ANTISENSE SUPPRESSION OF δ-CADINENE SYNTHASE GENE IN COTTON

Thesis submitted to the University of Agricultural Sciences, Dharwad in partial fulfilment of the requirements for the

Degree of

MASTER OF SCIENCE

IN

BIOTECHNOLOGY

By

REVATHY CHARAGONDA

DEPARTMENT OF BIOTECHNOLOGY COLLEGE OF AGRICULTURE, DHARWAD

UNIVERSITY OF AGRICULTURAL SCIENCES, DHARWAD-580 005

APRIL, 2008

ADVISORY COMMITTEE

DHARWAD (I. S. KATAGERI ) APRIL 2008 MAJOR ADVISOR

Approved by : Chairman : I. S. KATAGERI

______________________

Members : 1. _________________________

(P. U. KRISHNARAJ)

2. _________________________ (S. S. PATIL)

3. _________________________ (H. M. VAMADEVAIAH)

CONTENTS

Sl. No. Chapter Particulars

CERTIFICATE

ACKNOWLEDGEMENT

LIST OF TABLES

LIST OF FIGURES

LIST OF PLATES

1. INTRODUCTION

2. REVIEW OF LITERATURE

2.1 Discovery of RNA interference

2.2 Mechanism of post transcriptional gene silencing

2.3 RNAi and functional genomics

2.4 Applications of RNAi for crop improvement

2.5 Disease resistance by RNAi

2.6 RNAi for male sterility in plants

2.7 RNAi and gene therapy

2.8 Constraints of RNAi

2.9 Designing constructs for PTGS

3. MATERIAL AND METHODS

3.1 Material used

3.2 Amplification of partial δ -cadinene gene

3.3 PCR based cloning

3.4 Cloning into generic ihp vector

3.5 Subcloning into plant transformation vector pCAMBIA1305.1

3.6 Mobilizing recombinant clones into Agrobacterium LBA4404

3.7 Transgenic cotton development

3.8 Transgene expression analysis

4. EXPERIMENTAL RESULTS

4.1 PCR amplification of δ-cadinene gene from cotton

4.2 PCR based cloning and sequence analysis

4.3 Cloning into generic ihp vector

4.4 Cloning into plant transformation vector pCAMBIA1305.1

4.5 Mobilizing recombinant clones into Agrobacterium

4.6 Transgenic cotton development

4.7 Plant transformation studies

5. DISCUSSION

5.1 Construction of gene cassette for plant transformation

5.2 Plant transformation studies and PCR analysis

5.3 Expression studies

6. SUMMARY AND CONCLUSIONS

7. REFERENCES

8. ABSTRACT

LIST OF TABLES

Table No. Title

1. Landmarks in PTGS

2. Use of RNAi in metabolic engineering of plants

3. Use of RNAi for virus resistance in plants

4. Homology of the 600 bp dCS trigger sequence to various isoforms of δ-cadinene synthase gene from cotton

LIST OF FIGURES

Figure No. Title

1. Model of PTGS/RNAi

2. Vector map of pTZ57R/T

3. Construct maps of pTZ57R/T carrying partial δ-cadinene sense and antisense gene

4. 600 bp Nucleotide sequence of partial δ-cadinene gene fragment

5. Nucleotide and aminoacid blast result of 600 bp partial δ-cadinene synthase gene

6. Restriction map of partial δ-cadinene gene fragment

7. Vector back bone maps used to develop PTGS constructs

8. Vector map of pCAMBIA1305.1

9.

Map of pCAMBIA1305.1 carrying ihp (sense and antisense) inserts

LIST OF PLATES

Figure No. Title

1. Total RNA isolation and PCR standerdization of d-cadinene gene

2. PCR and Restriction confimation of pTZR/T clones containing partial d-cadinene gene

3. PCR and Restriction confirmation of ihp clones

4. PCR and Restriction analysis of pCAMBIA1305.1 carrying d-cadinene synthase gene

5. Transgenic cotton plant containing δ-cadinene synthase gene

6. Gossypol gland counting from transgenic and control plant

1 INTRODUCTION Cotton has been cultivated for its fiber for >7,000 years. Despite the availability of

synthetic alternatives, it continues to serve as the most important source of fiber for textiles. Cotton is grown in >80 countries and is a cash crop for >20 million farmers in developing countries in Asia and Africa, where malnutrition and starvation are rampant. An attribute of cotton not widely recognized is that for every 1 kg of fiber, the plant produces ~1.65 kg of seed. This makes cotton the third largest field crop in terms of edible oilseed tonnage in the world. In addition to 21% oil, cottonseed is a source of relatively high-quality protein (23%). However, the ability to use this nutrient-rich resource for food is hampered by the presence of toxic gossypol that is unique to the tribe Gossypieae. This cardio and hepatotoxic terpenoid present in the glands, renders cottonseed unsafe for human and monogastric animal consumption (Risco and Chase., 1997). Unfortunately, this toxicity subjugates this abundant agricultural resource to the ranks of a feed for ruminant animals either as whole seeds or as meal after oil extraction. In fact, the 44 million metric tons (MT) of cottonseed (9.4 million MT of available protein) produced each year could provide the total protein requirements of half a billion people for 1 year (50 g/day rate) if the seed were safe for human consumption. Thus, gossypol-free cottonseed would significantly contribute to human nutrition and health, particularly in developing countries (Hedin et al., 1992), and would help to meet the requirements of the predicted 50% increase in the world population in the next 50 years.

Gossypol and related terpenoids are present throughout the cotton plant in the glands of foliage, floral organs, and bolls, as well as in the roots. In addition, these terpenoids are induced in response to microbial infections. These compounds protect the plant from both insects and pathogens (Stipanovic et al., 1999). After the discovery of a glandless mutant, several breeding programs were launched in the U.S., Africa, and Asia to transfer the glandless trait into commercial varieties to produce gossypol-free cottonseed. These programs provided cottonseed that could be fed to monogastric animals that use feed more efficiently and was even deemed safe for human consumption. Cottonseed compared favorably as a source of protein compared to other traditional food sources in several human nutrition studies (Lusas and Jividen., 1987). However, these glandless cotton varieties were a commercial failure. Under field conditions, glandless plants were extraordinarily susceptible to attack by a host of insect pests, because they constitutively lacked protective terpenoids (Jenkins et al., 1966) and were, therefore, rejected by farmers. Thus, the potential of cottonseed in contributing to human nutrition remains unfulfilled.

Gossypol and other sesquiterpenoids are derived from (+) - (δ)-cadinene. The enzyme δ-cadinene synthase catalyzes the first committed step involving the cyclization of farnesyl diphosphate to (+) - (δ)-cadinene (Rathore et al., 2006). Thus, tissue-specific RNAi of δ-cadinene synthase expression to disrupt terpenoid biosynthesis offers a possible mechanism to eliminate gossypol from the seed while retaining a full complement of this and related terpenoids in the rest of the plant for maintaining its defensive capabilities against insects and diseases.

Gene silencing in plants and animals can be induced by delivery of dsRNA into their cells. In animals, this has been mainly by transient delivery, such as by injection, of dsRNA (Baulcomge, 2004). In plants, stable transformation with transgenes that encode hairpin (hp) RNA has been the method of choice. The ds or hpRNA induces a two step, sequence specific RNA degradation mechanism involving a nuclease called DICER and a nuclease complex called RISC. In the first step the ds or hpRNA is degraded into ≈ 21 nt fragments by DICER. In the second step, one of the strands of a siRNA is used to guide the RISC complex to complementary ssRNA which RISC then cleaves. Thus the sequence delivered as ds or hpRNA determines which ssRNAs are destroyed. This early directed RNA degradation mechanism has found wide usage in medical, animal, insect and plant research.

Gene silencing has emerged as a powerful tool to protect against viruses, generate valuable traits (Baulcombe, 1996), and to determine the functions of genes identified by genome sequencing (Chory et al., 2000). It has also become a key tool in the rush to develop new therapeutics, both as a therapeutic agent in itself and as a research tool to identify and validate gene targets for new therapeutics (Arenz and Schppers, 2003).

A major challenge in the post genome era of plant biology is to determine the functions of all the genes in plant genome (Helliwell and Waterhouse, 2002). A straight forward approach to this problem is to reduce or knock out expression of a gene with the hope of seeing a phenotype that is suggestive of its function. Insertional mutagenesis is a useful tool for this type of study, but is limited by gene redundancy, lethal knock outs, non tagged mutants and the inability to target the inserted element to a specific gene. RNA interference of plant genes, using constructs encoding self complementary hairpin RNA, largely overcome these problems (Smith et al., 2000). RNAi has been used very effectively in Caenorhabditis elegans functional genomics and resources are currently being developed for the application of RNAi to high-throughput plant functional genomics (Fire et al., 1998).

Initially, gene silencing was a puzzling phenomenon but great studies have been made in elucidating the basic biology of the complex mechanism. Today, the phenomenon of RNA silencing is used to describe all siRNA mediated gene silencing pathway that are evolutionarily conserved in most eukaryotic organisms. The phenomenon has been referred to as Post Transcriptional Gene Silencing (PTGS) in plants, RNA interference (RNAi) in nematode, flies and mammals and quelling in fungi and is increasingly viewed as an adaptive immune system of plants against viruses (Voinnet, 2001). The term RNAi indicates name given to a gene silencing process induced by double stranded RNA (dsRNA) and is widely used strategy for functional genomics, the primary advantage being its ability to knock down the specific target gene. The implication of the RNAi in science has lead to christening RNAi as “Technology of the year” (Couzin et al., 2002).

Post transcriptional silencing of δ-cadinene synthase genes was envisaged as a way to activate silencing mechanism in cotton, there by blocking the cadinene type sesquiterpenes pathway and abolishing gossypol production in the transformants. With this background, following objectives were set for the current study.

1. Development of PTGS construct for silencing δ-cadinene synthase gene to prevent the expression of gossypol in cotton

2. Genetic transformation using PTGS construct with sense and antisense genes to prevent the production of gossypol in cotton

2 REVIEW OF LITERATURE Plants enlist a complex array of physical and chemical defenses to protect themselves against diseases. Cotton plants (Gossypium spp) have numerous inducible defense mechanisms that are important for their ability to respond to changing biotic threats, including the synthesis of volatile terpenes (Pare and Tumlinson, 1997), phytoalexins, tannins, tyloses, pathogenesis related proteins, as well as lignification’s, and the release of active oxygen species (Bell, 1981). In cotton (Gossypium hirsutum) the enzyme (+)-δ-cadinene synthase (CDNS) catalyzes the first committed step in the biosynthesis of cadinene type sesquiterpens such as gossypol, that provides constitutive and inducible protection against pests and diseases. However, the presence of gossypol renders cottonseed unsafe for human and monogastric animal consumption. Thus gossypol free cottonseed would significantly contribute to human nutrition and health.

Plant breeders frequently seek to improve crops by down-regulating expression of genes encoding undesirable traits. They have done this traditionally by selecting within natural variation inherent in a species after needing to use unadapted germplasm as the source of the required trait expression. This is a slow and costly process requiring several generations and considerable effort to construct elite lines with the desired phenotype. Alternatively, new variation for trait expression can often be generated through the use of chemical mutagens or ionizing radiation. In this case, large mutagenized populations have to be created and screened, and desirable selections may then have to undergo extensive backcrossing to remove random mutations not associated with the trait and deleterious to agronomic preference. A further limitation in using induced mutation approaches is that they cannot control gene expression in a tissue specific manner if the genes involved have constitutive expression.

Post transcriptional gene silencing (PTGS) a sequence-specific RNA degradation mechanisms inherent in eukaryotes, has been successfully used to silence gene expression and produce desirable traits in crop plants. PTGS has been induced in plants either through the use of antisense or cosupression constructs (Kooter et al., 1999). One major advantage of this approach is the ability to avoid any undesirable effects of global silencing of the target gene by confining the gene suppression to a specific tissue or organ through the use of appropriate tissue-specific promoters to drive the gene-silencing constructs. However, the relatively low frequency of PTGS achieved with antisense and co-suppression (Hamilton et al.,1998) requires that large populations of transgenic plants are produced in order to obtain an acceptable number of transgenic lines exhibiting sufficient degrees of target gene suppression. This can present a major limitation, particularly in species that have low transformation and regeneration frequencies.

RNA-mediated interference (RNAi) is an evolutionarily conserved gene silencing mechanism that recognizes double-stranded RNA (dsRNA) as a signal to trigger the sequence-specific degradation of homologous mRNA. Arguably the most important advance in biology has been the discovery that RNA molecules can regulate the expression of both endogenous and exogenous genes. The literature on post transcriptional gene silencing/RNA interference (RNAi) is reviewed here.

The mechanism of down regulation of gene expression by sense transgene would involve an antisense like process (Grierson et al., 1991). The PTGS could be initiated both by sense and antisense transgenes and both might follow similar biochemical mechanism (Francesco et al., 2001). In some cases, the silencing phenomenon has been correlated with methylation in the promoter sequences, which controlled the expression of the specific transgenes (Matzke and Matzke, 1991). By contrast, other studies indicated that the suppressed genes were transcribed and the silencing event occured post-transcriptionally through the reduction of steady-state mRNA levels (Mol et al., 1994). Co-suppression of the endogenous gene occurred at a higher frequency in transgene carrying a small inverted repeat in the 5' UTR than in those harboring only the sense transgene without the inverted repeat (Metzlaff et al., 1997). Detailed analysis of RNA content has revealed the presence of discrete RNA degradation intermediates (Eldik et al., 1998).

The antisense transcripts have been described in prokaryotes, as well as in a variety of eukaryotes (Kumar and Carmichael, 1998), where, they invariably play a negative role. The

biological activity of antisense RNA can be exerted at all levels of gene expression: transcriptional RNA processing and transport and RNA stability and translation (Brossollet and Vaquero, 1998). Antisense transcripts might be involved in different biological functions, such as the control of development or adaptation to different stresses. The observation in mammals and other eukaryotes indicate that naturally transcribed antisense RNA has to fulfill two major functions. First, it can code for small protein or for a peptide. Indeed, peptides are known to be commonly used as signal molecules in mammals and to be found also in plants. These antisense transcripts encode a product, referred as overlapping transcripts. Second, the antisense RNA can regulate the expression of the sense transcripts depending on their location in cell, which could be the nucleus as well as the cytoplasm.

Antisense transcripts have also been found in other transposon systems, such as the micropia retrotransposon of Drosophila and TOC1 from chlamydomonas (Day and Bejarano., 1991; Lankenau et al., 1994). High level of sense transcript correlated with low level of antisense RNAs and vice versa, suggesting that, the antisense transcript might regulate the expression of genes. Antisense mediated gene silencing (ASGS) and PTGS with sense transgenics are remarkably similar in mechanistic terms. Both forms of silencing are involved in production of 20-25nt long degraded RNA (siRNA) (Serio et al., 2001; Groot et al., 2004). However, PTGS works only when both sense and antisense RNAs are simultaneously present in the plant cell.

