yap suppresses lung squamous cell carcinoma progression ...patients, patients with lung scc do not...

Molecular and Cellular Pathobiology

YAP Suppresses Lung Squamous Cell CarcinomaProgression via Deregulation of the DNp63–GPX2Axis and ROS AccumulationHsinyi Huang1,2,3,Wenjing Zhang1,2,3, Yafang Pan1,2,3,4, Yijun Gao1,2,3, Lei Deng5,Fuming Li1,2,3, Fei Li1,2,3, Xueyan Ma1,2,3, Shenda Hou1,2,3, Jing Xu6, Peixue Li1,2,3,Xiaoxun Li7, Guohong Hu7, Cheng Li8, Haiquan Chen9, Lei Zhang1,2,3,4,and Hongbin Ji1,2,3,4

Abstract

Lung squamous cell carcinoma (SCC), accounting for approx-imately 30% of non–small cell lung cancer, is often refractory totherapy. Screening a small-molecule library, we identified digi-toxin as a high potency compound for suppressing human lungSCC growth in vitro and in vivo. Mechanistic investigationsrevealed that digitoxin attenuated YAP phosphorylation andpromoted YAP nuclear sequestration. YAP activation led toexcessive accumulation of reactive oxygen species (ROS) by

downregulating the antioxidant enzyme GPX2 in a mannerrelated to p63 blockade. In patient-derived xenograft models,digitoxin treatment efficiently inhibited lung SCC progression incorrelation with reduced expression of YAP. Collectively, ourresults highlight a novel tumor-suppressor function of YAPvia downregulation of GPX2 and ROS accumulation, withpotential implications to improve precision medicine of humanlung SCC. Cancer Res; 77(21); 5769–81. �2017 AACR.

IntroductionLung cancer is the major health burden worldwide with high

incidence and mortality (1). On the basis of the clinical andhistological criteria, lung cancer can be classified into small-celllung cancer (SCLC) and non–small cell lung cancer (NSCLC;ref. 2), and the latter is the most common subtype of lung cancerwith a grim prognosis (3). Lung squamous cell carcinoma (SCC)accounts for approximately 30% of NSCLC cases (2), which

equates to about 400,000 patients worldwide annually (4).Lung SCC is a treatment-refractory malignancy, which remainsas largely incurable. Unlike lung adenocarcinoma (ADC)patients, patients with lung SCC do not have common onco-genic drivers such as EGFR mutation or ALK fusion (5), andseldom respond to those targeted therapeutic regimens (6–8).Therefore, the identification of efficient therapeutics is of urgentneed for improvement of human SCC management.

The Hippo pathway is a newly identified pathway, which isoriginally known to restrict organ size via balancing cell pro-liferation and apoptosis (9). Emerging evidences have alsoindicated the prominent role of the Hippo pathway in regu-lating tumorigenesis (10). YAP is one of major downstreamexecutors of the Hippo pathway. The Hippo signaling controlsYAP activation through the modulation of its protein leveland/or subcellular distribution in a MST-LATS dependent man-ner (11). The upstream components of Hippo pathway such asMST or LATS are observed to be switched off by mutations orepigenetic silencing and the downstream effects of the Hippopathway such as YAP are hyperactivated via gene amplificationor overexpression in a wide spectrum of human epithelialcancers (12). Indeed, YAP is commonly considered as aproto-oncogene in a majority of epithelial cancers includinglung cancer (13–16). Interestingly, other studies have alsodemonstrated the tumor-suppressive role of YAP in hemato-logical cancer and breast cancer (17, 18). These data indicate acell or tissue-context function of YAP in cancer malignantprogression.

Lung ADC and SCC are two distinct lung cancer subtypeswhereas the inactivation of LKB1 could progressively promotesthe transdifferentiation of lung ADC to SCC in the mouse model,which is potentially associated with malignant progression anddrug resistance (19, 20). Interestingly, our work from animal

1State Key Laboratory of Cell Biology , Chinese Academy of Science, Shanghai,China. 2CASCenter for Excellence inMolecular Cell Science, ChineseAcademyofScience, Shanghai, China. 3Innovation Center for Cell Signaling Network, Insti-tute of Biochemistry and Cell Biology, Shanghai Institutes for BiologicalSciences, Chinese Academy of Science, Shanghai, China. 4School of Life Scienceand Technology, Shanghai Tech University, Shanghai, China. 5Department ofBioinformatics, School of Life Science and Technology, Tong Ji University,Shanghai, China. 6Department of Nephrology, Kidney Institute of CPLA, Changz-heng Hospital, Second Military Medical University, Shanghai, China. 7The KeyLaboratory of StemCell Biology, Institute of Health Sciences, Shanghai Institutesfor Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao TongUniversity School of Medicine, University of Chinese Academy of Sciences,Shanghai, China. 8Center for Bioinformatics, School of Life Science, PekingUniversity, Beijing, China. 9Department of Thoracic Surgery, Fudan UniversityShanghai Cancer Center, Shanghai, China.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

H. Huang and W. Zhang contributed equally to the article.

Corresponding Authors: Hongbin Ji, Institute of Biochemistry and Cell Biology,Shanghai Institutes for Biological Sciences, 320 Yue Yang Road, Shanghai,200031 China. Phone: 86-21-5492-1108; Fax: 86-21-5492-1101; E-mail:[email protected]; and Wenjing Zhang, [email protected]

doi: 10.1158/0008-5472.CAN-17-0449

�2017 American Association for Cancer Research.

CancerResearch

www.aacrjournals.org 5769

on February 8, 2021. © 2017 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 15, 2017; DOI: 10.1158/0008-5472.CAN-17-0449

http://crossmark.crossref.org/dialog/?doi=10.1158/0008-5472.CAN-17-0449&domain=pdf&date_stamp=2017-10-20

http://cancerres.aacrjournals.org/

models have previously identified different levels of YAP activa-tion in lung ADC and SCC and found that YAP activation couldlargely abolish this phenotypic transition (21), indicating thatYAP might function differently in these two major subtypes ofNSCLC.We andothers have convincingly shown that YAP acts as apotential proto-oncogene in promoting lung ADC malignantprogression using both human cell lines and mouse models(21, 22). In contrast, the exact role of YAP in SCC still remainslargely unknown.

