident. This is con-sistent with a previous report[19].Usually, the activated Akt, namely phosphorylated Akt, has a relatively higher expression in K562 cells. Nevertheless, our experiment showed that the p-Akt expression of K562 cells was sub-stantially reduced by wortmannin treatment and the re-duction was dose-dependent. Additionally, the mRNA of p-Akt is down-regulated simultaneously along with translation of p-Akt after wortmannin treatment on K562 cells. The foregoing findings indicate that the expression of p-Akt was abnormal in K562 cells and could be af-fected by wortmannin in a dose-dependent manner. In recent years, it is found that aberrant deregulation of NF-κB is a key event involved in oncogene expression. The actiated NF-κB can suppress apoptosis and promote metastasis of tumor cells, thus promoting chemoresis-tance and tumorigenesis[20–21]. Moreover, NF-κB is also one of the critical downstream targets of Akt. Akt phos-phorylates and activates IκB kinase (IKK), which subse-quently decompose IκB proteins. IκB proteins are spe-cific inhibitory factors of NF-κB and its decomposition makes NF-κB be dissociated from NF-κB complex and enter the nucleus, where they regulate the transcription of a variety of genes. NF-κB is a crucial molecule of the cellular signaling pathways. Suppression of NF-κB ex-pression in tumor cells may provide a novel target for prevention and chemotherapy of cancer[22–23]. Our study shows that wortmannin could decrease the expression of the mRNA and translation of NF-κB as well as IKK-β, while exerts no effect on the expression of total Akt, suggesting that wortmannin could reduce the phosphory-lation of Akt, IκB as well as NF-κB, thereby inhibiting the activity of Akt/NF-κB signaling pathway. Our study suggests that Akt/NF-κB signaling pathway is probably implicated in the mechanism by which wortmannin in-duces the apoptosis of K562 cells and bears a relation with the malignant behaviors of leukemia, which was consistent with recent reports[24–25]. The reports showed that wortmannin could dephosphorylate and inactivate Akt by down-regulating the expression of multiple molecules of this pathway, such as PI3K and mTOR.

To sum up, the proliferation-inhibiting effect of wortmannin on K562 cells is closely related with the cellular signaling PI3K/Akt/NF-κB pathway. However, as a fungal metabolite, wortmannin is soluble only in the organic solvent, which limits its application in clinical

trails. Currently research on the water-soluble wortman-nin is under way. In the future, the treatment with wort-mannin with radiotherapy and/or chemotherapy will fur-ther enhance efficacy of the anti-tumor treatment.

REFERENCES 1 Olsen BB, Bjørling-Poulsen M, Guerra B. Emodin nega-

tively affects the phosphoinositide 3-kinase/AKT signal-ling pathway: a study on its mechanism of action. Int J Biochem Cell Biol, 2007,39(1):227-237

2 Rudelius M, Pittaluga S, Nishizuka S, et al. Constitutive activation of Akt contributes to the pathogenesis and sur-vival of mantle cell lymphoma. Blood, 2006,108(5): 1668-1676

3 Fillmore GC, Wang Q, Carey MJ, et al. Expression of Akt (protein kinase B) and its isoforms in malignant lympho-mas. Leuk Lymphoma, 2005,46(12):1765-1773

4 Priulla M, Calastretti A, Bruno P, et al. Preferential chemosensitization of PTEN-mutated prostate cells by si-lencing the Akt kinase. Prostate, 2007,67(7):782-789

5 Martelli AM, Nyåkern M, Tabellini G, et al. Phospho-inositide 3-kinase/Akt signaling pathway and its ther-aeutical implications for human acute myeloid leukemia. Leukemia, 2006,20(6):91-98

6 Tang JM, He QY, Guo RX, et al. Phosphorylated Akt overexpression and loss of PTEN expression in non-small cell lung cancer confers poor prognosis. Lung Cancer, 2006,51(2):181-191

7 George P, Bali P, Annavarapu S, et al. Combination of the histone deacetylase inhibitor LBH589 and the hsp90 in-hibitor 17-AAG is highly active against human CML-BC cells and AML cells with activating mutation of FLT-3. Blood, 2005,105(4):1768-1776