RNA silencing by PTGS is a newly discovered mechanism of gene regulation in eukaryotes. It is in some way, similar to classical humoral immunity, which protects eukaryotes against viruses and transposons. Post-transcriptional gene silencing (PTGS) of small sense and antisense RNAs and aberrant transcripts of endogenous sense and truncated homologous transgene were demonstrated by YuanHuai et al. (2004). PTGS greatly reduces mRNA accumulation in plant, but doesn’t affect transcription. Significant accumulation of sense and antisense siRNAs was observed in various PTGS systems in plants (Hamilton and Baulcombe, 1999). The accumulation of both sense and antisense siRNAs suggests that dsRNA is produced prior to RNA degradation.

Comparative effect of sense, antisense, dsRNA and siRNAs was first studied by Klahre et al. (2002). Their results suggest that siRNAs themselves or intermediates induced by siRNAs could comprise silencing signals and that these signals induce self-amplifying siRNAs. Only dsRNA molecules showed the highest level of gene silencing as compared to single stranded RNA molecules. Transformation of plants with hpRNA constructs gives stable silencing that is inherited from generation to generation, thereby enabling the continued study of a phenotype (Waterhouse and Wang., 2001). In experiments in which genes have been targeted with intron-containing hpRNA constructs, silencing causes measurable effects (70-100%) in the resulting plants (Wesley et al., 2001; Helliwell et al., 2002). Fire et al. (1998), first demonstrated that injection of sense, antisense and dsRNA molecules to C. elegans induces gene silencing. After injection into adult animals, purified single strands have at most a modest effect, whereas double-stranded mixtures cause potent and specific interference. The effects of this interference were evident in both the injected animals and their progeny. Only a few molecules of injected dsRNA were required per affected cell, arguing against stochiometric interference with endogenous mRNA and suggesting that there could be a catalytic or amplification component in the interference process.

The initiation of RNAi in the dsRNA triggered silencing of a second transcript that has no homology to the initial dsRNA trigger, but shares upstream sequence similar to the first transcript (Sijen et al., 2001). Transitive RNAi appears to occur when siRNA molecules synthesized new dsRNA, mediated by an RNA dependent RNA polymerase (RdRP), in the 5'-3' direction on the antisense strand. The newly synthesized dsRNA leads to the production of more siRNA and triggers further gene silencing (Han and Grierson, 2002).

2.1 DISCOVERY OF RNA INTERFERENCE

The discovery of RNA interference (Guo and Kemphues., 1995; Fire et al., 1998) was unusual in the post modern era of molecular biology in that, like immunoglobulin gene rearrangement, for example, it was almost entirely unanticipated. Beyond the action of RNA interference and RNA silencing at the translational level of gene expression, RNA mediated phenomena are now known to direct the transcription-level. Silencing of some genes, and

even the “editing down’ of an organisms genome by selective excision events in certain cases (Selker, 2003; Yao et al., 2003).

Prior to the discovery of RNAi, scientists applied various methods such as insertion of T-DNA elements and transposons, treatment with mutagens or irradiation and antisense RNA suppression to generate loss-of-function mutations. Apart from being time-consuming, the above methods did not always work satisfactorily. For instance, transposons and T-DNA elements were found to occasionally insert randomly in the genome resulting in highly variable gene expression. Furthermore, in many instances the particular phenotype or a trait could not be correlated with the function of a gene of interest. It is against this backdrop that the RNAi phenomenon was discovered.

The antisense process doesn’t always result in a loss of function of a targeted gene, which led concerned scientists to continue the search for other methods of gene silencing. Fire et al. (1998) took the antisense silencing approach a step further in C. elegans with simultaneous introduction of both the sense and antisense strands of the targeted mRNA, resulting in a ten fold higher potency in silencing of the targeted mRNA. This experiment laid the foundation for many scientists to look into the complex process of RNAi.

RNA silencing is a novel mechanism of gene regulation, that limits the transcript level by either suppressing transcription [transcriptional gene silencing (TGS)] or by activating a sequence-specific RNA degradation process [post transcriptional gene silencing (PTGS)]/RNA interference (RNAi), mechanistic connection between TGS and PTGS does exist. Transcriptional gene silencing is an emerging field while PTGS is under going enhancement in its information content.

Three phenotypically different but mechanistically similar forms of gene silencing, co-suppression or PTGS in plants (Jorgensen, 2003), quelling in fungi (Cogoni et al., 1996) and RNAi in the animal kingdom (Fire et al., 1998) have been described. More recently, miRNA formation (Pasquinelli, 2002; Bartel, 2004), promoter methylation (Matzke et al., 2001; Wesley et al., 2001), heterochromatinization (Schramke and Allshire, 2003) etc., have been revealed as other facets of naturally occurring RNAi processes in eukaryotic cells. The evolutionary functions of RNAi and its related processes are designed for the protection of genome against invading mobile elements like viruses and transposons as well as for orchestrated functioning of developmental programs in eukaryotes.

For the past few years, the primary focus of the studies on miRNA has been to catalogue the complete mRNA inventory in a host of model organisms, using both cloning and bioinformatics (Bartel, 2004) and search for the natural targets of these endogenous regulators. David Baulcombe’s group developed tools for functional genomics in plants, through development of potato virus X (PVX), as an effective vector for high throughput virus-induced gene silencing (Liu et al., 2003).

The Ambrose laboratory reported the first case of micro RNA (miRNA) in an attempt to silence heterochronic gene lin-4 of C. elegans (Lee et al., 1993), and the Fire and Mello laboratories described the gene silencing effect of double-stranded RNA (dsRNA) in C. elegans by injecting dsRNA that corresponds to unc22, responsible for body morphology (Fire et al., 1998).

2.2 MECHANISM OF POST TRANSCRIPTIONAL GENE SILENCING

Recent advances in molecular biology have shown that gene expression can effectively be silenced in a highly specific manner, through the addition of double stranded RNA. The term RNA interference (RNAi) was coined to describe this phenomenon. The mechanism was originally observed in plants and later in the worm Caenorhabditis elegans. Subsequent studies have shown that RNAi is present in a wide variety of eukaryotic organisms including mammals. For the most part, it is believed that RNAi serves as an antiviral defense mechanism although there is, preliminary evidence that it also play a role in the formation and maintenance of heterochromatin during mitosis and meiosis.

Table 1. Landmarks in PTGS

Events/Phenomenon References

First reported resistance against TMV in transgenic tobacco using CP gene Powel-Abel et al., 1986

Silencing phenomenon correlated with promoter methylation Matzke et al., 1989

Gene silencing induced by co-suppression in plants Nepoli et al., 1990

Sense strand could down regulate endogenous gene expression Nepoli et al., 1990

Replicase mediated resistance against TMV Golemboski et al., 1990

Discovery of miRNAs in C. elegans Lee et al., 1993

Plant RdRp doesn’t require primers to synthesize RNA in vitro Schiebel et al., 1993

Cloning of QDE1 gene in animals homologous to plant RdRp Lindbo et al., 1993

First transgenic tomato expressing coat protein of TYLCV Kunik et al., 1994

First evidence that sense RNA could instigate gene silencing in C. elegans Guo and Kemphues, 1995

RNA silencing was first reported in animals using antisense mRNA in C. elegans Guo and Kemphues, 1995

VIGS demonstrated in plants Kumagai et al., 1995

Transmission of PTGS signals through grafting in plants Palauqui et al., 1997

RNA silencing is induced locally and spreads systemically Voinnet et al., 1997

Gene silencing effect of dsRNA in C. elegans Fire et al., 1998

Spreading of siRNA both in 5’ and 3’ along the target Voinnet et al., 1998

Use of PVX as VIGS vector Ruiz et al., 1998

Use of TRV as VIGS vector Ratcliff et al., 1999

Cell-to-Cell movement of silencing signal in plants Voinnet et al., 1998

Heterologous gene silencing described Hamilton et al., 1999

Table 1. Contd…

Events/Phenomenon References

An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells Hammond., et al., 2000

RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals Zamore., et al., 2000

AGO1, QDE-2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals

Fagard., et al., 2000

Selective reduction of dormant maternal mRNAs in mouse oocytes by RNA interference Svoboda., et al., 2000

RNA interference is mediated by 21-and 22-nucleotide RNAs Elbashir., et al., 2001

Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells Elbashir., et al., 2001

RNAi in mouse oocytes and preimplantation embryos: effectiveness of hairpin dsRNA Svoboda., et al., 2001

Single-stranded antisense siRNAs guide target RNA cleavage in RNAi Martinez., et al., 2002

Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells Lee., et al., 2002

Bispecific short hairpin siRNA constructs targeted to CD4, CXCR4, and CCR5 confer HIV-1 resistance. Oligonucleotides

Anderson., et al., 2003

Inhibition of HIV-1 by lentiviral vector-transduced siRNAs in T lymphocytes differentiated in SCID-hu mice and CD34+ progenitor cell-derived macrophages

Banerjea., et al., 2003

RISC is a 5' phosphomonoester-producing RNA endonuclease Martinez., et al., 2004

Argonaute2 Is the catalytic engine of mammalian RNAi Liu., et al., 2004

A brief history of RNAi: the silence of the genes Sen., et al., 2006

RNAi in combination with a ribozyme and TAR decoy for treatment of HIV infection in hematopoietic cell gene therapy

Li., et al., 2006

Fig. 1: Model of PTGS/RNAi (Waterhouse and Helliwell, 2003)

The dsRNA alone cannot degrade mRNA, but requires the assistance of two enzymes namely, Dicer and RISC. Dicer, which was first discovered by Bernstein et al. (2001) in Drosophila, is a complex enzyme belonging to the RNase III family. It has four different domains with different functions. They are: (a) N-terminal helicase, (b) dual RNase III motifs, (c) C-terminal dsRNA binding domain, (d) PAZ (Piwi/Argonaute/Zwille) domain (Kuznetsov, 2003; Arenz and Schepers, 2003). The PAZ domain is believed to physically interact with the corresponding PAZ domain of the RISC complex. The dual RNase III motifs perform the actual cleavage of the dsRNA, hence the characteristic 5’ phosphate and 3’ hydroxyl residues on the resulting siRNAs. ARGONAUTE1 (AGO1) of Arabidopsis thaliana mediates the cleavage of miRNA-targeted mRNAs and it has been also implicated in PTGS of transgenics and maintenance of chromatin structure (Vaucheret, 2006). Experiments involving human DICER showed that the cleavage mechanism of the enzyme is ATP-independent (Kuznetsov, 2003). However, ATPase activity could also be involved during the release of siRNA from the enzyme. The helicase domain is also believed to take part in the process.

The DICER protein functions in two different pathways in silencing a gene by recognizing distinct types of precursor dsRNA. In the first pathway, DICER cleaves long and perfect dsRNA structures originated mainly from the protein-coding region to generate double stranded siRNAs, which guide the subsequent endonucleolytic cleavage of homologous RNAs with perfect base pairing interaction (Elbashir et al., 2001). In the second pathway, DICER can dice imperfect RNA duplexes predominantly derived from the regions between protein coding genes into short RNAs, which are subsequently recruited into a micro RNA-ribonucleoprotein complex (miRNP) to further regulate translational inhibition or other PTGS effects (Hutvagner et al., 2001; Voinnet, 2002). Accordingly DICER processes precursors dsRNAs to generate both siRNAs and miRNAs. Recently, four types of dicers involved in small interfering RNA biogenesis have been reported in Arabidopsis (Xie et al., 2004 and 2005), they are DCL1 (miRNA), DCL2 (viral RNA), DCL-3 (endogenous siRNA) and DCL-4 (exogenous siRNA) (Fig. 1).

RISC is the component of the RNAi machinery that uses siRNAs to track down and degrade the target mRNAs. First discovered in Drosophila, by Hammond et al. (2000), RISC consists of both protein and RNA. The protein component of the complex has ribonuclease activity with the ability to cleave RNA. In addition to ribonuclease activity, RISC also contains a PAZ domain involved in regulation of RNA interference (RNAi). Additional RISC components include two RNA binding proteins, vasa intronic and dFMR protein (Arenz and Schepers, 2003). There are still other components of RISC yet to be identified. For example, it remains unclear as to how the siRNA incorporates within the complex. Recent biochemical studies in Drosophila suggested that the DCR-2/R2D2 complex also facilitates incorporation of siRNA into the RISC complex (Liu et al., 2006). RISC utilizes the siRNA and search for the complementary target mRNA.

The biochemical and informatics efforts reached a single conclusion that the sequence and structure of a siRNA determines which of its two strands participates in the RNA silencing pathway. Consequently, some siRNAs appear inactive in vivo, as the wrong strand has entered the RNAi pathway (Schwarz et al., 2003). The orientation of DCR-2/R2D2 complex proteins on the siRNA duplex reflects which strand is incorporated into RISC (Tomari et al., 2004). Each siRNA dissociates from the DICER active site soon after it is produced, its thermodynamics evaluated by the RNA silencing machinery and then, one strand is selectively loaded onto RISC and other is destroyed. The degradation process is initiated once the successful location and cleavage of the complementary mRNA occurs by the siRNA-RISC complex. Studies are beginning to reflect that the siRNAs are transported through the phloem (Lucas et al., 2001) and the regulation of RNA trafficking plays an important role in plant development in addition to its role in PTGS (Vance and Vaucheret, 2001).

In case of translational repression pathway, small RNAs direct RISC to bind to target mRNA and repress its translation process, rather than cleavage. Animal miRNAs typically, but not always, mediate translational repression rather than cleavage. In contrast, most plant miRNAs direct target RNA cleavage. The multiple candidate sites in 3’ UTR sequences is useful predictor for an mRNA being regulated by miRNA. The complete pairing of 3' half of a siRNA or miRNAs to target RNA is not required for translational repression (Doench et al., 2003). Translational repression occurs at some stage after translational initiation, because the

distribution of ribosomes along the length of the repressed mRNA under going active translation (Vauchert, 2006). Inspite of all these findings, still many more questions are still left answered. The more we explore RNA silencing, the more these pathways reveal their remarkable complexity.

Short RNAs associated with transgene RNA silencing are heterogeneous in both size and function (Hamilton and Baulcombe, 1999). Thus, these RNAs are not a single class of ~25nt, but instead are two distinct species with 21-22nt and 25nt in size. The 21-22nt siRNA represents the siRNA that guides the RISC ribonuclease to the target of RNA silencing (Elbashir et al., 2001; Aigner, 2006). However, it is unlikely that the two classes of siRNA have the same function because they accumulate differently in locally and systematically silenced tissue. The long siRNA molecule that is directly involved in systemic silencing, RNA directed DNA methylation and RNA silencing processes such as amplification and transitivity (Sijen et al., 2001; Vaistij et al., 2002) may also depend on the long siRNAs.