Here, we have performed a small-molecule compoundscreening in human lung SCC cells and identified digitoxin asthe one with high inhibitory potency. Unexpectedly, we findthat digitoxin increases YAP nuclear sequestration and boostsYAP activity. YAP activation unexpectedly leads to excessiveaccumulation of intracellular reactive oxygen species (ROS)level through downregulation of the antioxidant enzyme GPX2expression in DNp63-dependent manner. Using preclinical PDXmodels, we have further found the correlation between YAPlevel and digitoxin efficacy in suppression of lung SCC growth,which holds important implication for precision medicine.

Materials and MethodsHuman lung SCC specimen collection

All the human lung SCC specimens were collected in FudanUniversity Shanghai Cancer Center from November 2007 to July2010, with patient written consents and the approval from theInstitute Research Ethics Committee. The patient studies wereconducted in accordancewith International EthicalGuidelines forBiomedical Research Involving Human Subjects (CIOMS) ethicalguidelines. All tumor specimens were taken at the time of surgicalresection. Sixty-six of SCC samples were used for immunohis-tochemistry analysis.

Cell culture, transfection, and lentiviral infectionHuman lung SCC cell lines HTB-182, L78, CRL-5889 and

human normal bronchus epithelia cells HNBE were purchasedfrom the ATCC and cultured in RPMI-1640 supplemented with10% FBS. HEK-293T were cultured in DMEM containing 10%FBS. All cell lines were Mycoplasma free and cultured no longerthan 2 months after recovering. Lentiviral infection was done asfollows: HEK-293T cells were co-transfected with pLKO.1 orpCDH constructs and packaging plasmids. The progeny virusesreleased fromHEK-293T cells were filtered, collected, and used toinfect CRL-5889, HTB-182, and L78 cells, respectively.

Lung SCC cell growth inhibitor screeningA total of 500 cells per well were seeded in 384-well plates. A

library containing 465 compounds was dispensed into each well24 hours after seeding at a final concentration of 1 mmol/L. After72 hours, the cells were taken for PI and Hoechst staining. Imageof each well was captured by high content screening microscopesystem (Operetta, PerkinElmer). Cell number and cell death werecalculated and analyzed by Harmony 3.5 software.

Cellular functional assayCell viability was measured by CellTiter-Glo luminescent cell

viability assay (Promega). Briefly, 50 mL of assay reagent wasadded to the wells and mixed at room temperature. After 10minutes, intracellular ATP content was measured by a lumines-cence multilabel counter.

MTT assay was done as previously described (23). Briefly,20 mL of MTT working solution (5 mg/mL) was added intoeach well and incubated at 37�C for 4 hours. The superna-tants were then removed, and the resultant MTT formazan wasdissolved in 100 mL of DMSO. The absorbance was measuredat the wavelengths of 570 and 630 nm.

Soft agar assay was performed as previously described(23). Cells were added to growth medium with 0.2% agarand layered onto 1% agar beds in 6-well plates. Cells werefed with 1 mL of medium every 3 days. The colonies werestained with 0.005% crystal violet and counted in 3 to 4weeks.

Luciferase reporter assayHEK-293T cellswere seeded in24-well plates. Luciferase report-

er and the indicated plasmids were co-transfected. Luciferaseactivities were detected 48 hours after transfection using Dual-Luciferase Assay kit (Promega) on GloMax 20/20 luminometer(Promega) following themanufacturer's instructions. pRL-TKwasco-transfected as internal control. Experiments were done intriplicates.

RT-PCR and real-time PCRTotal RNA was extracted and retro-transcribed into first-

strand complementary DNA as previously described (21).cDNAs were subjected to quantitative real-time PCR withgene-specific primers on the 7500 Fast Real-Time PCRSystem using SYBR-Green Master PCR Mix. Primer list isas follows:

GPX2-Forward: GGTAGATTTCAATACGTTCCGGG;GPX2-Reverse: TGACAGTTCTCCTGATGTCCAAA;SOD2-Forward: TTTCAATAAGGAACGGGGACAC,SOD2-Reverse: GTGCTCCCACACATCAATCC;CAT-Forward: TGGGATCTCGTTGGAAATAACAC,CAT-Reverse: TCAGGACGTAGGCTCCAGAAG;XDH-Forward: CTGCGATTTGAAGGGGAGC,XDH-Reverse: TCAATGCCAATCTCCGTGTTC;PRDX5-Forward: CTTCACCCCTGGATGTTCCAA,PRDX5-Reverse: AGGCATCATTAACACTCAGACAG;GSTK1-Forward: AGAACCAGCTCAAGGAGACC,GSTK1-Reverse: CATCCACTTCTCTCCCAGCA;CROT-Forward: TTTTCTACCTGCAAGGTTCCAG,CROT-Reverse: ACAGCACTACAATGTGGTTTGG;MGST2-Forward: TCGGCCTGTCAGCAAAGTTAT,MGST2-Reverse: TGTTGTGCCCGAAATACTCTCT;IDH1-Forward: CACTACCGCATGTACCAGAAAGG,IDH1-Reverse: TCTGGTCCAGGCAAAAATGG;GCLC-Forward: GGCACAAGGACGTTCTCAAGT,GCLC-Reverse: CAGACAGGACCAACCGGAC;NRF2-Forward: TCATGATGGACTTGGAGCTG,NRF2-Reverse: CATACTCTTTCCGTCGCTGA;NQO1-Forward: GTCATTCTCTGGCCAATTCAGAGT,NQO1-Reverse: TTCCAGGATTTGAATTCGGG;DNp63-Forward: GGAAAACAATGCCCAGACTC,DNp63-Reverse: GTGGAATACGTCCAGGTGGC;GAPDH-Forward: CAGGTGGTCTCCTCTGACTT,GAPDH-Reverse: CCAAATTCGTTGTCATACCA

Microarray analysisGene profiling were performed using Affymetrix Human

Genome U219 array Strip. The expression of genes was

Huang et al.

Cancer Res; 77(21) November 1, 2017 Cancer Research5770




normalized with robust multichip average. The gene expressiondata were subjected to pathway analysis using GSEA (version2.2.10) from Broad Institute. Signal-to-noise ratio metric wasused to discover differential expression genes and enrichmentanalysis was performed with Kyoto Encyclopedia of Genes andGenomes pathway source by permuting 1,000 times of genessets. Significantly enriched pathways were scored and ranked bydefault nom-P value.

