2014-10-30

Seong-Eui Hong

Background

1987 2002 2005 2007

2012 2013

Identification of palindromic and repetitive se-quence

Study on the repetitive DNA sequence

Suggestion of the role in cell immunity

Experimental confirmation of adaptive immunity

Mechanisms of CRISPR in adaptive immunity

Figure from http://www.biochem.or.kr/ksbmb_webzine

tracrRNA: trans-acting crRNA

Genome editing using CRISPR

Introduction

• Aim: Generation of cancer model using CRISPR in mice

• Target gene: 1) Pten2) p533) beta-catenin

Generation of Pten mutations in adult animals using CRISPR

• Pten: negative regulator of PI3K/Akt

Step1: cloning of pX330 vector co-expressing an sgRNA targeting Pten (sgPten) and Cas9

Step2: in vitro mutation in mouse 3T3 cell using sgPtenStep3: in vivo delivery of luciferase plasmid DNA using

hydrodynamic tail-vein injection, which can deliver DNA to 20% of hepatocytes

Step4: in vivo delivery sgPten and sgGFP in FVB mice dur-ing 2 weeks

Result: delivery of sgPten

• 3.36% hepatocytes with (-) Pten staining• 0.4% hepatocytes with intermediate Pten staining

(=heterozygous mutation)

• Elevated staining of pAkt in sgPten mice• Oil red O staining indicates lipid accumulation in sg-

Pten mice, which is a known phenotype in Pten muta-tion in liver

• Conclusion: in vivo CRISPR-mediated genome editing was able to

generate Pten (-) cells in the liver, mimicking liver-spe-cific conditional deletion of Pten in mice

Question: Loss of Pten is due to CRISPR-me-diated mutation?

Method: Deep sequencing• 2.66% of the reads had indels

in Pten locus• 0.56% indels in sgGFP• Most of variants were pre-

dicted to cause frameshift mutations

• 1~2bp indels cause the dis-ruption of the Pten reading frame

• These indels were at the predicted sgPten induced Cas9 cutting site

• Whereas the indels in sg-GFP distributes randomly

• Pten loss (scored by IHC) strongly correlated with the Pten indels

Conclusion: These data indicate that for most cells, ex-pression of the sgPten vector results in muta-tion of Pten

Question: long-term phenotype following sgPten treatment?

• Method:

Analysis the livers from 3 sgPten-treated mice at 4 months

• Lipid accumulation• Pten loss• Elevated pAkt• No induction of p53 despite the activation of pAkt• No tumor up to 4 months

Question: off-target?

• Recent studies identified that Cas9 can tolerate mismatches between sgRNA and genomic DNA depending on the sgRNA sequence and the position of the mismatches

• Question: potential off-target effects of sgPten in the liver?

• Method:

1) Prediction of sgPten off-target sites using a published prediction tool

2) Amplification of the Pten locus and the top four potential off-target sites us-ing Surveyor assay Result:

There were no Surveyor nuclease cut-ting, indicating that the frequency ofoff-target editing is below the limit of detection of this assay

Test of a nickase version of Cas9

• Cas9 generates double strand breaks

• Cas9(D10A) makes single-strand DNA (ssDNA) breaks and was re-ported to have further reduced levels of off-target effects

Test of a nickase version of Cas9

• By deep sequencing, 2.76% indels at the Pten locus compared to 0.26% in sgGFP-treated mice were observed

• Pten (-) cells were observed

Generation of p53 mutations in adult an-imals using CRISPR

• 6.061% of indels in p53 was observed• No tumor up to 3 months

Co-injected sgPten and sgp53• 4.06% for Pten and 6.46% for p53• At 3 months post-injection, all 5 mice developed

liver tumors with bile duct differentiation fea-tures

• Tumors were positive for cytokeratin 19, a marker of bilinear lineage cells

• bi-allelic mutations of both genes

Tumor ID Gene Sequences (indels=red)

T2 Pten ATGACAGCCATCATCAAAGAGATCGTTAGCAGAAAC-AAAGGATGACAGCCATCATCAAAGAGATCGTTAGCAGAAA--AAAGG

p53 ATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCT--GCCAGGATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTGACGCCAGG

T3 Pten ATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACCAAAAGGATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACCAAAAGG

p53 ATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTG-GCCAGGATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTGAAGCCAGG

T4 Pten ATGACAGCCATCATCAAAGAGATCGTTAGCAGAAAC-AAAGGATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACCAAAAGG

p53 ATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTG-GCCAGGATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTGAAGCCAGG

T5 Pten ATGACAGCCATCATCAAAGAGATCGTTAGCAG-AACAAAAGGATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACCAAAAGG

p53 ATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTGAAGCCAGGATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTGAAGCCAGG

Question: Can CRISPR be used to directly in-troduce gain of-function mutations?

• Target: Ctnnb1 gene, which encodes b-catenin, a transcription factor in the Wnt signalling pathway that is frequently mutated in liver cancer

• Phosphorylation at four ser/thr results in the degradation of Ctnnb1

• Method: co-injection of two pX330 plasmids carrying i) sgRNA targeting Ctnnb1 and ii) 200 nt ssDNA oligonucleotide containing four point mu-tation

• in five mice injected with sgbcatenin and ssDNA, 0.5% of hepatocytes ex-hibited nuclear b-catenin

• Accumulation of b-catenin was asso-ciated with increased levels of glu-tamine synthetase, a b-catenin target gene

Targeting of b-catenin

• Reduced level of p-b-catenin• Nuclear accumulation of b-catenin

As a result of deep sequencing, small but de-tectablepercentage of sequencing reads contained the four ‘G’ point mutations present in the ssDNA

Conclusion:These data demonstrate that CRISPR system can be used to directly induce gain-of-function mutation or other substitutions via homolo-gous recombination in vivo

Conclusion

• The authors illustrate the potential to directly disrupt tumor suppressor genes and generate point mutations in oncogenes in adult mouse liver using the CRISPR/Cas system

• This approach generated compound Pten and p53 indels at low fre-quency but was sufficient to induce multifocal tumors

• More efficient delivery techniques, such as adenovirus or adeno-as-sociated virus, more potent sgRNAs, and longer homologous re-combination templates might also improve the overall efficiency of this method and expand the range of tissue that could be targeted

• Consistent with recent studies showing that long-term Cas9/sgRNA ex-pression is not toxic in cells