The term, small interfering RNA (siRNA) was coined due to their use as a targeting sequence by RISC, aimed at mRNA for degradation, first isolated by Hamilton and Baulcombe (1999). The siRNAs are composed of 21-25bp with a 5' phosphate and 3' hydroxyl groups with 2-3bases of overhangs. Lipardi et al., (2001) found that the 3' hydroxyl group is required in order to direct RNAi in vitro. While, DICER may incorporate siRNAs into RISC following their synthesis, they don’t require event to occur in vivo.

2.3 RNAi AND FUNCTIONAL GENOMICS

RNAi has several advantages over insertional mutagenesis for functional genomics, the prime advantage being an ability to specifically target the chosen gene (Guo et al., 2003). Down regulation of endogenous genes via PTGS using sense or antisense constructs is a crucial tool to assess gene function in transgenic plants. One drawback of these studies is that constitutive gene silencing often entails pleiotropic effects on growth and development of transgenic plants, which complicate the interpretation of the phenotype and might mask true gene function. Effective gene silencing by PTGS of two highly related target genes as compared to conventional antisense fragments was observed by Hofgen et al. (1994) and Papenbrock et al. (2000).

2.4 APPLICATIONS OF RNAi FOR CROP IMPROVEMENT

Since its discovery, RNA silencing has been widely implemented as a research tool for a number of potentially commercial applications in crop improvement by controlling unwanted traits or metabolic pathway (Senior, 1998). One of the first commercial product was a tomato and with a longer shelf life as a result of silencing of gene responsible for softening of ripen fruit (Schuch et al., 1989). RNAi technology has also been used in several other plants to improve their nutritional quality for example caffeine content in coffee plants has been markedly reduced by RNAi mediated suppression of caffeine synthase gene (Ogita et al., 2004). In another work, RNAi has been used to generate dominant high lysine maize variant by knocking out the 22 kDa maize zein protein, a protein that is poor in lysine content (Zlus and Galili, 2004).

RNA interference of soybean isoflavane synthase (IFS) genes led to silencing in tissues distal to the transformation site and enhanced its susceptibility to Phytophthora sojae (Subramanian et al., 2005). Approximately 50% of the transformed roots showed >95% silencing of isoflavone accumulation.

An exhaustive and gene-specific gene silencing was successfully induced to modulate flower color (Fukusaki et al., 2004), by altering chalcone synthase (CHS) activity, a key enzyme for anthocyanin biosynthesis, using coding region and 3’ UTR of CHS-mRNA.

Naturally occurring, hpRNA-mediated silencing of a rice gene [low glutelin content 1 (Lgc1)] has been reported [Kusaba et al., 2003]. Glutelin is a major seed storage protein; the low glutelin content of the resulting rice lines is beneficial for patients with kidney diseases who must reduce their protein intake. Lgc1 is a dominant mutation that results in the reduction of glutelin content in the rice grain. Lgc1 homozygotes have a deletion of ~3.5 Kb between two highly similar glutelin genes, forming a tail-to-tail inverted repeat, which results in a dsRNA, inducing gene silencing. This has been confirmed by producing transgenic plants containing the inverted repeat and by detecting siRNAs belonging to that region in natural

mutants and in transgenic plants [Kusaba et al., 2003]. The trait was stable for 20 generations demonstrating the stability of dsRNA in transgenic plants.

The efficacy of this approach has been demonstrated by silencing two key enzymes in the fatty acid biosynthesis pathway in cotton: ghSAD-1 and ghFAD2-1. RNAi mediated down regulation of ghSAD-1 elevated the stearic acid content in cotton seeds (44% compared with a normal level of 2%), and silencing ghFAD2-1 increased the oleic acid content (77% compared with a normal level of 15%) [Liu et al., 2002].

RNAi has also shown promise in the development of hypoallergenic grasses. The major cause of hay fever and seasonal allergic asthma, which affects ~25% of the population in temperate climates, is ryegrass pollen (Loliumspp.). The main allergens are the pollen proteins Lol p1 and Lol p2: 90% of allergy sufferers are sensitive to these proteins. Levels of Lol p1 and Lol p2 can be down regulated by expressing antisense cDNA sequences under the control of a maize pollen-specific promoter [Petrovska et al., 2005]. Analysis of these transgenic grasses is also providing information about the function of the allergens in pollen, which is so far unclear.

A somewhat different approach was adopted to improve productivity of oilseed rape (Brassica napus). This species produces a bright-yellow canopy of flowers that can absorb nearly 60% of photo synthetically active radiation, resulting in reduced yield. A plant with reduced (or no) petals was achieved using an hp construct targeted at the BPI gene family (MADS-box floral organ identity genes) under the control of a chimeric, petal-specific promoter derived from Arabidopsis [Byzova, et al., 2004]. The resultant plants produced male fertile flowers in which the petals were converted into sepals (Arabidopsis) or into sepaloid petals (B. napus).

The first real breakthrough for RNAi-mediated metabolic engineering came in 2004 when RNAi was used to silence enzymes in the codeine reductase (COR) gene family in the opium poppy (Papaver somniferum) [Allen et al.,2004]. This was achieved using an hpRNA construct containing sequences from multiple cDNAs of genes in the pathway. A precursor, the non narcotic alkaloid (S)-reticuline, which occurs upstream of codeine in the pathway, accumulated at the expense of morphine, codeine, opium and thebaine in transgenic plants. The researchers involved in this study were the first to report metabolic engineering of the opium poppy using RNAi and the first to interfere with multiple steps in a complex biochemical pathway.

The earliest example of PTGS involved the re-introduction of the full coding region of the target gene in either the normal (sense) or reverse (antisense) orientation. The antisense-mediated PTGS was used in rapeseed to down-regulate the expression levels of the ∆9-desaturate enzyme that converts stearic acid to oleic acid, resulting in an increase in stearic acid from 2% to about 33% (Knutzon et al., 1992). Similarly, sense-mediated PTGS (co-suppression) targeted against the ∆12-desaturase that converts oleic acid to linolenic acid has resulted in the development of soybean, rapeseed and mustard oil with very high oleic acid (Liu et al., 2002; Stoutjesdijk et al., 2002). However, these antisense and co-suppression strategies have proven to be variable and unpredictable in their effectiveness and generally require the production and screening of large number of lines to isolate those exhibiting sufficient degree of gene suppression. The PTGS technology has also been successful in genetic modification of the fatty acid composition of oil in other crops (Stoutjesdijk et al., 2002; Liu et al., 2002). The alterations to fatty acid composition of seed oil achieved using PTGS enables the development of a range of fatty acids that better match current end-use requirements.These results suggested that hpRNA has the potential to be the most efficient in systemically silencing the endogenous gene than sense and antisense strategies.

Table 2. Use of RNAi in metabolic engineering of plants

TRAIT TARGET GENE HOST PLANT POTENTIAL

BENEFIT Reference

Reduced or absent petals BP1 gene Oilseed rape Improved photosynthesis

Byzova., et al., 2004

Reduced ethylene sensitivity 1-Aminocyclo propane-1- carboxylate oxidase

Tomato Longer shelf life (slower ripening

Xiong., et al., 2004

Reduced caffeine production CaMxMt 1 gene Coffee bean plant Decaffeinated coffee Ogita., et al.,2004

Non-narcotic alkaloid production Codeine reductase (COR) gen Opium poppy - Allen., et al., 2004

Maize quality Starch branching enzyme Maize Up to 50% increase in amylose content

Chai., et al., 2005

Increased carotenoid and flavonoid content DET1 gene Tomato Consumer health benefits

Davuluri., et al., 2005

Flower colour CHI gene Tobacco - Nishihara., et al., 2005

Enzymatic browning Polyphenyl oxidase gene Potato Extended storage life Welsley., et al., 2001

Allergy Lol p1 and Lol p2 Ryegrass (Lolium spp.) Hypo-allergic ryegrass Petrovska., et al., 2005

Increased stearic acid and oleic acid content of seed oil

ghSAD-1 and ghFAD2-1 genes Cotton Useful for cooking applications without the need for hydrogenation

Liu., et al.,2002

Increased arsenic uptake ACR2 gene Arabidopsis thaliana Phytoremediation of soils

Dhankher., et al., 2006

2.5 DISEASE RESISTANCE BY RNAi

The effects of gene silencing in plants were first used in efforts to develop resistance to diseases, particularly those caused by viruses, although the mechanism was not clear at the time. This ‘pathogen-derived resistance’ (PDR) was achieved by transforming plants with genes, or sequences, derived from the pathogen, with the aim of blocking a specific step in the life or infection cycle of the pathogen. Many of the strategies used for PDR were shown to be mediated by RNA, rather than protein, and led directly to the identification of PTGS – a phenomenon that is believed to be a form of anti-viral defence [Voinnet et al., 2001; Goldbach et al., 2003]. An important finding, first recognized in plants, was that once triggered, the silencing spreads throughout the organism by virtue of a gene silencing signal [Voinnet et al.,1998], thus providing systemic rather than localized resistance. The effectiveness of RNAi technology for generating virus resistance in plants was first demonstrated in 1998. Complete immunity was reported to Potato virus Y in potato plants harbouring vectors for the simultaneous expression of both the sense and antisense transcripts of the viral helper-component proteinase (HCPro) gene [Waterhouse et al.,1998]. Immunity has since been shown for several other viruses The technology works against a diverse array of RNA viruses. However, plant viruses have evolved counter-silencing strategies by encoding proteins that can overcome this resistance. These ‘suppressors’ of gene silencing are often involved in viral pathogenicity and mediate synergism among plant viruses – a phenomenon whereby two viruses, each providing an essential factor for the synergism, induce a more severe disease than either on their own. Simultaneous silencing of diverse plant viruses can be achieved by designing hairpin structures that target distinct viruses in a single construct.

Efforts to control single-stranded DNA viruses, specifically the Gemini viruses, by RNAi have been reported. The non-coding intergenic region of the Gemini virus Mungbean yellow mosaic India virus (MYMIV) was expressed as an hp construct under the control of the 35S promoter and used to biolistically inoculate MYMIVinfected black gram (Vigna mungo) plants. Plants treated with the construct showed a complete recovery from infection that lasted until senescence. This work showed that phyto pathogenic DNA viruses can potentially be controlled by RNAi and that promoter sequences (which are not usually transcribed but can possibly be covered by fortuitous read-through) make a suitable target for silencing [Pooggin et al., 2003]. The coding sequences of Gemini viruses, particularly the Rep protein (a rolling-circle initiator protein essential for viral DNA replication), have been used as a target for pathogen-mediated resistance [Bendahmane and Gronenborn, 1997; Sangare et al., 1999.]. The potential for silencing geminiviruses by RNAi using a transient protoplast assay has also been shown [Vanitharani, et al., 2003.]. Protoplasts were cotransfected with a siRNA designed to the Rep coding sequence of African cassava mosaic virus (ACMV) and the genomic DNA of ACMV resulting in a 91% reduction in Rep transcript and 66% reduction in viral DNA. This siRNA was able to silence a closely related strain of ACMV but not a more distantly related virus. Subsequently the complete Rep gene of ACMV was transformed, in sense orientation, into cassava (Manihot esculenta). Again resistance was shown following challenge with infectious clones of ACMV and viral DNA levels were reduced by 98%. Despite the presence of virus these plants remained symptom less. In addition, the ACMV Rep transgene provided good protection against several distantly related geminiviruses, showing the potential of RNAi for developing broad-spectrum resistance, something that has not been possible using other means.

However, attempts to obtain RNAi-mediated resistance against a second Gemini virus, Tomato yellow leaf curl Sardinia virus, also by targeting Rep sequences, resulted in either no or limited resistance [Noris, et al.2004]. This suggests that RNAi-mediated resistance might not work against all Gemini viruses. The reason for this might be the differential expression of RNAi against viruses. In plants with RNAi mediated resistance to the coat protein of Beet necrotic yellow vein virus (BNYVV), resistance levels are variable between tissues, levels of resistance in leaves being higher than in roots [Andika, et al.,2005]. A recent study shows that Gemini viruses use different strategies to overcome RNA silencing. A better understanding of suppression of RNA silencing by these viruses might thus be needed for the effective use of RNA silencing-mediated resistance [Bisaro, 2006].

Table 3. Use of RNAi for virus resistance in plants

NAME OF VIRUS FAMILY REGION TARGETED RESULTS SYSTEM USED GENOME Reference

Potato virus Y Potyviridae HC-Pro Immunity Potato RNA Waterhouse., et al., 1998

Mungbean yellow mosaic India virus (MYMIV)

Geminiviridae Bidirectional promoter Recovery from infection

Vigna mungo (black gram)

DNA Pooggin., et al., 2003

African cassava mosaic virus (ACMV)

Geminiviridae Replication-associated protein gene

Reduced virus accumulation

Tobacco Protoplast

DNA Vanitharani., et al., 2003

Tomato yellow leaf curl Sardinia virus

Geminiviridae Replication-associated protein gene

Poor resistance Tomato DNA Noris., et al., 2004

Pepper mild mottle virus (PMMoV)

Tobamoviridae Arbitrary sequence Block in viral infectivity

Tobacco RNA Tenllado., et al., 2003

Tobacco etch virus (TEV Potyviridae Arbitrary sequence No viral-specific symptoms appeared

Tobacco RNA Tenllado., et al., 2003

Alfalfa mosaic virus (AMV Bromoviridae Arbitrary sequence Recovery from infection

Tobacco RNA Tenllado., et al., 2003

Beet necrotic yellow veinvirus (BNYVV)

Benyviridae Coat protein Tolerance Tobacco RNA Andika., et al., 2005

Tobacco mosaic virus (TMV Tobamoviridae Replication-associated protein

Inhibition of TMV replication

Tobacco RNA Zhao., et al., 2006

RNAi has similarly been used to provide protection against phytopathogenic bacteria. Agro bacterium tumefaciens causes crown gall disease that affects many perennial fruit, nut and ornamental crops. There are two genes that play an important role in this disease: iaaM, encoding a tryptophan monooxygenase that converts tryptophan to the auxin precursor indoleacetamide [Depicker, et al., 1978], and ipt, encoding a product catalysing the condensation of AMP and isopentenyl pyrophosphate to form the cytokinin zeatin [Lichtenstein, et al.,1984]. Expression of both of these oncogenes is required for wild-type tumour formation [Ooms, et al.,1981]. Transgenic Arabidopsis thaliana and Lycopersicon esculentum transformed with RNAi constructs targeting iaaM and ipt showed resistance to crown gall disease. RNA silencing plays an important role in establishing crown gall disease, and plants deficient in silencing are hyper-susceptible to A. tumefaciens [Dunoyer, et al., 2005]. Successful infection relies on a potent anti-silencing state established in tumours whereby siRNA synthesis is specifically inhibited.

RNAi has also been used effectively to target nematode genes important for pathogenicity on plants. Expression of silencing constructs against these genes in transgenic plants might provide protection against phytopathogenic nematodes [Bakhetia, et al., 2005].