ImmunohistochemistryIHC was performed as described previously (24). Paraffin-

embedded mice tissues (lung, liver, and intestine) and xenografttumors were incubated with the following antibodies: anti-YAP(Santa Cruz Biotechnology; 1:500 dilution), anti-DNp63 (SantaCruz Biotechnology, 1:500 dilution), anti-Ki67 (Leica; 1:500dilution), anti-cleaved caspase-3 (Cell Signaling Technology;1:500 dilution), and anti–8-oxo-dGuo (Abcam; 1:500 dilution).The immunostaining was reviewed and scored blindly. The scor-ing system for grading level of nuclear YAP, nuclear p63 and 8-oxo-dGuo expressions was reported previously (21). Briefly,intensity was graded as 0�4 to indicate undetectable, weak,moderate, strong, and extremely strong staining. The expressionlevel was scored bymultiplying intensity by percentage of positivecells. The proliferation rate was evaluated by counting Ki67-positive nuclear staining. Cell death was assessed by the analysisof cleaved caspase-3 staining. Cellular oxidative stress wasassessed by 8-oxo-dGuo staining. To calculate cells positive forKi67, cleaved caspase-3 and 8-oxo-dGuo, at least 30 high-powerfields were evaluated for each group.

ImmunoblottingCells were lysed in lysis buffer and subjected to Western blot

analysis with the following primary antibodies: anti-YAP (SantaCruz Biotechnology, 1:500 dilution), anti–phospho-YAPSer127(Cell Signaling Technology, 1:500 dilution), anti-GPX2(Abcam,1:500 dilution), anti-DNp63 (SantaCruz Biotechnology,1:500 dilution), anti-LATS1 (Cell Signaling Technology, 1:1,000dilution), anti-MST1 (Cell Signaling Technology, 1:1,000 dilu-tion), anti-histone H3 (Proteintech, 1:1,000) and anti-ACTIN(Sigma, 1:5,000 dilution).

Nuclear and cytoplasmic protein extractionPreparation of nuclear and cytoplasmic extract was per-

formed as previously described using Beyotime Nuclear andCytoplasmic Protein Extraction Kit (21). Briefly, Cells wereharvested by adding 0.125% trypsin-EDTA and lysed in bufferA on ice for 15 minutes and centrifuged at 16,000 � g for 5minutes. The supernatant containing the cytoplasmic proteinswas stored for use. The pellet was resuspended in buffer B. Afterincubation on ice for 30 minutes, lysates were centrifuged at16,000 � g for 15 minutes and the supernatants containing thenuclear proteins were stored for use.

Intracellular ROS detectionIntracellular ROS detection was performed following manu-

facturer's instructions (Beyotime Reactive Oxygen Species AssayKit). Briefly, cells of indicated groups were seeded in 6-well plate.Forty-eight hours later, cells were incubatedwithDCFH-DAprobefor 20 minutes. Then the cells were harvested and subjected toFACS analysis.

Mice treatment and histopathological analysisAll mice were housed in a specific pathogen-free environ-

ment at the Shanghai Institute of Biochemistry and Cell Biologyand treated with strict accordance with protocols approved bythe Institutional Animal Care and Use Committee of theShanghai Institute for Biological Sciences, Chinese Academyof Sciences.

HTB-182cells (106 cells) andpatientderived lungSCCxenograftwere subcutaneously transplanted into nude mice (n ¼ 3 forxenograft assay and n ¼ 4–6 for PDX model each group). Whenthe average tumor volumes reached about 200 mm3, nude micewere administrated with digitoxin (1 mg/Kg) or vehicle via intra-peritoneal injection. Tumor volume and nude mice weight weremeasured every other day. Wild-type mice were also treated withdigitoxin (1 mg/Kg) for 3 weeks. All mice were then sacrificed forpathological examinationand tumorsweredissected formolecularanalysis. Histopathological analysis was conducted as previouslydescribed. Briefly, mice tissues including lung, liver, intestine, andxenograft tumorswere fixed in 4% formalin, embedded in paraffinand sectioned for hematoxylin and eosin staining.

Plasmid constructionTo construct the GPX2 expression plasmid, the coding

sequence of GPX2 was amplified with primers:GPX2-Forward: ACGAATTCGCCACCATGGAACAAAAACTCA-

TCTCAGAAGAGGATCTGGCTCACTCTGCGCTTCACCATGGCTT;GPX2-Reverse: CGGATCCCTATATGGCAACTTTAAGGAGG. The

DNA fragment was insert into pCDH vector.The GPX2 2074-bp promoter fragment was amplified with

following primers:

forward: CGGCTAGCTCTAGAAAAATTCCT-ACAAACAA;reverse: CCCTCGAGGGTGAAGCGCAGAGTGAGCCCCGC.

TheDNA fragment was then inserted into the pGL3-Basic vector.The human YAP2 expression vector is a gift from Professor

Kunliang Guan. The human YAP shRNA construct is generouslygiven by Professor Zengqiang Yuan. The human LATS1 andMST1shRNA construct is kindly given by Professor Bin Zhao. YAPexpression vectors, including YAP S127A, YAP 5SA and YAP5SA-DelC were generated as previously described (21). The plas-mids pCDH-YAP S94A and pCDH-YAPWWdomainmutantwereconstructed using the QuikChangeXL Site-Directed MutagenesisKit (Agilent Technologies).

Statistical analysisStatistical analyses were performed by the Student t test (two-

tailed) using Prism GraphPad software. Error bars represent SEM(�, P < 0.05; ��, P < 0.01; ��, P < 0.001).

ResultsIdentification of digitoxin as a top hit in suppression of lungSCC growth

To identify efficient lung SCC growth inhibitors, we screen-ed a chemical library of 465 compounds targeting variousbiological processes in human lung SCC cell line L78. Weidentified 10 candidates with most significant effects uponcell viability and cell death (Fig. 1A–C). Most of those com-pounds are known as anti-cancer drugs, suggesting the feasi-bility of our screen system. Interestingly, digitoxin and digox-in, which share similar chemical structure, stand out as top

YAP Suppresses Lung Squamous Cell Carcinoma Progression

www.aacrjournals.org Cancer Res; 77(21) November 1, 2017 5771




Figure 1.