8 Liao Y, Grobholz R, Abel U, et al. Increase of Akt/PKB expression correlates with gleason pattern in human pros-tate cancer. Int J Cancer, 2003,107(4):676-680

9 Hsu J, Shi Y, Krajewski S, et al. The Akt kinase is acti-vated in multiple myeloma tumor cells. Blood, 2001,98 (9):2853-2855

10 Nakanishi K, Sakamoto M, Yamasaki S, et al. Akt phos-phorylation is a risk factor for early disease recurrence and poor prognosis in hepatocellular carcinoma. Cancer, 2005, 103(2):307-312

11 Wipf P, Halter RJ. Chemistry and biology of wortmannin. Org Biomol Chem, 2005,3(11):2053-2061

12 Wu C, Huang J. Phosphatidylinositol 3-kinase/AKT mammalian target of rapamycin pathway is essential for neuroendocrine diferentiation of prostate cancer. J Biol Chem, 2007,282(6):3571-3583

13 Huang XL, Cui GH, Zhou KY, et al. Correlation of PI3K-Akt signal pathway to apoptosis of tumor cells. Chin J Cancer (Chinese), 2008,27(3):331-336

14 Grandage VL, Gale RE, Linch DC, et al. PI3-kinase/Akt is constitutively active in primary acute myeloid leuke-mia cells and regulates survival and chemoresistance via NF-κB, MAP kinase and p53 pathways. Leukemia, 2005, 19(4):586-594

15 Zhang C, Yang N, Zhang XW, et al. Advances in kinase inhibitors targeting PI3K/Akt-mTOR signal transduction pathway. Chin Oncol (Chinese), 2006,16(12):1064-1070

16 Xu Q, Simpson SE, Scialla TJ, et al. Survival of acute myeloid leukemia cells requires PI3 kinase activation. Blood, 2003,102(3):972-980

17 Westfll SD, Skinner MK. Inhibition of phosphatidylinosi-tol 3-kinase sensitizes ovarian cancer cells to carboplatin and allows adjunct chemotherapy treatment. Mol Cancer


456

Ther, 2005,4(11):1764-1771 18 Panwalkar A, Verstovsek S, Giles FJ. Mammalian target

of rapamyein inhibition as therapy for hematologic ma-lignancies. Cancer, 2004,100(4):657-666

19 Xie X, Gao Q, Wang YL, et al. Inhibition of PI3 K/PKB signal pathway improves chemotherapeutic effect on gas-tric carcinoma cell lines. Chin Pharmacol Bull (Chinese), 2008,24(12):1666-1670

20 Karin M, Cao Y, Greten F R, et al. NF-kappaB in cancer: from innocent bystander to major culprit. Nat Rev Cancer, 2002,2(4):301-310

21 Baldwin AS. Control of oncogenesis and cancer therapy resistance by the transcription factor NF-kappaB. J Clin Invest, 2001,107(3):241-246

22 Kaltschmidt B, Kaltschmidt C, Hofmann TG, et al. The pro- or anti-apoptotic function of NF-kappaB is deter-

mined by the nature of the apoptotic stimulus. Eur J Bio-chem, 2000,267(12):3828-3835

23 Bharti AC, Aggarwal BB. Nuclear factor-kappa B and cancer: its role in prevention and therapy. Biochem Phar-macol, 2002,64(5-6):883-888

24 Poh TW, Pervaiz S. LY294002 and LY303511 sensitize tumor cells to drug-induced apoptosis via intracellular hy-drogen peroxide production independent of the phospho-inositide 3-kinase-Akt pathway. Cancer Res, 2005,65(14): 6264-6274

25 Ohta T, Ohnfiehi M, Hayasaka T, et al. Inhibition of phosphatidylinositol 3-kinase increases efficacy of cis-platin in vivo ovarian cancer models. Endocrinology, 2006,147(4): 1761-1769

(Received March 19, 2009)

wortmannin inhibits k562 lukemic cells by regulating pi3k/akt channel in vitro

Documents