2.6 RNAi FOR MALE STERILITY IN PLANTS

Reproduction in plants, particularly male gametogenesis, is an area of intense investigation in plant developmental biology; there is significant commercial interest in controlling crop fertility [Goldberg, et al., 1993; Gorman and McCormick, 1997]. Manipulation of pollen development is crucial for F1 hybrid seed production. Numerous genes have been identified in a diverse range of plant species that show another-specific expression. The manipulation of some of these using transgenic technologies has been used to interfere with male fertility.

RNAi has been used to generate male sterility. hpRNA constructs targeting TAZ1, an another-specific zinc-finger protein involved in tapetum development, result in the production of transgenic petunia that have generalized degeneration of the tapetum and extensive microspore abortion, which is initiated soon after their release from pollen tetrads. The few pollen grains that are retained show reduced flavonoloccumulation, defects in pollen wall formation and poor germination [Kapoor, et al., 2002].

Recently, hpRNAi was used to identify the function of the rice gene OsGEN-L. OsGEN-L is a member of the RAD2/XPG nuclease gene family. Most of the OsGEN-LRNAi plants had low fertility, and some were male-sterile. Sterility in this case resulted from a defect in early microspore development [Moritoh, et al.2005]. Another way of using RNAi to create male sterility is to silence anther-specific promoters using hairpin structures directed against promoter sequences. The maize gene MS45 is expressed exclusively in the tapetal layer of anthers during microspore development and mutation results in a male-sterile phenotype. A high frequency of male-sterile plants were obtained by constitutively expressing an inverted repeat construct containing fragments of the Ms45 promoter [Cigan, et al.2005].

The ability to restore male fertility is an important issue for hybrid seed production, particularly in species such as oilseed rape, maize and sunflower where the crop is grown from the second generation seed of hybrid plants. In the case of cytoplasmic male sterility, this is achieved by restorer lines. For engineered sterility using the Barnase gene, male fertility is restored by crossing with a second transgenic line carrying the Barstar gene; a specific cytoplasmic inhibitor of Barnase [Mariani, et al.,1990]. Male fertility is restored after hpRNAi-mediated silencing of the Ms45 promoter by expressing the Ms45 gene under a heterologous promoter [Cigan, et al., 2005]. An alternative approach would be to use an inducible promoter to drive the expression of the silencing construct. This approach has been exploited previously to control the expression of a cytotoxic gene used for creating male sterility in maize [Greenland, et al.,1998], allowing induction of male sterility only when required, with no need for ‘restorer’ lines.

2.7 RNAi AND GENE THERAPY

The most obvious clinical uses of RNAi are for diseases in which selective depletion of one or few specific proteins would be expected to slow or halt the disease process in the affected cell. In cancer there are two general abnormalities they exhibit disregulation of the

cell cycle resulting in uncontrolled growth and resistant to death as a result of abnormalities in one or more proteins that mediate apoptosis (Nam and Parang, 2003). The goal of RNAi approaches for cancer therapy are therefore to knock out the expression of the cell cycle gene or an anti apoptic gene.

The other most promising application of RNAi in the treatment of infectious disease. Pathogens of major importance around the globe, which has been targeted, are HIV, influenza, herpes virus, hepatitis virus B and C, polio and west Nile virus. Cardiovascular disease is a leading cause of death worldwide. It may be possible to use RNAi technologies to intervene in the process of arterioscleroses is up regulation of cell adhesion molecules in vascular cells, which plays an essential role in recruitment of macrophage to the site of damage. The production of cell adhesion molecules can be suppressed in culture cells (Jarad et al., 2002) thus providing a promising approach to overcome this disease. The siRNA directed against specific respiratory disease (RSV) mRNA has resulted in 30-50 times decrease in the level of mRNA (Bilko and Barik, 2001).

Unlike classical antisense technology, ds RNA act as a powerful gene silencer, which influences their therapeutic potential. As an ideal therapeutics, RNAi, acts selectively in long term and systematically modulate gene target at a distance from inoculated area. A major constraint in its use is still its delivery problem. The improvement of in-vivo nucleic acid delivery technologies is the most important obstacle to overcome by the scientists in future.

2.8 CONSTRAINTS OF RNAi

The specificity of RNAi is determined by the sequence similarity of the target gene with siRNA generated by silencing constructs. A possible limitation of the technology is the off-target effects of siRNA that might silence nontarget genes [Malik, et al., 2006]. Transcript profiling has been widely used in plant research and yet no off-target effects of RNAi in plants have been reported. Indeed, a system that was developed to identify possible off-target effects in plants found no off-target effects when used to investigate the silencing of salicylic acid-binding protein 2 (SABP2) gene [Kumar, et al.,2006]. Most of the reports of off-target effects of siRNA are of translational repression of non-target genes resulting from partial homology of siRNA to the 30 un-translated regions of genes in animals [Lin, et al., 2005; Birmingham, et al., 2006]. A possible reason for the absence of such effects in plants is that miRNA in plants cause silencing because of their homology with coding sequences that result in cleavage of mRNA [Bartel, 2004]. The development of RNAi-based therapeutics for clinical applications will require improvements to be made in siRNA stability and delivery in vivo, while minimizing off-target and non-specific effects. Several approaches have been used to avoid off-target effects, including chemical modification of 20-O-methyl ribosyl at position 2 in the guide strand, which reduces the silencing of most off-target transcripts [Jackson, et al., 2006]. Recent results show that these modified siRNAs are compatible with intracellular siRNA machinery and are useful for reducing undesirable, sequence-related off-target effects [Elmen, et al., 2005]. However, the use of synthetic siRNAs in plants is still limited to experimental applications and is not useful in the hp strategy, which is widely used in plants for generating siRNAs. Nevertheless, the possibility of off-target effects in plants cannot be ruled out and therefore needs careful attention. Caution is warranted in interpreting gene function and phenotype information resulting from RNAi experiments. RNAi data should be validated using the theoretical and practical tools available to predict and identify the potential off-target effects of siRNAs in plants.

2.9 DESIGNING CONSTRUCTS FOR PTGS

Double strand RNA (dsRNA) has been shown to be an effective trigger of gene silencing in vertebrate, invertebrates and plant systems (Waterhouse et al., 2001). Using an intron as a spacer fragment in the gene constructs to create an inverted repeat of a gene leading to the production of hpRNA increases the frequency of silencing (Wesley et al., 2001; Smith et al., 2000). The silenced plants produced with a particular construct tend to have differing degrees of silencing ranging from 75 to 100% silencing of the target gene. The hpRNA constructs are efficiently used to get silenced plants for every gene that is targeted, irrespective of whether a viral gene, transgene or endogene (Wesley et al., 2001). With ihp constructs, the efficiency averaged about 90%, and an arm of 400-800 nt appeared to be

stable and effective. These results suggest that ihp constructs will be effective in a wide range of circumstances.

The construct producing dsRNA of tomato ACC oxidase, containing DNA fragment with 1002 bp with seven nucleotide long synthesized linker fragments showed highest silencing effect than other linkers, indicating that short linker was more efficient in PTGS (Xiong et al., 2005). To study the effectiveness of gene silencing, Wagner et al. (2005) tried different constructs carrying cinnamyl alcohol dehydrogenase (CAD) gene. Quantitative CAD measurement demonstrated that the construct containing an inverted-repeat of the CAD cDNA was most efficient in triggering gene silencing in Pinus radiata.

A major limitation to using hpRNA mediated silencing for high throughput applications is the number of cloning steps needed to produce hpRNA constructs. A high throughput cloning system to generate hpRNA constructs were developed by Helliwell et al. (2002) based on Cre/lox recombination system. In a high throughput application, it is desirable to have the highest possible efficiency of usable clones to reduce the number of bacterial colonies that need to be screened following recombination. These constructs were efficiently used to target two Arabidopsis genes, FLC (flowering locus C) and PDS (Phytoene desaturase). Silencing of PDS gave a range of phenotypes from bleaching of cotyledons to complete bleaching of plant (Helliwell et al., 2002). The replacement of gene fragments by promoter-derived sequences further increased the extent of gene silencing, indicating that non-transcribed genomic region may be more efficient gene silencing element than gene transcripts (Yan et al., 2006).

The choice of gene fragment plays a crucial role in target specific gene silencing. The gene fragments ranging from 50bp to 1000bp were used to successfully silence genes (Helliwell et al., 2002). Two factors can influence the choice of length of the fragment, shorter the fragment the less effective silencing will be achieved, but very long hp increases the chance of recombination. The effectiveness of silencing also appears to be gene dependent and could reflect accessibility of target mRNA or the relative abundance of the target mRNA. Hence, fragment length of between 400 and 800bp as a suitable size to maximize the efficiency of silencing.

3 MATERIAL AND METHODS The present study was undertaken to clone partial δ-cadinene gene from Gossypium

hirsutum (Sahana genotype). While the development of the PTGS was taken up at the Institute of Agri-biotechology, the transformation was done at ARS, Hebballi, UAS, Dharwad. The material and methods followed for conducting these experiments are presented below

3.1 MATERIAL USED

Developing cotton ovules 45 days after post anthesis were collected from cotton fields in the A.R.S., Dharwad, Karnataka.

3.1.1 RNA isolation

The total RNA was extracted from cotton ovules using Eppendorf Perfect RNATM

, Eukaryotic Mini RNA Isolation kit. Diethylpyrocarbonate (DEPC) 0.1 percent, beta merceptoethanol (14.3M), and absolute ethanol (96-100 per cent) were from Himedia. All the solutions and glassware were treated with 0.1 percent DEPC water.

The total RNA was isolated from infected and non-infected leaves of groundnut using Eppendorf Perfect RNA

TM, Eukaryotic Mini RNA Isolation kit. Accordingly, three ovules devoid

of fibres (≈500 mg) was ground in liquid nitrogen and about 100 mg of the ground material was taken in a tube containing 350µl lysis solution and homogenized. The homogenized sample was transferred to a 1.5 ml microcentifuge tube and spun at 15,700 rcf for five minutes. The supernatant was transferred to a fresh 1.5 ml tube, to which 350 µl of 70 per cent ethanol was added and mixed by gentle inversions. To this mix, 200 µl of Perfect Binding Matrix Solution was added and mixed gently, the lysate/ Binding Matrix mixture was pepited into a Perfect RNA Binding Matrix Spin Column and centrifuged at 15,700 rcf for 30 seconds. Two successive washes with 700µl wash solution 1 and 500µl wash solution 2 were given by centrifugation for 30 seconds at 15,700 rcf, before eluting RNA from the column with RNase free water. About 50µl of RNA preparation was collected and stored at -20

0C.

3.1.2 Gel electrophoresis (1.2 percent agarose gel)

Agarose (0.48g) was added to 40ml MOPS buffer and melted in micro oven. After cooling, 720µl of 37 percent formaldehyde and 2.5µl of ethidium bromide from 10X stock were added and poured into electrophoresis tray for solidification (Appendix I).

3.1.3 Sample preparation for RNA loading

One volume of 5X loading dye was mixed with 4 volumes of isolated RNA sample, and incubated at 65°C for 5minutes. The electrophoresis unit with tank buffer was run at 45V for 30 minutes prior to loading. Electrophoresis was continued after loading chilled samples at 50V for 5 minutes. The RNA bands in the gel were visualised on a UV-transilluminator and documented using a gel documentation system (Herolab).

3.1.4 Reverse transcription

cMaster RTplus PCR System and cMaster RT Kit (Eppendorf) were used for cDNA synthesis. 4µl of total RNA was taken in a sterile 0.5ml microcentrifuge tube. 3µl RNase-free water, 1µl Oligo (dT) primer (10mM) and 2µl dNTPs (10mM) were added to it. The contents in the tube were spun briefly and incubated at 65°C in a thermal cycler for 5 min. It was later cooled on ice for 2 minutes and 5µl RNase-free water, 4µl RTplusPCR Buffer, 1µl cMaster RT Enzyme were added, and gently vortexed, briefly centrifuged, and incubated at 42°C for 1.5 hours in a thermal cycler. The reaction was stopped by heating the sample at 85°C for 5 minutes. The cDNA obtained was stored at -20°C.

3.2 AMPLIFICATION OF PARTIAL δ -CADINENE GENE

3.2.1 Primers specific for the partial δ-cadinene gene

All the nine δ-cadinene synthase genes (cds) were downloaded from NCBI database and multialigned using CLUSTALX. 600bp conserved sequence was identified. The specific primers for amplifying ≈ 600 bp partial δ-cadinene gene of Gossypium hirsutum were designed, using the Gene Tool software. The primer sequences are;

Primers for δ-cadinene gene (sense) with XhoI and ApaI sites

CADXF 5’ CTCGAGATGCCGAGAACGACCTCTACA 3’

CADAR 5’ GGGCCCACTTTTGTCAACATCTTTCTACCA 3’

Primers for δ-cadinene gene (antisense) with BamHI and KpnI sites

CADBF 5’ GGATCC ATGCCGAGAACGACCTCTACA 3’

CADKR 5’ GGTACC ACTTTTGTCAACATCTTTCTACCA 3’

3.2.2 Standardization of primer concentration

Primer concentrations viz., 1 pM, 2.5 pM, 5 pM and 10 pM were used to optimize amplification. Based on the results, 5 pM of cad primers, which gave single intense amplicon, were used for large scale amplification.

3.2.3 Standardization of temperature

Temperature was standardized by setting gradient PCR. A bright intense amplicon was observed at 50°C.

3.2.4 Reaction mix

The master mix required was prepared from components obtained from Bangalore Genei, Bangalore and Eppendorf. About 20µl PCR reaction mix was distributed into 0.2ml PCR tubes.

Components Concentration per µl µl per reaction

Template DNA 100 ng 1.0

Primers 5 pM each 1 each

Taq DNA Polymerase 3U 0.33

Assay Buffer 10X 2.0

dNTPs 1mM each 2.0

MgCl2 25 mM 0.5

H20 12.2

3.2.5 PCR amplification

The following PCR amplification conditions were employed for amplification of partial δ-cadinene gene.

Stage Step Temperature (°C) Duration (min) No. of cycles

I Initial denaturation 94 5 1

II Denaturation 94 1

Annealing 50 1

Extension 72 1

39

III Final extension 72 20 1

Hold 4 - -

3.2.6 Electrophoresis

About 20 µl of the reaction mixture from each tube mixed with 3 µl of loading dye and were loaded onto 1 per cent agarose gel along side 100bp DNA ladder as molecular weight marker. Electrophoresis was done at 50 V for initial 30 min and then 70 V for 1 hr. The buffer used was 1x TAE (Appendix II) at pH=8.0. The DNA bands in the gel were visualised on a UV-transilluminator and documented using a gel documentation system (Herolab).

3.3 PCR BASED CLONING

Cloning of the partial δ-cadinene gene with both sets of primers was done by using InstT/A cloning kit (MBI, Fermantas) following the procedure recommended.

3.3.1 Gel elution of PCR fragment

The specific amplicon of about 600bp was amplified by giving 45 minutes of final extension in PCR reaction (as per user’s manual) and run on a 1% agarose gel. Specific PCR amplicon was cut using a sharp sterile scalpel by keeping the gel at low intensity UV transilluminator and collected in sterile pre-weighed 2.0ml microcentrifuge tubes. The eppendorf gel cleanup kit was used to elute the amplicons from the agarose block as described in user’s manual.