Identification of digitoxin as a compound efficiently suppressing lung SCC growth in vitro and in vivo. A and B, Plots showing cell death (A) and growthinhibition (B) of lung SCC L78 cells treated with a library of small-molecule compounds at 1 mmol/L compared with the control. Digitoxin and digoxinare highlighted in red. C, Top 10 candidates with most significant effects upon cell death and growth inhibition. D, Relative cell viability of lung SCCcell ines L78, HTB-182, CRL-5889, and human normal bronchial epithelial cells HNBE treated with indicated concentration of digitoxin for 72 hourscompared with vehicle control. E, HTB-182 and CRL-5889 cells treated with digitoxin (100 nmol/L) in soft agar colony formation assay. F and G, Digitoxintreatment in xenograft assay of HTB-182 cells (n ¼ 3 for each group). Tumor volume (F) and weight (G) are shown. H and I, Representative photosof Ki67 (H) and cleaved caspase-3 (CC3; I) immunostaining in HTB-182 xenograft tumors treated with digitoxin. Statistical analyses of the Ki67and CC3-positive index are also shown. �� , P < 0.01; �� , P < 0.001.

Huang et al.





hits. Digitoxin is a cardiac glycoside widely used in clinic fortreating heart failure and atrial fibrillation, potentiallythrough inhibition of the sodium–potassium adenosine tri-phosphates' (Naþ/Kþ-ATPase) complex to increase the intra-cellular calcium level (25). We next tested the efficacy ofdigitoxin on other human lung squamous cell lines (HTB-182, L78 and CRL-5889) as well as human normal bronchialepithelial cells HNBE. Compared with HNBE cells, the lungSCC cell lines showed higher sensitivity to digitoxin (Fig. 1D).Consistently, digitoxin treatment almost completely abol-ished the colony formation ability of HTB-182 and CRL-5889 cells (Fig. 1E).

We further found that digitoxin treatment efficiently inhib-ited human SCC growth in xenograft assay, indicated by thesignificantly reduced tumor growth and tumor weights (Fig.1F–G). Consistently, a lower proliferation rate indicated byKi-67 staining and a higher apoptosis rate indicated bycleaved caspase-3 staining were observed in tumors with

digitoxin treatment (Fig. 1H–I). Taken together, these dataindicated that digitoxin worked efficiently in suppressing lungSCC growth both in vitro and in vivo.

Digitoxin enhances YAP activity in lung SCCPrevious study has showed that digitoxin gravitates to the

WW domain of YAP in a manner similar to the binding ofcanonical PPxY ligands (26, 27). This led us to investigate ifdigitoxin affects YAP activity. Interestingly, we found thatdigitoxin treatment indeed attenuated YAP-S127 phosphory-lation (Fig. 2A) and promoted YAP nuclear retention (Fig. 2Band C). Consistently, we observed a significant increase of YAPnuclear staining in tumors treated with digitoxin (Fig. 2D).Together, these data indicated that digitoxin treatment elevatedYAP activity in human SCC cells through currently unknownmechanism.

Figure 2.

Digitoxin promotes the nucleus translocation of YAP. A, Western blot detection of endogenous YAP and phosphorylated YAP (S127) levels in L78 andHTB-182 cells treated with digitoxin. Actin served as control. B, Immunofluorescence staining of L78 and HTB-182 cells treated with digitoxin. YAP(green) and nuclei (blue). C, Western blot detection of nuclear and cytoplasmic YAP levels in CRL-5889 and HTB-182 cells treated with digitoxin. HistoneH3 served as nuclear control and tubulin served as cytoplasmic control. D, Representative photos for YAP immunostaining and statistical analysis inHTB-182 xenograft tumors with or without digitoxin treatment. �� , P < 0.001.






Modulation of the MST1/LAST1/YAP axis suppresses lungSCC cell growth

The cytostatic effect of digitoxin and its promotive role onYAP activity led us to speculate that digitoxin inhibits SCC cellproliferation through activation of YAP. We found that ectopicexpression of YAP activating mutant (YAP-S127A) dramatical-ly suppressed lung SCC cell proliferation and decreased thesoft agar colony formation (Fig. 3A and B; Supplementary Fig.S1A). Moreover, we found that knockdown of either LATS1 orMST1, the upstream negative regulators of YAP in the canon-ical Hippo pathway (28), attenuated lung SCC cell prolifer-ation and colony formation (Fig. 3C–F; Supplementary Fig.S1B–S1C).

We further found that the growth inhibitory function ofYAP in lung SCC was impaired when its carboxyl-terminaltrans-activation domain was deleted (Supplementary Fig.S1D–S1E), indicating that the transcriptional activity of YAPis indispensable for its function. Previous studies showed

that TEADs and p73 are major transcriptional factors bindingto YAP and execute different functions in a context-depen-dent manner (29, 30). Disruption of the interaction betweenYAP and TEADs by employing YAP S94A mutant (31, 32),but not disruption of the interaction between YAP and p73by using YAP WW domain mutant (29), abolished thesuppressive role of YAP on lung SCC cell proliferation,suggesting the function of YAP in lung SCC depended onits binding to TEADs (Supplementary Fig. S1F–S1G). Togeth-er, these data indicated that YAP suppressed SCC cell growthpotentially through the transcriptional activation of theYAP–TEAD complex.

YAP suppresses lung SCC growth through disruption of ROShomeostasis

To further explore the underlying mechanism of YAPin regulating lung SCC cell growth, we performed gene-expression microarray profiling and gene set enrichment

Figure 3.

YAP activation inhibits lung SCC cell proliferation and soft agar colony formation. A, Relative cell growth of CRL-5889, HTB-182, and L78 cells with or withoutYAP S127A overexpression. B, The colony formation of CRL-5889 and HTB-182 cells with or without YAP S127A overexpression in soft agar assay. C, Relativecell growth of L78 and HTB-182 cells with or without LATS1 knockdown. D, The colony formation of HTB-182 cells with or without LATS1 knockdown insoft agar assay. E, Relative cell growth of L78 and HTB-182 cells with or without MST1 knockdown. F, The colony formation of HTB-182 cells with orwithout MST1 knockdown in soft agar assay. �� , P < 0.01; �� , P < 0.001.

Huang et al.





analysis (GSEA) to evaluate the global transcriptomic changesassociated with YAP activation. Interestingly, we found thatgene sets of peroxisome pathway and glutathione metabolismwere significantly enriched in SCC cells with YAP-S127Aoverexpression (Fig. 4A). Real-time PCR quantification fur-ther confirmed that YAP activation decreased the expressionof multiple signature genes for ROS clearance (Fig. 4B).Consistently, we observed the increased cytosolic ROSaccumulation in L78 and CRL-5889 SCC cells with YAPactivation (Fig. 4C and D). We further found that the growthinhibition upon YAP activation can be partially rescued by theROS scavenger N-acetyl cysteine (NAC; Fig. 4E). These datatogether suggested that YAP activation promoted excessive

ROS accumulation, which in turn resulted in lung SCC cellgrowth inhibition.

The P63/GPX2 axis mediates the inhibitory function of YAPTo identify potential downstream executors of YAP in

regulating ROS homeostasis, we examined the transcriptionallevel of multiple ROS scavenging genes. Most of those genesare down-regulated upon YAP activation in lung SCC cells(Fig. 4B). Notably, GPX2, which encodes the antioxidantenzyme glutathione peroxidase 2, was most significantly andconsistently downregulated in L78, HTB-182 and CRL-5889cells. Furthermore, we found that ectopic YAP S127A expres-sion significantly decreased GPX2 expression at both mRNA

Figure 4.

YAP activation promotes ROS accumulation. A, Significantly enriched gene sets in human lung SCC cells with or without ectopic YAP S127A expression. GSEAplots of the peroxisome and glutathione metabolism pathways are shown. B, Real-time PCR quantification of signature genes in peroxisome and glutathionemetabolism pathways in L78, HTB-182, and CRL-5889 cells with and without ectopic YAP S127A expression. Downregulation (%) was compared with vectorcontrol. C andD,ROS levels indicated by DCFH-DA staining in L78 (C) and CRL-5889 (D) cells with andwithout ectopic YAPS127A expression. E,Relative cell growthof L78, CRL-5889, and HTB-182 cells with or without ectopic YAP S127A expressionwith or without NAC (5mmol/L) treatment. � , P < 0.05; �� , P < 0.01; ��, P < 0.001.






Figure 5.

YAP promotes ROS accumulation via the DNp63–GPX2 axis. A and B, GPX2 mRNA (A) and protein (B) levels in HTB-182 and L78 cells with or without ectopic YAPS127A overexpression. C and D, GPX2 mRNA(C) and protein (D) level in HTB-182 and L78 cells with or without YAP knockdown. E, GPX2 promoter reporterassay with or without DNp63 overexpression in HEK-293T cells. F and G, GPX2 mRNA in HTB-182 (F) and L78 (G) cells with or without YAP S127A and/orDNp63 expression. H and I, GPX2 protein level in HTB-182 (H) and L78 (I) cells with or without YAP S127A and/or DNp63 expression. J, Relative cell growth of HTB-182 and L78 cells with or without YAP S127A and/or GPX2 expression. �� , P < 0.01; �� , P < 0.001.

Huang et al.





and protein level (Fig. 5A and B). Conversely, YAP knockdownupregulated GPX2 expression (Fig. 5C and D). We havepreviously shown that YAP decreased DNp63 expressionby upregulating the transcriptional repressor ZEB2 (21). Con-sistently, we find a negative correlation between YAP andP63 levels in human SCC samples (Supplementary Fig.S2A–S2B). Interestingly, GPX2 was reported to be a directtarget of DNp63 (33). Consistent with this, our data showedthat DNp63 over-expression significantly enhanced the GPX2-promoter activity (Fig. 5E). Moreover, the downregulation ofGPX2 level by YAP activation could be rescued by DNp63 co-expression (Fig. 5F–I). These data demonstrated that YAPdownregulated the expression of the antioxidant enzymeGPX2 in a DNp63-dependent manner. We next asked if GPX2indeed mediated the inhibitory function of YAP in SCC cells.Activation of YAP reduced GPX2 expression and suppressedSCC cell proliferation whereas reintroduction of GPX2 res-cued the inhibitory function of YAP (Fig. 5J; SupplementaryFig. S3A–S3B).

Boosting YAP activity by digitoxin treatment decreasedDNp63 level and in turn suppressed GPX2 expression (Fig.6A and B; Supplementary Fig. S3C). Moreover, digitoxintreatment significantly promoted excessive ROS accumula-tion (Fig. 6C). An increasing level of 8-oxo-dGuo, indicativeof DNA damage level triggered by ROS (34), was alsoobserved in digitoxin treatment group in vivo, suggestingthat digitoxin played an anti-tumor role via inducing ROS

accumulation (Fig. 6D). Together, our data demonstrated thatre-activation of YAP by genetic manipulation or digitoxintreatment disrupted ROS homeostasis via the DNp63–GPX2signaling axis.

Reactivation of YAP through digitoxin treatment efficientlysuppresses the growth of lung SCC with low YAP expressionin PDX model

Patient-derived xenograft (PDX) model serves as a usefulplatform for evaluating the therapeutic efficacy. To ask whetherthere exists the potential link between digitoxin efficacy andYAP nuclear level, we performed digitoxin treatments in twoSCC PDX models with relative low or high nuclear YAP level(Fig. 7A and B). No obvious loss of body weights was found inmice with digitoxin treatment (Supplementary Fig. S4A–S4B).Although digitoxin treatment increased YAP nuclear level inintestine and to a much less extent in liver and lung, theseorgans were pathologically normal and displayed no change ofcell proliferation and apoptosis rates, which were indicated byKi67 and cleaved caspase 3 IHC staining respectively (Supple-mentary Fig. S4C).

Interestingly, we found that the SCC model with low YAPlevel (PDX#1) was much more sensitive to digitoxin treat-ment: digitoxin treatment significantly suppressed the tumorgrowth (Fig. 7C). In contrast, the SCC PDX model withhigh YAP expression (PDX#2) was refractory to digitoxintreatment (Fig. 7D). Significant increase of YAP nuclear

Figure 6.

Activation of YAP by digitoxin promoted ROS accumulation via the DNp63–GPX2 axis. A and B, GPX2 mRNA (A) and protein (B) level in L78 and HTB-182cells with or without digitoxin treatment. C, ROS levels in CRL-5889 cells with or without digitoxin treatment. D, Representative photos for 8-oxo-dGuo immunostaining and statistical analysis in HTB-182 xenograft tumors with or without digitoxin treatment. � , P < 0.05; �� , P < 0.01; �� , P < 0.001.






Figure 7.