3.3.2 Cloning of PCR product

The purified PCR fragment of about 600bp was separately ligated to pTZ57R/T cloning vector (2886 bp) as described in InsT/A clone

TM PCR product cloning kit (K1214) MBI,

Fermentas, USA (Fig. 2).

3.3.2.1 Ligation

For ligation, an optimal molar ratio of cloning vector and insert (1:3) (Appendix III) was computed and the components of ligation mix were added to 0.5 ml micro centrifuge tubes. Ligation mix was incubated at 16°C for 16 hr. (Appendix IV).

Components δ-cadinene antisense δ-cadinene sense

Plasmid vector pTZ57R/T DNA (0.165 µg, 0.18 pmol ends)

3.0 µl 3.0 µl

Purified PCR fragment (Approx. 0.54 pmol ends)

9.0 µl 9.0 µl

10x ligation buffer 3.0 µl 3.0 µl

PEG 4000 solution 3.0 µl 3.0 µl

Deionized water 16.0 µl 16.0 µl

T4 DNA ligase, 5U 1.0 µl 1.0 µl

Total 35 µl 35 µl

3.3.2.2 Preparation of competent cells

E. coli DH5α transformation competent cells were prepared by following the protocol mentioned in Sambrook and Russell (2001) with minor modifications under aseptic and

refrigerated condition. An isolated colony from E. coli DH5 α plate was inoculated in 5 ml Luria broth (Appendix V) and incubated at 37°C overnight at 200 rpm containing Nalidixic acid (10mg/ml). Next day, the culture was diluted to 1:100 using Luria broth i.e., 0.5 ml of culture was added to 50 ml of Luria broth. It was incubated for 2 to 3 hours till an OD of 0.3 to 0.4 at 600 nm was attained. The culture was chilled in ice for 30 min and 25 ml of culture was dispensed into two sterile centrifuge tubes. The cells were pelleted at 6000 rpm for 5 min at 4

0C, the supernatant was discarded and the pellet was suspended in 12.5 ml ice-cold 0.1 M

CaCl2. The centrifuge tubes were again kept in ice for 30 min and later centrifuged at 5000

rpm for 5 min, the pellet dispensed in 1 ml of ice-cold 0.1 M CaCl2 and to this 88 µl of dimethyl sulfoxide (DMSO) was added. About 100 µl of the competent cells were distributed to pre-chilled 1.5 ml micro centrifuge tubes and stored at –20

0C.

Ref: www.fermentas.com Ref: www.fermentas.com

Fig. 2: Vector map of pTZ57R/T

3.3.2.3 Transformation into E. coli DH5 αααα

About 100 µl of competent cells and 10µl of ligation mixture were taken in a chilled microcentrifuge, mixed gently, and chilled on ice for 30 min. Heat shock was given by shifting the chilled mixture to 42°C water bath for exactly 2 min, followed by chilling in ice for 5

minutes. To this 900 µl of Luria broth (Appendix V) was added and incubated at 37°C at 200 rpm for 45 minutes to allow bacteria to recover and express the antibiotic marker encoded by the plasmid. The cells were pelleted at 13,000 rpm for 1 min. The pellet was dissolved in the

remaining 100µl of supernatant after discarding 900µl of supernatant. The dissolved pellet was spread on Luria agar plates having Amp50, X-gal, and IPTG, and incubated for 10-12 hours at 37°C.

The recombinant clones were identified by blue/white assay. The white colonies having recombinant were picked up and streaked on plates having Luria agar with Amp100, X-gal, IPTG and reincubated at 37°C overnight, for multiplication.

3.3.3 Confirmation of clones

The confirmation for the presence of desired DNA fragment in cloning vector was done by PCR amplification uing specific primers and by restriction analysis.

For PCR confirmation of clones, the template DNA from plasmids was isolated following the alkaline lysis protocol of Brimbion and Dolly (1979). White colonies were inoculated to 10 ml Luria broth with ampicillin (100µg/ml) overnight at 37°C over shaker at 175 rpm. Overnight grown culture was centrifuged at 5000 rpm for 2 min at 4°C in 2.0 ml microcentrifuge tubes. The supernatant was removed and pellet was washed with STET (Appendix VI) (0.25 volume of original culture). It was centrifuged at 5000 rpm for 2 min. The

pellet was resuspended in 200 µl of ice-cold alkaline lysis solution I (Appendix VI). by

vigorous vortexing. Later, 400 µl of freshly prepared alkaline lysis solution II (Appendix VI) was added to each tube and the contents were mixed by inverting the tubes 4 to 5 times and

kept in ice for about 5 min. To this suspension, 300 µl of alkaline lysis solution III (Appendix VI) was added and again mixed thoroughly by gently inverting the tubes 4-5 times. The tubes were stored on ice for 5 minutes and centrifuged at 13,000 for 8 min. The supernatant was transferred to fresh tubes and equal volume of phenol: chloroform isoamyl alcohol (25:24:1) was added to precipitate proteins and was mixed well. It was centrifuged at 13,000 rpm for 10 min at 4°C. The aqueous layer was transferred to a fresh tube and two volumes of isopropanol was added. The contents were mixed and allowed to stand for 2 minutes at room temperature. The solution was later centrifuged at 13,000 rpm for 5 min. The supernatant was discarded and pellet was washed with 70 per cent ethanol and spun for 1 min at 13,000 rpm to recover the plasmid. The supernatant was discarded, pellet dried completely and

dispended in 25 µl of T10E1 (pH=8.0) containing 3 µl of RNase A (10 mg/ml). The solution was kept at 50°C for 15 min and then stored at -20°C. The plasmid DNA was visualized on 0.8 per cent agarose gel as described, using 100 bp DNA molecular marker.

Confirmation of the presence of cloned fragment was done by PCR amplification of clones with respective primers. The cDNA and cloning vector were used as positive and negative controls, respectively. The confirmation was also done through restriction analysis of selected clones and the control vector for the presence of insert with KpnI and BamHI.

3.3.4 Sequencing of clones

The partial δ-cadinene amplicon cloned in pTZ57R/T was sequenced using M13F/R primers, at Bangalore Genei Private Ltd., Bangalore. The sequences were subjected to analysis using BLAST algorithm available at http://www.ncbi.nim.nih.gov.

3.4 CLONING INTO GENERIC ihp VECTOR

The generic ihp vector is derived from pRT100, a cloning vector carrying plant expression T-DNA cassette. The generic ihp vector has a functional catalase (CAT) intron from castor, downstream to CaMV 35S promoter. The presence of multiple cloning sites on either side of the introns helps in cloning inserts directionally.

3.4.1 Isolation of generic ihp vector

For cloning of partial δ-cadinene gene into generic ihp vector (Source: Dr. Dineshkumar, DOR, Hyderabad), the Vector DNA was isolated using the alkaline lysis protocol of Brimbion and Dolly (1979) with certain modifications as described earlier at section 3.3.3. Plasmids DNA were quantified by agarose gel electrophoresis as described earlier at section 3.2.6.

3.4.1.1 Preparation of generic ihp vector and inserts for antisense cloning

Sequential digestion of generic ihp vector was done separately with two restriction enzymes Kpn I and BamHI (Appendix VII) for cloning in antisense orientation. The linearized vector was eluted and was extracted using eppendorf gel cleanup kit as per the protocol given in user’s manual.

For cloning partial δ-cadinene gene in antisense orientation, PCR amplification was done with respective gene specific primers having Kpn I and BamHI restriction sites in forward and reverse primers respectively, to help antisense cloning.

The specific amplicon from above PCR reactions was digested with Kpn I and BamHI restriction enzymes and purified using eppendorf PCR purification kit as per user’s manual and quantified using standard DNA markers.

3.4.1.2 Preparation of generic ihp vector and inserts for both sense and antisense cloning to get ihp insert

The recombinant ihp plasmid clones having antisense insert of partial δ-cadinene gene was digested separately with two restriction enzymes ApaI and XhoI (Appendix VIII) for cloning in sense orientation. The linearized vector was eluted and extracted using eppendorf gel cleanup kit as per the protocol given in user’s manual.

For cloning partial δ-cadinene gene in sense orientation, recombinant ihp vector containing antisense insert was taken. PCR amplification was done with respective gene specific primers having ApaI and XhoI restriction sites in forward and reverse primer respectively, to help sense cloning.

The specific amplicon from above PCR reactions was digested with ApaI and XhoI and purified using eppendorf PCR purification kit as per user’s manual and quantified using standard DNA markers.

3.4.2 Ligation and transformation

The ligation reaction, preparation of competent cells, transformation of E. coli DH5α and confirmation of clones were done as described earlier in 3.3.3. The ligation mixture composition is as follows

Components Sense Sense+ Antisense

Generic ihp vector 2 µl 2 µl

Insert 4 µl 4 µl

T4 DNA ligase (5U) 2 µl 2 µl

T4 ligase buffer (10X) 2 µl 2 µl

Deionised water 10 µl 10 µl

Total 20 µl 20 µl

3.5 SUBCLONING INTO PLANT TRANSFORMATION VECTOR pCAMBIA1305.1

3.5.1 Isolation of pCAMBIA vector

For cloning of the entire expression cassette containing partial δ-cadinene gene (in both sense and antisense orientation) into pCAMBIA vector, the plasmid was isolated as

described earlier at section 3.3.3. Plasmids DNA were quantified by agarose gel electrophoresis as described earlier at sectin 3.2.6.

3.5.2 Preparation of pCAMBIA 1305.1 vector and inserts for cloning

Plant expression vector pCAMBIA1305.1 is a promoterless vector used for cloning inserts along with regulatory elements for expression studies. It was digested with PstI restriction enzyme (Appendix IX) for cloning entire expression cassette with insert. The linearized vector was eluted and extracted using eppendorf gel cleanup kit as per the protocol given in user’s manual.

For cloning entire expression cassette of ihp, (sense and antisense) recombinant plasmid was digested with PstI and the released expression cassette was gel eluted and purified using Eppendorf gel cleanup kit, as per user’s manual and quantified using standard DNA marker.

3.5.3 Ligation and transformation

The ligation reaction, preparation of competent cells, transformation of E. coli DH5α and confirmation of clones were done as described earlier in 3.3.3. Initially recombinants were selected based on blue/white assay. The ligation mixture composition was as follows,

Components ihp Sense+antisense

p CAMBIA 2 µl

Insert 4 µl

T4 DNA ligase (5U) 2 µl

T4 ligase buffer (10X) 2 µl

Deionised water 10 µl

Total 20 µl

3.6 MOBILIZING RECOMBINANT CLONES INTO Agrobacterium LBA4404

The confirmed clones were further mobilized into Agrobactrium tumefaciens LBA4404 by triparental mating. The vector, pCAMBIA1305.1 is capable of replicating in both E. coli as well a Agrobacterium and have genes for hygromycin resistance in its T-DNA and is used as selectable marker in plants. The strain has chromosomal selection rifampicillin (25µg/ml) and disarmed Ti-plasmid pAL4404, having gene for streptomycin resistance (100µg/ml) as selectable marker. E. coli strain containing pRK2013 vector with gene for kanamycin resistance was used as a helper for mobilizing the recombinant vector into A. tumefaciens LBA4404.

E. coli DH5α cells having recombinant plant transformation vector pCAMBIA1305.1 were grown overnight in Luria broth containing 50 µg/ml of kanamycin at 37

0C. The A.

tumefaciens LBA4404 was grown for 16-20 hours at 280C in Yeast Extract Mannitol Agar

(Appendix X) containing Rifampicillin (25µg/ml) and Streptomycin (100µg/ml). The E. coli DH5α pRK2013 strain was grown overnight in LB containing kanamycin (50µg/ml).

The overnight grown cultures were centrifuged at 13000 rpm for 1 min. The supernatant was discarded and the pellet was washed with 0.01 MgSO4 for 2-3 times to remove traces of antibiotics. It was again centrifuged at 13,000 rpm for 1 min and pellet was dispensed in 50 µl of 0.01 M MgSO4. A. tumefaciens LBA4404, E. coli DH5α (pRK2013) and E. coli containing pRK was mixed in 1:2:2 ratios separately. The mixture was spotted on plain LA medium and incubated overnight at 28

0C. The spotted culture was scraped and dissolved

in 200 µl of 0.01 M MgSO4 and spotted on YEMA medium containing streptomycin (100µg/ml). Rifampicillin (25µg/ml) and kanamycin (50µg/ml) along with A. tumefaciens LBA4404, E. coli helper strain and E. coli with recombinant vector as negative control.

The presence of recombinant plasmid in the Agrobacterium was confirmed by PCR amplification.

3.7 TRANSGENIC COTTON DEVELOPMENT

Agrobacterium containing construct pCAMBIA with δ-cadinene synthase (sense, antisense/ihp) was used for transformation of cotton (Genotype – Sahana, Gossypium hisrsutum).

For development of transgenic cotton, the transformation protocol developed by Katageri et al., 2007 was followed to generate T0 plants.

Seeds were delinted with sulphuric acid and soaked in HgCl2 (50 mg/l) for 30 min and kept for shaking (50 rpm) on a rotary shaker. Seeds were rinsed three times with sterile double-distilled water and germinated at 28°C in the dark for 3 days and later shifted to light and dark (16/8 h) rotation to obtain healthy seedlings. Seedlings (7–8-day-old) grown aseptically on MS (Appendix XI) medium, were used for isolation of shoot apex.

Agrobacterium tumefaciens (LBA4404) harbouring a binary vector (pCAMBIA) was grown overnight at 28°C. The binary vector carries a PTGS construct with δ-cadinene sense and antisense genes driven by CaMV 35S promoter. Healthy shoot apices were bisected from apex to base producing two asymmetrical halves. Both the halves were inoculated with A. tumefaciens diluted (1: 20) in virulence induction medium (MS medium containing 2.0% glucose, octopine 100 mg/l and 100 mM acetosyringone) followed by vacuum infiltration for 5 min. The explants were incubated on co-cultivation medium (MS medium containing 2 mg/l of benzyl adenine) for 3 days at 22°C. After 3 days of co-cultivation, shoots were transferred to shoot growth medium (MS medium containing 100 mg/l myo-inositol, 0.5 mg/l thiamine HCl, 0.5 mg/l nicotinic acid, 0.5 mg/l pyridoxine HCL and 2% sucrose at pH 5.7) and incubated in diffuse light at 26 ± 2°C for a 60 days. Further analyses of the plants were carried out.

3.8 TRANSGENE EXPRESSION ANALYSIS

3.8.1 DNA isolation

The total DNA from cotton leaf sample was isolated by following CTAB protocol (Sambrook et al., 1989) with some modifications. Two grams of leaf sample was ground in liquid nitrogen to a fine powder and transferred quickly to 50ml centrifuge tube containing 10 ml of pre-warmed extraction buffer (0.1 M Tris base, 0.05 M EDTA, 0.1 M NaCl, 2% CTAB, 0.1% mercaptoethanol, 0.1% PVP) (Appendix XIII) was immediately added to 50 ml centrifuge tubes and kept in 65°C water bath for 10-15 min with intermittent mixing. After cooling to room temperature, equal volumes of chloroform: isoamylalcohol (24:1) was added and mixed by inverting. It was centrifuged at 10,000 rpm for 10 min at 4°C. The supernatant was carefully taken into fresh tube and equal volume of chilled isopropanol was added and gently mixed. It was kept at –20°C for 2 hrs and then the DNA was pelleted at 15,000 rpm for

10 min. The pellet was washed with 70 per cent ethyl alcohol, air dried, dissolved in 500 µl of

T10E1 with 5µl of RNase (10 mg/ml) and incubated at 37°C for 1 hr. The DNA was further purified by adding equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) and centrifuged at 10,000 rpm for 10 min at 4°C. The aqueous phase was collected and equal volume of chloroform: isoamyl alcohol (24:1) was added and again centrifuged at 15,000 rpm for 10 min at 4°C. To the supernatant 1/10

th volume of 3M sodium acetate and twice the

volume of chilled ethanol were added, left for 30 min at room temperature and then centrifuged. After discarding the supernatant, the pellet was washed with 70 per cent alcohol,

air-dried and dissolved in 100 µl of T10E1. The total DNA isolated was quantified by spectrophotometeric method as given by Sambrook and Russel (2001).

3.8.2 PCR analysis

Genomic DNA isolated from putative transgenic lines was tested for the presence of

insert. PCR was performed using hptII specific primers in a 20 µl PCR reaction containing 1U of Taq DNA polymerase, 2mM dNTP mix, 5 pmoles of each primer, 1x Taq assay buffer. For PCR standard protocol was followed except the annealing temperature (55

0 C

for 1 min).

Vector DNA and non-transgenic plant DNA were used as positive and negative control, respectively. The following primer combination was used for hptII amplification; Forwad-5'

CGACCTGATGCAGCTCTCGGAGGGC3';reverse-5'CGATTGCGTCGCAT ACCCTGCGC3'. Amplicon was visualized by running on 1% agarose gels.

3.8.3 Counting of Gossypol Glands

Gossypol glands of ten control and transgenic plants were observed in leaves, under stereoscopic microscope at 2X magnification.

3.8.4 Estimation of Gossypol

About 150 mg leaf sample of transgenic and 10 control plants were ground to a fine powder by using mortar and pestle, and plunged in 95%ethyl alcohol of 10-12ml for 5min. Extract was collected by filtering through whatman filter paper no.1.It was again repeated with the residue and the extracts were combined. Extract was diluted with 40% ethanol and the pH of the extract was adjusted with 1N HCL to pH 3.0. Contents were mixed with 1.5 volume of diethyl ether at 10°C using a separating funnel. The ether phase was saved and washed with 2 changes of distilled water. Ether extract was evaporated in vacuum to dryness. The residue was redissolved in a 5ml volume of 95% ethanol. 200µl of aliquot of the gossypol extract in ethanol is taken into test tubes, and 0.5ml of phloroglucinol reagent followed by 1ml of conc.HCL to each tube was added, and incubate for 30min with occasional shaking at room temperature.The volume of the solution was made to 10ml with 80%ethanol. (Appendix XIII) Absorbance of colour was recorded at 550nm against a reagent blank.

4 EXPERIMENTAL RESULTS The primary aim of this investigation was to develop post-transcriptional gene silencing constructs (PTGS) of δ-cadinene synthase genes to prevent the expression of gossypol in cotton. The result of various experiments done is presented below.

Total RNA was isolated from developing cotton ovules of 45 days after post anthesis, by using eukaryotic mini RNA isolation kit Eppendorf and cDNA was synthesized using cMaster RT-KIT Eppendorf which was later used as template for further amplification.

4.1 PCR AMPLIFICATION OF δ-CADINENE GENE FROM COTTON

The PCR was carried out using gene specific primers against δ-cadinene cDNA, obtained from total RNA isolated (Plate 1) from developing cotton ovules of 45 days after post anthesis. The amplifications were standardized with the help of gradient PCR (Plate 1) and the specific amplicon (600bp) obtained from both sense and antisense primers were separated on 1.0 per cent agarose gel (Plate 1).

The 600 bp amplicon of δ-cadinene genes was eluted from preparative gels.

pTZ57R/T was used as cloning vector for cloning the amplified fragments. E. coli DH5α was

transformed separately with molecules using 10 µl of ligation mixture. Super coiled plasmid DNA of pTZ57R was used as positive control. The transformation efficacy was found to be 0.45 x 10

4 CFU/µg of the recombinant molecules.

The transformed cells that appeared white on Luria agar containing ampicillin (100

ppm), X-gal (32 ppm) and isopropyl β-D-thiogalactoside (IPTG; 38.4 ppm) were isolated and confirmed through PCR amplification for the presence of antisense and sense inserts with gene specific primers respectively (Plate 2). The clones amplified for respective inserts were further confirmed through restriction analysis using KpnI and BamHI for antisense construct and with ApaI and XhoI restriction enzymes for sense construct, which released 600 bp (Plate 2). The recombinant clones were named as pGhCADI and pGhCADII (Fig. 3).

4.2 PCR BASED CLONING AND SEQUENCE ANALYSIS

The partial δ-cadinene gene cloned in pTZ57R/T was sequenced using M13F/R primers at Bangalore Genei Pvt Ltd, Bangalore. The complete nucleotide and deduced amino acid sequences are presented in the (Fig. 4), respectively. These sequences were subjected to homology search analysis using BLASTn and BLASTp algorithms available at http:// www.ncbi.nlm.nih.gov. The homology search revealed that partial 600bp δ-cadinene gene showed maximum homology of 99.8% with Gossypium arboretum (U23205),and 98.8%homology with Gossypium hirsutum(AF270425)(Table 4) (Fig.5).

The sequences were subjected to further analysis in BTI software of GeneTool for finding restriction sites and the sequences did not have any internal restriction sites for BamH1, Kpn I, Apa I and Xho I and Pst I (Fig. 6).

4.3 CLONING INTO GENERIC ihp VECTOR

The generic ihp vector isolated in large quantities was restricted with XhoI and ApaI to facilitae directional cloning of sense fragment, and KpnI and BamHI to facilitate directional cloning of antisense fragment.

To clone δ-cadinene gene in antisense orientation, specific primers having restriction sites KpnI and BamHI were used to amplify the gene. The linearized vector was ligated

separately with amplicon at 1:3 molar concentrations and, transformed into E. coli DH5α. The

transformants were picked and streaked on Luria agar containing kanamycin (50 µg/ml). Plasmid DNA isolated from these clones was confirmed through PCR (Plate 3) and restriction analysis (Plate 3) using KpnI and BamHI enzymes, separately and named as pGhCADIII.

To clone δ-cadinene gene in sense orientation, specific primers having restriction sites XhoI and ApaI was used to amplify the gene. The linearized vector was ligated

separately with amplicon at 1:3 molar concentrations, and transformed into E. coli DH5α. The

transformants were picked and streaked on Luria agar containing kanamycin (50 µg/ml).

Plasmid DNA isolated from these clones were confirmed through PCR (plate 3) and restriction analysis (plate 3) using XhoI+ApaI enzymes. The clones were named as pGhCADIV.

The construct map of ihp vector containing sense and antisense inserts were represented in fig 7.

4.4 CLONING INTO PLANT TRANSFORMATION VECTOR pCAMBIA1305.1

The recombinant plasmid DNA and plant transformation vector pCAMBIA1305.1 (fig. 8) were isolated in large quantities and restricted with PstI to release entire expression cassette from pGhCADIV.

The linearized vector was ligated with expression cassette at 1:3 molar

concentrations and transformed into E. coli DH5α. The transformed cells were picked up and

streaked on Luria agar containing kanamycin (50 ppm), X-gal (32 ppm) and isopropyl β-D-thiogalactoside (IPTG) (38.4 ppm). White colonies were selected as the clones containing recombinant molecules. Plasmid DNA isolated from these recombinant clones was confirmed through PCR (Plate 4) and restriction (Plate 4) analysis using PstI enzyme. The clones were named as pGhCADV. The construct map of pGhCADV is represented in fig 9.

4.5 MOBILIZING RECOMBINANT CLONES INTO Agrobacterium

The confirmed pGhCADIV clones were mobilized into Agrobacterium tumefaciens LBA4404, via tri-parental mating using E. coli carrying pRK2013 as a helper plasmid. The trans-conjugants were picked on yeast extract mannitol agar (YEMA) medium containing

kanamycin (50 µg/ml), streptomycin (100 µg/ml) and rifampicillin (25 µg/ml). The transformed A. tumefaciens clones were confirmed through PCR amplification (Plate 4) of the plasmids obtained from them.

4.6 TRANSGENIC COTTON DEVELOPMENT

Agrobacterium containing construct pCAMBIA with δ-cadinene synthase (sense+antisense/ihp) was used for transformation of cotton genotype Sahana. (Gossypium hisrsutum).Cotton plant transformation method developed by Katageri et al., 2007 was followed to generate T0 plants. For every 100 transgenic plants 2-5 plants survived (Plate 5).

4.7 PLANT TRANSFORMATION STUDIES

4.7.1 PCR analysis of transformed plants

Screening of the plants were done using hptII primers. positive plant gave an expected PCR amplicon of 800bp (plate 4), but no such amplicon was observed in untransformed (negative control) plants.

4.7.2 Counting of gossypol glands

Gossypol glands of 10 control and transgenic plants were observed in shoots and leaves, under stereoscopic microscope. In control plants 60-100 glands per 1cm

2, and in

transgenic plant only 5 glands per 1cm2 were observed (Plate 6).

4.7.3 Estimation of gossypol

Gossypol content was estimated in 150 mg leaf sample of both control and transgenic plants, 5-8 µg/mg was found in control plants. 0.07 µg/mg was found in transgenic plant. A drastic reduction of gossypol content in transgenic plant was observed compared to control plant.

Plate 1. Total RNA isolation and PCR standerdization of δδδδ-cadinene gene

1a) RNA ISOLATION

1. 100 bp DNA Ladder

2-3 Totla RNA from cotton ovules

1b) PCR TEMPERATURE STANDERDISATION OF δδδδ-CADINENE GENE

1. 100 bp DNA Ladder

2-11 Temperature Gradient from 470C-57

0C

1c) LARGE SCALE AMPLIFICATION OF δδδδ-CADINENE GENE WITH

ANTISENSE PRIMERS

1. 100 bp DNA Ladder

3-5 600 bp Amplification of partial δ-cadinene gene

1d) LARGE SCALE AMPLIFICATION OF δδδδ-CADINENE GENE WITH SENSE

PRIMERS

1. 100 bp DNA Ladder

2-4 600 bp Amplification of partial δ-cadinene gene

Plate 1. Total RNA isolation and PCR standerdization of δ-cadinene gene

Plate 2. PCR and Restriction confimation of pTZR/T clones containing partial δδδδ-cadinene gene

2a) PCR confimation of pTZR/T clones containing partial antisense δδδδ-cadinene gene

1. λ DNA /Hind III digest

2. Positive control cDNA

3. Negetive control

4. 600 bp amplification of partial δ-cadinene gene

2b) Restriction (BamHI and KpnI) confimation of pTZR/T clones containing partial

antisense δδδδ-cadinene gene

1. λ DNA /Hind III digest

2. pGhCADI restricted with BamHI and KpnI

3. Uncut pTZ57R/T vector

2c) PCR confimation of pTZR/T clones containing partial sense δδδδ-cadinene gene

1. Positive control cDNA

2. Negetive control

3. 600 bp amplification of partial δ-cadinene gene

4. λ DNA /Hind III digest

2d) Restriction (ApaI and XhoI) confimation of pTZR/T clones containing partial

sense δδδδ-cadinene gene

1. λ DNA /Hind III digest

2. pGhCADII restricted with ApaI and XhoI

Plate 2. PCR and Restriction confimation of pTZR/T clones containing partial δ-cadinene gene

Fig. 3: Construct maps of pTZ57R/T carrying partial δ-cadinene sense and antisense gene

ATGCCGAGAACGACCTCTACACCACATCCCTTCGATTCCGATTACTCCGAGAGCATGGATTCAATGTTTCATGCGACGTATTCAACAAGTTTAAAGACGAGCAAGGGAATTTCAAGTCATCCGTGACAAGCGATGTTCGAGGATTGTTGGAACTTTACCAAGCTTCCTATTTGAGGGTTCATGGGGAAGATATATTGGATGAAGCAATTTCTTTCACCACCAACCATTTAAGCCTTGCAGTAGCATCTTTGGACTATCCGTTATCCGAAGAGGTTTCACATGCTTTGAAACAATCAATTCGAAGAGGCTTGCCAAGGGTTGAGGCAAGACACTATCTTTCAGTATACCAAGATATTGAGTCCCATAATAAGGTTTTGTTGGAGTTTGCTAAGATCGATTTCAACATGGTACAACTTTTGCATAGGAAAGAGCTAAGTGAGATTTCTAGGTGGTGGAAGGATTTAGACTTTCAAAGAAAGTTGCCATACGCAAGAGATAGA

GTGGTTGAAGGCTATTTTTGATCTCAGGATGTACTTTGAGCCCCAATATTCTCTTGGTAGAAAGATGTTGACAAAAGTGATAGCAATGGCTTCTATTGTAGA

Fig. 4: 600 bp Nucleotide sequence of partial δ-cadinene gene fragment

Table 4. Homology of the 600 bp dCS trigger sequence to various isoforms of δ-cadinene synthase gene from cotton

δ-cadinene synthase gene Homology with the trigger

sequence (%) Plant source Genbank accession no.