The antitumor efficacy of digitoxin in PDX mouse models correlates with low nuclear YAP level. A and B, Representative photos for YAP immunostainingin PDX#1 (A) with low nuclear YAP level and PDX#2 (B) with high nuclear YAP level. C and D, Tumors growth of lung PDX#1 (C) and PDX#2 (D)with or without digitoxin treatment. E and F, Representative photos for YAP (E) and 8-oxo-dGuo (F) immunostaining and statistical analysis in lungSCC PDX#1 with or without digitoxin treatment. G and H, Representative photos for YAP (G) and 8-oxo-dGuo (H) immunostaining and statisticalanalysis in lung SCC PDX#2 with or without digitoxin treatment. �� , P < 0.01; �� , P < 0.001. ns, nonsignificant.

Huang et al.





staining and ROS accumulate (indicated by 8-oxo-dGuostaining) were observed in the PDX#1 with digitoxin treat-ment (Fig. 7E and F). However, the YAPhigh SCC PDX#2 withdigitoxin treatment showed no significance changes in YAPnuclear expression and ROS accumulation (Fig. 7G and H).These data collectively demonstrated that reactivation ofYAP specifically suppressed the growth of lung SCC PDXwith low nuclear YAP level.

DiscussionIn this study, we have revealed an unexpected role of YAP in

the suppression of lung SCC growth through disruption ofintracellular ROS homeostasis via the DNp63–GPX2 axis. Wehave further identified digitoxin as a potential YAP activatorand cytostatic agent for human lung SCC with low YAP nuclearlevel. Reactivation of YAP by digitoxin shows tumor growthinhibition potential in both human lung SCC cell xenograftand preclinical lung SCC PDX models. These data demonstratethat the novel tumor-suppressive function of YAP correlateswith digitoxin treatment and provides potential therapeuticstrategy for treatment of human lung SCC with low YAPexpression.

The oncogenic property of YAP is well documented in lungcancer, especially in lung ADC. For example, we and others haveshown that YAP activation is important for lung ADCmalignantprogression (16, 21, 22) and the response to EGFR-targetedtherapy in lung ADC cells (35). However, the function of YAP inlung SCC still remains elusive. Previous studies show that themajority of human lung SCC exhibit low YAP levels (21, 36),suggesting that YAP may work in a distinct way in lung SCCmalignant progression. Activation of YAP either by geneticmanipulation or chemical tool in lung SCC results in decreasedcell proliferation and tumor growth, in stark contrast with theoncogenic role of YAP in lung ADC. Those data implicate thecell linage–specific role of YAP in lung cancer development. YAPactivation accelerates lung ADC progression through enhancingpro-survival and pro-metastatic genes expression (16, 22),whereas suppresses lung SCC growth through GPX2 down-regulation. Our data also support an involvement of the canon-ical YAP–TEAD complex in lung SCC growth suppression otherthan previously reported YAP–P73 complex in myeloma (17).We further show that YAP reduces GPX2 expression throughdownregulating SCC lineage-specific transcription factorDNp63. The dominant role of DNp63 in lung SCC survivalbut not lung ADC may explain why silencing DNp63 in lungSCC by YAP activation leads to the inhibition of lung SCCgrowth.

The fascinating connection between YAP and metabolic pro-gram, including nutrient traits, energy status, and redox homeo-stasis begins to emerge in recent years. YAP transcriptional activitycan regulate cellular response to glucose, for example, phospho-fructokinase (PFK1), responsible for the first committed step ofglycolysis, binds to TEADs and promotes their functional andbiochemical cooperation with YAP (37). The central metabolicsensor AMP-activated protein kinase (AMPK) can inhibit YAPactivation through either direct YAP phosphorylation or modu-lation of LATS1/2 activity via angiomotin-like 1 (AMOTL1;refs. 38, 39). The function of YAP in redox homeostasis is mainlystudied in cardiomyocytes. YAP activation can prevent cardio-myocyte death during severe oxidative stress condition (40).

Similarly, activation of YAP can protect cardiomyocyte cellagainst ischemia/reperfusion (I/R) injury, potentially throughupregulation of antioxidant genes CAT and MnSOD (41). Incontrast, how YAP regulates redox homeostasis in cancer remainslargely unknown. Our data demonstrate that YAP activation inSCC results in the redox reprogramming evidenced by elevatedROS accumulation. YAP promotes ROS accumulation throughdownregulation of those ROS scavenger genes such as GPX2,which might result in a severe defect of ROS clearance and triggercell growth inhibition.

Most efforts have been made to identify YAP inhibitorsgiven its oncogenic function in a majority of epithelial cancer(42–47). However, discovering YAP agonists is still in itsinfancy. Digitoxin, a clinical drug for heart failure treatment,was reported to have capability to manipulate several signalingpathways such as MAPK, SRC kinase, and PI3K signaling.Recently, several studies have also indicated that digitoxinand digoxin can inhibit the malignant progression throughtargeting the transcriptional activities of AP-1 and/or NF-kB. invarious cancer types, serving as a promising anti-cancer drug(48–50). Our results show the promising efficacy of digitoxinin boosting YAP activity although detailed biochemistrymechanisms need to be addressed. We anticipate that digitoxinwill be a useful tool for further understanding the physiolog-ical and pathological role of YAP in a variety of additionalexperimental settings. Digitoxin exhibits potential efficacy inprimary SCC tumors derived from patients with minimaltoxicity. Nonetheless, a large scale of lung SCC PDX modelsare necessary to test the in vivo efficacy and toxicity of digitoxinin the future. Moreover, these conclusions are based on studieswith growth of lung cancer cells subcutaneously, and futurestudies are needed to determine the effects of digitoxin upontumors growth in the lung environment. Together, our presentstudy provides a proof of principle that YAP could be apromising therapeutic target for those lung SCC with low YAPactivity and YAP expression level might serve as the biomarkerfor precision medicine.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: H. Huang, W. Zhang, H. Chen, H. JiDevelopment of methodology: H. Huang, W. ZhangAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): W. Zhang, Y. Gao, G. HuAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): H. Huang, W. Zhang, L. Deng, C. LiWriting, review, and/or revision of the manuscript: H. Huang, W. Zhang,H. JiAdministrative, technical, or material support (i.e., reporting or organiz-ing data, constructing databases): W. Zhang, Y. Pan, F. Li, X. Ma, S. Hou,J. Xu, P. Li, X. Li, H. Chen, L. Zhang, H. JiStudy supervision: H. Chen, H. Ji

AcknowledgmentsThe authors thank Drs. Kunliang Guan, Zengqiang Yuan, Caicun Zhou for

sharing materials; Dr. ShujueLan, Xinyuan Tong, Yingjiao Xue for technicalsupports.