Cad1-C14 (XC14) 99.8 G. arboreum U23205

Cdn1-C4 98.8 G. hirsutum AF270425

Cdn1 98.5 G. hirsutum U88318

Cad1-C2 96.4 G. arboreum Y16432

Cad1-C3 96.2 G. arboreum AF174294

Cad1-C1 (XC1) 96.0 G. arboreum U23206

Cad1-B 92.9 G. arboreum X95323

Cdn1-D1 90.9 G. hirsutum AY800107

Cad1-A 80.9 G. arboreum X96429

Accession Description Max

score Total score

Query coverage

E value

Max ident

U23205.1 Gossypium arboreum (+)-delta-cadinene synthase isozyme XC14 mRNA, complete cds

1110 1110 100% 0.0 99%

AF453326.1 Gossypium hirsutum (+)-delta-cadinene synthase mRNA, partial cds

1099 1099 99% 0.0 99%

AF270425.1 Gossypium hirsutum (+)-delta-cadinene synthase (cdn1-C4) mRNA, partial cds

1077 1077 100% 0.0 98%

U88318.1 Gossypium hirsutum (+)-delta-cadinene synthase (cdn1) mRNA, complete cds

1066 1066 100% 0.0 98%

Y16432.1 Gossypium arboreum mRNA for (+)-delta-cadinene synthase

994 994 100% 0.0 96%

U23206.1 Gossypium arboreum (+)-delta-cadinene synthase isozyme XC1 mRNA, complete cds

983 983 100% 0.0 96%

AY800106.1 Gossypium hirsutum (+)-delta-cadinene synthase (cdn1-C5) gene, complete cds

667 1092 100% 0.0 98%

AF174294.1 Gossypium arboreum (+)-delta-cadinene sythase (CAD1-C1) gene, complete cds

617 886 87% 1e-173

96%

AY800007.1 Gossypium hirsutum (+)-delta-cadinene synthase (cdn1-C7) pseudogene, partial sequence

582 705 73% 5e-163

96%

X95323.1 Gossypium arboreum cad1-b gene for (+)-delta-cadinene synthase

579 700 74% 6e-162

95%

AY800008.1 Gossypium hirsutum (+)-delta-cadinene synthase (cdn1-C8) pseudogene, partial sequence

579 792 87% 6e-162

94%

AY800006.1

Gossypium hirsutum (+)-delta-cadinene synthase (cdn1-C6) pseudogene, complete sequence

532 893 98% 5e-148

95%

Accession Description Max

score Total score

Query coverage

E value

Max ident

AY800107.1 Gossypium hirsutum (+)-delta-cadinene synthase (cdn1-D1) gene, complete cds

518 626 73% 1e-143

93%

X96429.1 Gossypium arboreum mRNA for cadinene synthase (cad1-A gene)

484 484 99% 1e-133

81%

U27535.1 Gossypium arboreum (+)-delta-cadinene synthase isozyme A mRNA, complete cds

484 484 99% 1e-133

81%

Y18484.1 Gossypium arboreum cad1-A gene

250 447 86% 6e-63 88%

AF456410.1 Gossypium barbadense (+)-delta-cadinene synthase (cad1-A) gene, partial cds

185 306 60% 2e-43 87%

sp|Q39760|DCS2_GOSAR (+)-delta-cadinene synthase isozyme XC14... 400 2e-110

gb|AAL50780.1| (+)-delta-cadinene synthase [Gossypium hirsutum] 397 2e-109

gb|AAX44033.1| (+)-delta-cadinene synthase [Gossypium hirsutum] 397 2e-109

gb|AAF74977.1|AF270425_1 (+)-delta-cadinene synthase [Gossypi... 397 2e-109

sp|P93665|DCS1_GOSHI (+)-delta-cadinene synthase (D-cadinene ... 395 9e-109

sp|Q39761|DCS1_GOSAR (+)-delta-cadinene synthase isozyme XC1 ... 389 9e-107

sp|O49853|DCS4_GOSAR (+)-delta-cadinene synthase isozyme C2 (... 389 9e-107

gb|AAD51718.1| (+)-delta-cadinene sythase [Gossypium arboreum] 386 6e-106

gb|AAX44034.1| (+)-delta-cadinene synthase [Gossypium hirsutum] 364 2e-99

emb|CAD90835.1| (+)-delta-cadinene synthase [Gossypium arboreum] 354 2e-96

emb|CAA77191.1| (+)-delta-cadinene synthase [Gossypium arboreum] 345 9e-94

sp|Q43714|DCS3_GOSAR (+)-delta-cadinene synthase isozyme A (D... 345 9e-94

Fig. 5: Nucleotide and aminoacid blast result of 600 bp partial δ-cadinene synthase gene

Fig. 6: Restriction map of partial δ-cadinene gene fragment

Plate 3. PCR and Restriction confirmation of ihp clones

3a) PCR confirmation of pGhCADIII clones

1. 100 bp DNA Ladder

2. Positive control cDNA

3. Negetive control (ihp vector with out insert)

4. 600 bp amplification of Partial Antisense δ-cadinene gene

3b) PCR confirmation of pGhCADIV clones

1. λ DNA/ HindIII digest

2. Positive control cDNA

3. Negetive control (ihp vector with out insert)

4. 600 bp amplification of Partial sense δ-cadinene gene

3c) Restriction (BamHI and KpnI) confirmation of pGhCADIII clones

1. λ DNA /EcoRI/Hind III Double digest

2. Positive control cDNA

3. linearized ihp Vector

4. pGhCADIII clone restricted with BamHI and KpnI

3d) Restriction analysis of generic ihp vector carrying sense and antisense inserts

1. λ DNA /EcoRI/Hind III Double digest

2. Positive control (600 bp amplification from cDNA)

3. Linearized ihp vector

4. pGhCADIII restricted with KpnI and BamHI

5. pGhCADIV restricted with ApaI and XhoI

6. pGhCADIII restricted with PstI

7. pGhCADIV restricted with PstI

Plate 3. PCR and Restriction confirmation of ihp clones

A) pRT100 backbone

B: Generic ihp vector

C: Generic ihp vector carrying sense and antisense partial

cad inserts

Fig. 7: Vector back bone maps used to develop PTGS constructs

CA CA

Ref: www.cambia.org

Fig. 8: Vector map of pCAMBIA1305.1

Plate 4. PCR and Restriction analysis of pCAMBIA1305.1 carrying δδδδ-cadinene

synthase gene

4a) PCR confirmation of pGhCADV clones

1. 100 bp DNA Ladder

2. Positive control cDNA

3. Negetive control (pCAMBIA1305.1 vector with out insert)

4-7 600 bp amplification

4b) Restriction (PstI) analysis of pGhCADV clone

1. 1 kb DNA Ladder

2. Linearized pCAMBIB1305.1 vector

3. pGhCADV digested with PstI

4c) PCR amplification of partial δδδδ-cadinene gene from Agrobacterium(LBA4404)

1. 100 bp DNA Ladder

2-5 600 bp amplification

4d) PCR amplification of cotton plant DNA with hptII primers

1. λ DNA /EcoRI/Hind III Double digest

4. 800 bp amplification from transgenic cotton DNA

7. Negetive control (DNA from non transgenic cotton plant)

8. 800 bp amplification from pGhCADV plasmid as positive control

Plate-4. PCR and Restriction analysis of pCAMBIA 1305.1 carrying δ-cadinene synthase

gene

Fig. 9: Map of pCAMBIA1305.1 carrying ihp (sense and antisense) inserts

Plate 5. Transgenic cotton plant cotaining δ-cadinene synthase gene

Plate 6. Gossypol gland counting from transgenic and control plant

5 DISCUSSION

Global cotton seed production can potentially provide the protein requirement for half a billion people per year. However, it is woefully underutilized because of the presence of toxic gossypol within seed glands. Therefore, elimination of gossypol from cottonseed has been a long standing goal of geneticist.

Gossypol besides its presence in roots and foliar tissues of the plant, is dominant terpene aldehyde in the storage glands of cotyledons in the developing mature cottonseed. Gossypol is toxic to non ruminant animals, and so it reduces the commercial value of seed meal used for animal feeds and must be removed from cottonseed oil prior to consumption.

Gossypol engineering may provide another means of generating the trait of gossypol free seed in cultivated cotton species through the disruption of terpenoid biosynthesis especially in seeds. But this will require a greater understanding of the complex set of genes regulating the synthesis of the cotton sesquiterpenes. Silencing of multigene families appears to be more complex than can often be explained by current models of PTGS.

Antisense suppression of delta cadinene genes blocking the cadinene type sesquiterpenes pathway was envisaged as a way to activate the suppression of gossypol synthase in cotton.

Antisense transgene constructs have worked best when multiple copy insertions generate inverted repeats that produce hairpin transcripts that fold into double-stranded RNAs that in turn trigger PTGS (Baulcombe., 1996). Crossing plants in with sense and antisense transgenes can also result in gene silencing through the production of large amount of dsRNA (Jorgensen., 2003 ). Small 21 to 25 mers (siRNAs) generated from cleavage of the dsRNA molecules by DICER proteins then become part of a nuclease containing RNA induced silencing complex that uses these siRNAs to target sequence specific degradation dependant on the presence of near-perfect matches to the siRANs. Antisense suppression, when activated, should therefore target all expressed genes sharing at least one of these siRNA domains (Aigner., 2006). So silencing of all members of multigene families by constructs containing a single family member is highly likely, unless specific conserved domains are selected to generate the initial dsRNA. Therefore in this investigation we have made an attempt to develop PTGS construct to silence all the multigene families of (+) - δ cadinene synthase.

5.1 CONSTRUCTION OF GENE CASSETTE FOR PLANT

TRANFORMATION

Based on the available information of nucleotide sequences of delta cadinene genes,all delta cadinene genes were multialigned and primers were designed to the most conserved region of 600bp. The purified PCR product of 600 bp from transformants were screened through blue/white assay. The white colonies were further analyzed by PCR and the clones were also confirmed by restriction analysis.

In silico analysis of the cloned nucleotide sequence of δ– cadinene synthase revealed maximum of 99.8 per cent homology at nucleotide level and 100 per cent at amino acid level with the published sequence in database. Further restriction sites analysis was done using BTI software GeneTool.

For developing ihp construct delta cadinene genes were cloned into a generic ihp vector. In sense orientation using Apa I and Xho I sites and also in antisense orientation using Kpn I and Bam HI sites. The ligated products were transformed into to E. coli DH5α and the transformants were confirmed by PCR and restriction analysis.

The entire expression cassette was released from generic ihp vector carrying sense and antisense using PstI sites and cloned into pCAMBIA 1305.1 a promoter less plant transformation vector. The ligated products were transferred into E. coli DH5α and transformants so obtained were mobilized into Agrobacterium tumefaciens LBA4404 by triparental mating using E. coli carrying pRK2013 as helper plasmid.

5.2 PLANT TRANSFORMATION STUDIES AND PCR

ANALYSIS

The Agrobacterium tumefaciens containing PTGS construct was used to develop transgenic cotton. Genotype independent genetic transformation protocol developed by Katageri et al., (2007) was followed using Gossypium hirsutum genotype Sahana. For every 100 transgenic plants, only 2-5 plants were survived as the PTGS construct targeted the whole plant. Percentage survival of the transgenic plants can be increased by using seed specific promoter. The transgene integration in plant genome was confirmed through PCR amplification of hptII gene. The presence of single ~800bp amplicon in transformed plants corresponding to positive control indicated the integration of transgene (T-DNA).

5.3 EXPRESSION STUDIES

Gossypol glands of control and transgenic plants were observed in leaves, under stereoscopic microscope. In control plants, 60-100 glands were observed per 1cm

2. In

transgenic however only 5 glands per 1cm2 were observed.

Gossypol content was estimated both in control and transgenic plants. Per 150mg of leaf sample 5-8 µg/mg of gossypol was found in control, and 0.07 µg/mg was found in transgenic plant. Drastic reduction of gossypol in transgenic plant was observed compared to control plant.

FUTURE LINE OF WORK

As the gossypol provides constitutive and inducible protection against pest and diseases, it is advised to use Seed specific promoter for preventing the production of gossypol only in cotton seeds.

6 SUMMARY AND CONCLUSIONS

The discovery of RNA mediated post transcriptional gene silencing has not only opened an unanticipated new window to study regulation of gene expression as well as a highly effective tool for knocking down gene expression in many organisms and cells. PTGS is a specific RNA degradation mechanism of any organism that takes care of aberrant unwanted excess of its own or foreign RNA intracellularly, in a homology dependent manner.

In the present study, an attempt was made to use this phenomenon to develop constructs for post transcriptional gene silencing of δ-cadinene synthase genes, and analyse its expression in transgenic cotton. The out come of this study is summarized below

1. A 600bp DNA fragment was amplified using δ-cad gene specific primer from ovules, 45 days after post anthesis.

2. The amplicon was cloned in PTZ57R/T containing T-overhangs at Eco321 site and transformed into E. coli DH5α. Transformants were selected on the basis of blue white assay. PCR and restriction were done for clonal confirmation. The clone was named as pGhCADI with antisense insert and pGhCADII with sense insert. The analysis of the sequence revealed maximum of 99.8% homology at nucleotide and 100% homology at aminoacid level with reported sequence in the database.

3. The pGhCADI insert was digested with Kpn1 and Bam H1 and subcloned into generic ihp vector in antisense orientation. The clone was named pGhCADIII.

4. The recombinant clone pGhCADII was digested with Apa1 and Xho 1 to facilitate sense cloning to develop hairpin construct and the clone was named pGhCADIV.

5. The expression cassette carrying insert from generic ihp vector was then subcloned into plant transformation vector pCAMBIA 1305.1 to facilitate plant transformation. The clone was named pGhCADV.

6. The recombinant clones of pGhCADV were then mobilized into Agrobacterium tumefaciens LBA4404 by tri parental mating.

7. The agrobacterium LBA4404 carrying recombinant clones were used to develop transgenic cotton and T0 transgenic plants were confirmed through PCR using hptII primers.

8. Gossypol glands were counted both in control and T0 transgenic plants under stereoscopic microscope. Very few glands were observed in transgenic plant compared to control plant.

Gossypol was estimated both in control and transgenic plants. A drastic reduction of gossypol was found in transgenic plant compared to control plant.

7. REFERENCES

Aigner, A., 2006, Gene silencing through RNA interference (RNAi) in vivo: Strategies based on the direct application of siRNAs. Biotechnology, 24:12-25.

Allen, R. S., Millgate, A. G., Chitty, J. A., Thistleton, J., Miller, J. A. C., Fist, A. J., Gerlach, W. L. and Larkin, P. J., 2004, RNAi-mediated replacement of morphine with the nonnarcotic alkaloid reticuline in opium poppy. Nat. Biotechnol, 22: 1559-1566.

Anderson, J., Banerjea, A. and Akkina, R., 2003, Bispecific short hairpin siRNA constructs targeted to CD4, CXCR4, and CCR5 confer HIV-1 resistance. Oligonucleotides, 13:303-312.

Andika, I. B., Kondo, H. and Tamada, T. 2005, Evidence that RNA silencing-mediated resistance to Beet necrotic yellow vein virus is less effective in roots than in leaves. Mol Plant Microbe Interact, 18: 194-204.

Arenz, C. and Schepers, U., 2003, RNA Interference: from an ancient mechanism to a state of the art

therapeutic application?. Naturwissenschaften, 90: 345-359.

Bakhetia, M., Charlton, W., Atkinson, H. J. and McPherson, M. J., 2005, RNA interference of dual oxidase in the plant nematode Meloidogyne incognita. Mol. Plant Microbe Interact. 18: 1099–1106.

Banerjea, A., Li, M.-J., Bauer, G., Remling, L., Lee, N.-S., Rossi, J. and Akkina, R., 2003, Inhibition of HIV-1 by lentiviral vector-transduced siRNAs in T lymphocytes differentiated in SCID-hu mice and CD34+ progenitor cell-derived macrophages. Mol. Ther, 8:62-71.