Grant SupportThis work was supported by the National Basic Research Program of China

(2017YFA0505500), the Strategic Priority Research Program of the Chinese






Academy of Sciences, Grant No. XDB19000000, the National Natural ScienceFoundationofChina (81325015, 81430066, 91731314, 31621003, 31370747,81402371, 81402276, 81402498, 81401898, 81572949, 31500696,81372509), Science and Technology Commission of Shanghai Municipality(15XD1504000), China Postdoctoral Science Foundation (2015M581673),and Chinese Academy of Science Taiwan Young Scholar Visiting Program(2015TW1SB0001).

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received February 17, 2017; revised July 7, 2017; accepted September 5, 2017;published OnlineFirst September 15, 2017.

References1. Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, 2014. CA: Cancer J Clin

2014;64:9–29.2. Travis WD. Pathology of lung cancer. Clin Chest Med 2011;32:669–92.3. West H, Harpole D, Travis W. Histologic considerations for individualized

systemic therapy approaches for the management of non-small cell lungcancer. Chest 2009;136:1112–8.

4. Cancer Genome Atlas Research N. Comprehensive genomic characteriza-tion of squamous cell lung cancers. Nature 2012;489:519–25.

5. Su C, Xu Y, Li X, Ren S, Zhao C,Hou L, et al. Predictive and prognostic effectof CD133 and cancer-testis antigens in stage Ib-IIIA non-small cell lungcancer. Int J Clin Exp Pathol 2015;8:5509–18.

6. Paez JG, Janne PA, Lee JC, Tracy S, Greulich H, Gabriel S, et al. EGFRmutations in lung cancer: correlation with clinical response to gefitinibtherapy. Science 2004;304:1497–500.

7. Lynch TJ, Bell DW, Sordella R, Gurubhagavatula S, Okimoto RA, BranniganBW, et al. Activating mutations in the epidermal growth factor receptorunderlying responsiveness of non–small cell lung cancer to gefitinib.N Engl J Med 2004;350:2129–39.

8. Pao W, Miller V, Zakowski M, Doherty J, Politi K, Sarkaria I, et al. EGFreceptor genemutations are common in lung cancers from"never smokers"and are associated with sensitivity of tumors to gefitinib and erlotinib.Proc Nat Acad Sci U S A 2004;101:13306–11.

9. Pan D. Hippo signaling in organ size control. Gen Deve 2007;21:886–97.10. Mo JS, Park HW, Guan KL. The Hippo signaling pathway in stem cell

biology and cancer. EMBO Rep 2014;15:642–56.11. Hansen CG, Moroishi T, Guan KL. YAP and TAZ: a nexus for Hippo

signaling and beyond. Trends Cell Biol 2015;25:499–513.12. Zhao B, Li L, Guan KL. Hippo signaling at a glance. J Cell Sci 2010;

123:4001–6.13. Harvey KF, Zhang X, Thomas DM. The Hippo pathway and human cancer.

Nat Rev Cancer 2013;13:246–57.14. Schlegelmilch K, Mohseni M, Kirak O, Pruszak J, Rodriguez JR, Zhou D,

et al. Yap1 acts downstream of alpha-catenin to control epidermal prolif-eration. Cell 2011;144:782–95.

15. Dong J, Feldmann G, Huang J, Wu S, Zhang N, Comerford SA, et al.Elucidation of a universal size-control mechanism in Drosophila andmammals. Cell 2007;130:1120–33.

16. ZhangW, Gao Y, Li F, Tong X, Ren Y, Han X, et al. YAP promotes malignantprogression of Lkb1-deficient lung adenocarcinoma through downstreamregulation of survivin. Cancer Res 2015;75:4450–7.

17. Cottini F, Hideshima T, Xu C, Sattler M, Dori M, Agnelli L, et al. Rescue ofHippo coactivator YAP1 triggers DNAdamage-induced apoptosis in hema-tological cancers. Nat Med 2014;20:599–606.

18. Yuan M, Tomlinson V, Lara R, Holliday D, Chelala C, Harada T, et al. Yes-associated protein (YAP) functions as a tumor suppressor in breast.Cell Death Differentiation 2008;15:1752–9.

19. Han X, Li F, Fang Z, Gao Y, Li F, Fang R, et al. Transdifferentiation oflung adenocarcinoma in mice with Lkb1 deficiency to squamous cellcarcinoma. Nature Comm 2014;5:3261.

20. Hou S,HanX, Ji H. Squamous transition of lung adenocarcinoma and drugresistance. Trends Cancer 2016;2:463–6.

21. GaoY, ZhangW,HanX, Li F,WangX,WangR, et al. YAP inhibits squamoustransdifferentiation of Lkb1-deficient lung adenocarcinoma throughZEB2-dependent DNp63 repression. Nat Comm 2014;5:4629.

22. Lau AN, Curtis SJ, Fillmore CM, Rowbotham SP, Mohseni M, Wagner DE,et al. Tumor-propagating cells and Yap/Taz activity contribute to lungtumor progression and metastasis. EMBO J 2014;33:468–81.

23. Zhang W, Gao Y, Li P, Shi Z, Guo T, Li F, et al. VGLL4 functions as a newtumor suppressor in lung cancer by negatively regulating the YAP-TEADtranscriptional complex. Cell Res 2014;24:331–43.

24. Ji H, Li D, Chen L, Shimamura T, Kobayashi S, McNamara K, et al. Theimpact of human EGFR kinase domain mutations on lung tumorigen-esis and in vivo sensitivity to EGFR-targeted therapies. Cancer Cell2006;9:485–95.

25. Menger L, Vacchelli E, Kepp O, Eggermont A, Tartour E, Zitvogel L, et al.Trial watch: cardiac glycosides and cancer therapy. Oncoimmunology2013;2:e23082.

26. Hao Y, Chun A, Cheung K, Rashidi B, Yang X. Tumor suppressorLATS1 is a negative regulator of oncogene YAP. J Biol Chem 2008;283:5496–509.

27. Sudol M, Shields DC, Farooq A. Structures of YAP protein domains revealpromising targets for development of new cancer drugs. Sem Cell DevelBiol 2012;23:827–33.

28. Zhao B, Tumaneng K, Guan KL. The Hippo pathway in organ sizecontrol, tissue regeneration and stem cell self-renewal. Nat Cell Biol2011;13:877–83.

29. Strano S,Munarriz E, RossiM,Castagnoli L, Shaul Y, Sacchi A, et al. Physicalinteraction with Yes-associated protein enhances p73 transcriptional activ-ity. J Biol Chem 2001;276:15164–73.

30. Zhao B, Ye X, Yu J, Li L, LiW, Li S, et al. TEADmediates YAP-dependent geneinduction and growth control. Gen Devel 2008;22:1962–71.

31. Chen L,ChanSW,ZhangX,WalshM, LimCJ,HongW, et al. Structural basisof YAP recognition by TEAD4 in the hippo pathway. Gen Devel2010;24:290–300.

32. Li Z, Zhao B,Wang P, Chen F, Dong Z, YangH, et al. Structural insights intothe YAP and TEAD complex. Gen Devel 2010;24:235–40.

33. Yan W, Chen X. GPX2, a direct target of p63, inhibits oxidative stress-induced apoptosis in a p53-dependent manner. J Biol Chem 2006;281:7856–62.

34. Shigenaga MK, Aboujaoude EN, Chen Q, Ames BN. Assays of oxidativeDNA damage biomarkers 8-oxo-2'-deoxyguanosine and 8-oxoguaninein nuclear DNA and biological fluids by high-performance liquidchromatography with electrochemical detection. Methods Enzymol1994;234:16–33.

35. Wang H, Lu B, Castillo J, Zhang Y, Yang Z, McAllister G, et al. TankyraseInhibitor sensitizes lung cancer cells to endothelial growth factor receptor(EGFR) inhibition via stabilizing angiomotins and inhibiting YAP signal-ing. J Biol Chem 2016;291:15256–66.

36. Wang Y, Dong Q, Zhang Q, Li Z, Wang E, Qiu X. Overexpression of yes-associated protein contributes to progression and poor prognosis of non-small-cell lung cancer. Cancer Sci 2010;101:1279–85.

37. Enzo E, Santinon G, Pocaterra A, Aragona M, Bresolin S, Forcato M, et al.Aerobic glycolysis tunes YAP/TAZ transcriptional activity. EMBO J 2015;34:1349–70.

38. Mo JS, Meng Z, Kim YC, Park HW,Hansen CG, Kim S, et al. Cellular energystress induces AMPK-mediated regulation of YAP and the Hippo pathway.Nat Cell Biol 2015;17:500–10.

39. DeRan M, Yang J, Shen CH, Peters EC, Fitamant J, Chan P, et al. Energystress regulates hippo-YAP signaling involving AMPK-mediated regulationof angiomotin-like 1 protein. Cell Rep 2014;9:495–503.

40. Del Re DP, Yang Y, Nakano N, Cho J, Zhai P, Yamamoto T, et al. Yes-associated protein isoform 1 (Yap1) promotes cardiomyocyte survival andgrowth to protect against myocardial ischemic injury. J Biol Chem2013;288:3977–88.

41. Shao D, Zhai P, Del Re DP, Sciarretta S, Yabuta N, Nojima H, et al. Afunctional interaction betweenHippo-YAP signalling and FoxO1mediatesthe oxidative stress response. Nat Commun 2014;5:3315.

42. Liu-Chittenden Y, Huang B, Shim JS, Chen Q, Lee SJ, Anders RA, et al.Genetic and pharmacological disruption of the TEAD-YAP complex sup-presses the oncogenic activity of YAP. Genes Devel 2012;26:1300–5.

Huang et al.





43. Brodowska K, Al-Moujahed A, Marmalidou A, Meyer Zu Horste M,Cichy J, Miller JW, et al. The clinically used photosensitizerVerteporfin (VP) inhibits YAP-TEAD and human retinoblastomacell growth in vitro without light activation. Exp Eye Res 2014;124:67–73.

44. Jiao S, Wang H, Shi Z, Dong A, Zhang W, Song X, et al. A peptidemimicking VGLL4 function acts as a YAP antagonist therapy againstgastric cancer. Cancer Cell 2014;25:166–80.

45. Zhang Z, Lin Z, Zhou Z, Shen HC, Yan SF, Mayweg AV, et al. Structure-Based Design and Synthesis of Potent Cyclic Peptides Inhibitingthe YAP-TEAD Protein-Protein Interaction. ACS Med Chem Lett 2014;5:993–8.

46. Oku Y, Nishiya N, Shito T, Yamamoto R, Yamamoto Y, Oyama C, et al.Small molecules inhibiting the nuclear localization of YAP/TAZ

for chemotherapeutics and chemosensitizers against breast cancers.FEBS Open Bio 2015;5:542–9.

47. Zhou Z, Hu T, Xu Z, Lin Z, Zhang Z, Feng T, et al. Targeting Hippo pathwayby specific interruption of YAP-TEAD interaction using cyclic YAP-likepeptides. FASEB J 2015;29:724–32.

48. Kulkarni YM, Kaushik V, Azad N, Wright C, Rojanasakul Y, O'Doherty G,et al. Autophagy-induced apoptosis in lung cancer cells by a novel digitoxinanalog. J Cell Physiol 2016;231:817–28.

49. Prassas I, Karagiannis GS, Batruch I, Dimitromanolakis A, Datti A, Dia-mandis EP. Digitoxin-induced cytotoxicity in cancer cells is mediatedthrough distinct kinase and interferon signaling networks. Mol CancerTher 2011;10:2083–93.

50. Elbaz HA, Stueckle TA, Tse W, Rojanasakul Y, Dinu CZ. Digitoxin and itsanalogs as novel cancer therapeutics. Exp Hematol Oncol 2012;1:4.






2017;77:5769-5781. Published OnlineFirst September 15, 2017.Cancer Res Hsinyi Huang, Wenjing Zhang, Yafang Pan, et al.

GPX2 Axis and ROS Accumulation−Deregulation of the DNp63 YAP Suppresses Lung Squamous Cell Carcinoma Progression via

Updated version

10.1158/0008-5472.CAN-17-0449doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2017/09/15/0008-5472.CAN-17-0449.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/77/21/5769.full#ref-list-1

This article cites 50 articles, 14 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/77/21/5769.full#related-urls

This article has been cited by 1 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/77/21/5769To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-17-0449

http://cancerres.aacrjournals.org/content/suppl/2017/09/15/0008-5472.CAN-17-0449.DC1

http://cancerres.aacrjournals.org/content/77/21/5769.full#ref-list-1

http://cancerres.aacrjournals.org/content/77/21/5769.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/77/21/5769


yap suppresses lung squamous cell carcinoma progression ...patients, patients with lung scc do not...

Documents