Bartel, D. P., 2004, MicroRNAs: genomics, biogenesis, mechanism, and function. Cell, 116: 281–297.

Baulcombe, D. C., 1996, RNA as a target and an initiator of post-transcriptional gene silencing in

transgenic plants. Plant Molecular Biology, 32: 79-88.

Baulcombe, D., 2004, RNA silencing in plants. Nature, 431:356-363.

Bell, A. A., 1981, Biochemical mechanisms of disease resistance. Annual Review Plant Physiology,

32:21-81.

Bendahmane, M. and Gronenborn, B., 1997, Engineering resistance against tomato yellow leaf curl virus (TYLCV) using antisense RNA. Plant Mol. Biol. 33: 351–357.

Bernstein, E., Caudy, A. A., Hammond, S. M. and Hannon, G. J., 2001, Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature, 409:363-

369.

Bilko,V. and Barik, S., 2001, Phenotypic silencing of cytoplasmic genes using sequence specific double stranded interfering RNA and its application in the reverse genetics of wild type negative strand RNA viruses. Biomedical Center Microbiology, 1: 34-55.

Birmingham, A, Anderson, E. M., Reynolds, A., Ilsley-Tyree, D., Leake, D., Fedorov, Y., Baskerville, S., Maksimova, E., Robinson, K., Karpilow, J., Marshall, W. S., Khvorova, A, 2006, 3' UTR seed matches, but not overall identity are associated with RNAi off-targets. Nat Methods, 3:199-204.

Bisaro, D. M., 2006, Silencing suppression by geminivirus proteins. Virology, 344:158-168.

Brossollet, V. C. and Vaquero, C., 1998, Do natural antisense transcripts make sense in eukaryotes?. Gene, 211:1-9.

Byzova, M., Verduyn, C., De Brouwer, D. and De Block, M., 2004, Transforming petals into sepaloid organs in Arabidopsis and oilseed rape: implementation of the hairpin RNA-mediated gene silencing technology in an organ-specific manner. Planta, 218: 379-387.

Chory, J., Ecker, J. and Briggs, S., 2000, functional genomics and the virtual plant.A blue print for understanding how plants are built and how to improve them. plant physiology,123:423-425.

Cigan, A. M., Unger-Wallace, E. and Haug-Collet, K., 2005, Transcriptional gene silencing as a tool for uncovering gene function in maize. Plant J. 43: 929–940.

Cogoni, C., Irelan, J. T., Schumacher, M., Schmidhauser, T. J., Selker, E. U., and Macino, G., 1996, Transgene silencing of the al-1 gene in vegetative cells of Neurospora is mediated by a cytoplasmic effector and does not depend on DNA-DNA interactions or DNA methylation. EMBO Journal, 15: 3153–3163.

Couzin, J., 2002, Breakthrough of the year. Small RNAs make big splash. Science, 298:2296-2297.

Day, A. G., Bejarano, E. R., Buck, K. W., Burrell, M. and Lichtenstein, C. P., 1991, Expression of an antisense viral gene in transgenic tobacco confers resistance to the DNA virus tomato golden mosaic virus. Proceeding of National Academy of Science, 88: 6721-6725.

Depicker, A., Montagu, M. V. and Schell, J., 1978, Homologous DNA sequences in different Ti-plasmids are essential for oncogenicity. Nature, 275: 150–153.

Doench, J. G., Peterson, C. P. and Sharp, P. A., 2003, siRNAs can function as miRNAs. Genes

Development, 17: 438-442.

Dunoyer, P., Himber, C. and Voinnet, O., 2005, DICER-LIKE 4 is required for RNA interference and produces the 21-nucleotide small interfering RNA component of the plant cell-to-cell silencing signal. Nature Genetics, 37: 1356-1360.

Dunoyer, P., Himber, C. and Voinnet, O., 2006, Induction, suppression and requirement of RNA silencing pathways in virulent Agrobacterium tumefaciens infections. Nat. Genet, 38: 258-263.

Elbashir, S. M., Lendeckel, W. and Tuschl, T., 2001, RNA interference is mediated by 21-and 22-nucleotide RNAs. Genes Dev, 15:188-200.

Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K. and Tuschl, T., 2001, Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature, 411:494-498.

Elbashir, S. M., Martinez, J., Patkaniowska, A., Lendeckerl, W. and Tuschl, T., 2001, Functional

anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo

lysate. EMBO Journal, 20: 6877-6888.

Eldik, V. G. J., Litiere, K., Jacobs, J. J., Van Montagu, M., De Carvalho, N. F., Frendo, P., Van- Montagu, M. and Cornelissen, M., 1998, Silencing of beta-1,3-glucanase genes in tobacco correlates with an increased abundance of RNA degradation intermediates. Nucleic Acids Research, 26:5176-5181.

Elmen, J., Thonberg, H., Ljungberg, K., Frieden, M., Westergaard, M., Xu, Y., Wahren, B., Liang, Z., Orum, H., Koch, T and Wahlestedt, C., 2005, Locked nucleic acid (LNA) mediated improvements in siRNA stability and functionality. Nucleic Acids Res, 33: 439–447

Fagard, M., Boutet, S., Morel, J.-B., Bellini, C. and Vaucheret, H., 2000, AGO1, QDE-2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals. Proc. Natl. Acad. Sci. USA, 97:11650-11654.

Fire, A., Xu, S., Mary, K., Montgomery., Steven, A., Kostas., Driver, S, E. and Mello, C. C., 1998, Potent and specific genetic interference by double-stranded RNA in Caenorhabditis

elegans. Nature, 391: 806-811.

Fortier, E. and Belote, J. M., 2000, Temperature-dependent gene silencing by an expressed inverted repeat in Drosophila. Genesis, 26:240-244.

Francesco., Di Serio., Schob, H., Iglesias, A., Tarina, C., Bouldoires, E. and Meins, F., 2001, Sense- and antisense-mediated gene silencing in tobacco is inhibited by the same viral suppressors and is associated with accumulation of small RNAs. Proceedings of National Academi of Science , 98: 6506–6510.

Fukusaki, E., Kawasaki, K., Kajiyama, S., An, C. I., Suzuki, K., Tanaka, Y. and Kobayashi, A., 2004, Flower color modulations of Torenia hybrida by downregulation of chalcone synthase genes with RNA interference. Journal of biotechnology, 111:229-240.

Goldbach, R., Bucher, E. and Prins, M., 2003, Resistance mechanisms to plant viruses: an overview. Virus Res, 92: 207-212.

Goldberg, R, B., Beals, T. P. and Sanders, P. M., 1993, Anther development: basic principles and practical applications. Plant Cell, 5: 1217-1229.

Gorman, S. W. and Mc Cormick, S., 1997, Male sterility in tomato. Crit. Rev. Plant Sci, 16: 31–53.

Greenland, A. et al. (1998) Reversible male sterility: a novel system for production of hybrid corn. Symp. Soc. Exp. Biol, 51: 141–147.

Grierson, D., Fray, R. G., Hamilton, A. J., Smith, C. J. S. and Watson, C. F., 1991, Does co-suppression of sense genes in transgenic plants involve antisense RNA?. Trends in Biotechnology, 9:122–123.

Groot, D., Weterings, K., De Been, M., Wittink, F., Hulzink, R., Custers, J., Herpen, V. V. M., Gherpen, W. M. and Wullems, G., 2004, Silencing of the pollen-specific gene NTP303 and its family members in tobacco affects in vivo pollen tube growth and results in male sterile plants. Plant Molecular Biology, 55:715-726.

Guo, H. S., Fei, J. F., Xie, Q. and Chau, N. H., 2003, A chemical regulated inducible RNAi system in

plants. Plant Journal, 34: 383-392.

Guo, S. and Kemphues, K. J., 1995, Par-1, a gene required for establishing polarity in C. elegans

embryos encodes a putative Ser.Thr kinase that is asymmetrically distributed. Cell, 81:611-

620.

Hamilton , A. J. and Grierson, D, 1998, Sense- and antisense-mediated gene silencing in tobacco is inhibited by the same viral suppressors and is associated with accumulation of small RNAs Plant J, 15:737-746.

Hamilton, A. J. and Baulcombe, D. C., 1999, A species of small antisense RNA in posttranscriptional gene silencing in plants. Science, 286: 950-962.

Hammond, S. M., Bernstein, E., Beach, D. and Hannon, G. J., 2000, An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature, 404:293-296.

Hammond, S. M., Bernstein, E., Beach, D. and Hannon. G. J., 2000, An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature, 404: 293-296.

Han, Y. and Grierson, D., 2002, Relationship between small antisense RNAs and aberrant RNAs

associated with sense transgene mediated gene silencing in tomato. Plant Journal, 29: 509-

519.

Hedin, P. A., Parrott, W. L. and Jenkins, J. N., 1992, Relationship of glands, cotton square terpenoid aldehydes, and other allelochemi- cals to larval growth of Heliothis virescens (Lepidoptera: NoctuiIn). J Econ Entomol, 85:359–364.

Helliwell, C. A., Wesley, V., Wielopolska, A. J. and Waterhouse, P. M., 2002, High-throughput vectors for efficient gene silencing in plants. Functional Plant Biology, 29: 1217-1225.

Hofgen, R., Axelsen, K. B., Kannangara, C. G., Schuttke, I., Pohlenz, H. D., Willmitzer, L., Grimm, B. and Wettstein, V. D., 1994, A visible marker for antisense mRNA expression in plants: inhibition of chlorophyll synthesis with a glutamate-1-semialdehyde aminotransferase antisense gene. Proceedings of the National Academy of Sciences of the United States of America, 91:1726-1730.

Hutvagner, G., Mclachlan, J., Pasquinelli, A. E., Balint, E., Tuschl, T. and Zamore, P. D., 2001, A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science, 293: 834–838.

Jarad, G., Wang, B., Khan, S., Devore, J., Miao, H., W, U. K., Nishimura, S. L., Wible, B. A., Konieczkowski, M., Sedor, J. R. and Schelling, J. R., 2002, Fas activation induces renal tubular epithelial cell β-8 integrin expression and function in the absence of apoptosis. Journal of Biological Chemistry, 277: 47826-47833.

Jenkins, J. N., Maxwell, F. G. and Lafever, H. N., 1966, The comparative preference of insects for glanded and glandless cottons. J Econ Entomol, 59: 352–356

Jorgensen, R. A., 2003, Sense co-suppression in plants: Past, present and future. In RNAi: A guide to gene silencing, Cold Spring Harbor Laboratory Press, 15-22.

Kapoor, S., Kobayashi, A. and Takatsuji, A., 2002, Silencing of the tapetum-specific zinc finger gene TAZ1 causes remature degeneration of tapetum and pollen abortion in petunia. Plant Cell 14: 2353–2367.

Katageri, I. S., Vamadevaiah, H. M., Udikeri, S. S., Khadi, B. M. and Kumar, P. A., 2007, Genetic transformation of an elite Indian genotypes of Cotton (G. hirsutum). Current Science, 93: 12-25.

Klahre, U., Crete, P., Leuenberger, S. A., Iglesias, V. A. and Meins, F., 2002, High molecular weight RNAs and small interfering RNAs induce systemic post-transcriptional gene silencing in plants. Proceedings of the National Academy of Sciences of the United States of America, 99:11981-11986.

Knutzon, D. S., Thompson, G. A., Radke, S. E., Johnson, W. B., Knauf, V. C. and Kridl, J. C., 1992,

Modification of Brassica seed oil by antisense expression of a stearoyl-acyl carrier protein

desaturase gene. Proceedings of National Academy Science, 89:2624-2628.

Kooter, J. M., Matzke, M. A. A. and Meyer, P., 1999, Listening to the Silent Genes: Transgene Silencing, Gene Regulation and Pathogen Control. Trends plant science.4:340-347.

Kumar, D., Gustafsson, C. and Klessig, D. F., 2006, Validation of RNAi silencing specificity using synthetic genes: salicylic acid-binding protein 2 is required for innate immunity in plants. Plant J. 45: 863–868.

Kumar, M. and Carmichael, G. G., 1998, Antisense RNA: function and fate of duplex RNA in cells of higher eukaryotes. Microbiol Mol Biol Rev, 62:1415-1434.

Kusaba, M., Miyahara, K., Iida, S., Fukuoka, H., Takano, T., Sassa, H., Nishimura, M and Nishio, T, 2003, Low glutelin content1: a dominant mutation that suppresses the glutelin multigene family via RNA silencing in rice. Plant Cell, 15: 1455–1467.

Kuznetsov, V.Y., 2003, RNA Interference. An approach to produce knockout organism and cell lines.

Biochemistry, 68: 1301-1317.

Lankenau, S., Corces, V. G. and Lankenau, D. H., 1994, The Drosophila micropia retrotransposon

encodes a testis-specific antisense RNA complementary to reverse transcriptase. Molecular

Cell Biology, 14: 1764-1775.

Lee, N. S., Dohjima, T., Bauer, G., Li, H., Li, M.-J., Ehsani, A., Salvaterra, P. and Rossi, J., 2002, Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nat. Biotechnol, 20:500-505.

Lee, R. C., Feinbaum, R. L. and Ambros, V., 1993, The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell, 75:843-854.

Li, M.-J., Li, H. and Rossi, J., 2006, RNAi in combination with a ribozyme and TAR decoy for treatment of HIV infection in hematopoietic cell gene therapy. Ann. N.Y. Acad. Sci, 1082:172-179.

Lichtenstein, C., Klee, H., Montoya, A., Garfinkel, D., Fuller, S., Flores, C., Nester, E. and Gordon, M., 1984, Nucleotide sequence and transcript mapping of the tmr gene of the pTiA6NC octopine Ti plasmid: a bacterial gene involved in plant tumorigenesis. J. Mol. Appl. Genet. 2:354-362.

Lin, X., Ruan, X., Anderson, M. G., Mc Dowell, J. A., Kroeger, P. E., Fesik, S. W. and Shen, Y., 2005, siRNA-mediated off-target gene silencing triggered by a 7 nt complementation. Nucleic Acids Res. 33: 4527–4535.

Lipardi, C., Wei, Q. and Paterson, B. M., 2001, RNAi as random degradative PCR: siRNA primers convert mRNA into dsRNAs that are degraded to generate new siRNAs. Cell, 107: 297-307.

Liu, J., Carmell, M. A., Rivas, F.V., Marsden, C. G., Thomson, J. M., Song, J.-J., Hammond, S. M., Joshua-Tor, L. and Hannon, G. J., 2004, Argonaute2 Is the catalytic engine of mammalian RNAi. Science, 305:1437-1441.

Liu, Q., Singh, S. P. and Green, A. G., 2002, High-Oleic and High-Stearic Cottonseed Oils: Nutritionally Improved Cooking Oils Developed Using Gene Silencing. Journal of the American College of Nutrition, 3: 205-211.

Liu, X., Jiang, F., Kalidas, S., Smith, D. and Liu, Q., 2006, Dicer-2 and R2D2 coordinately bind siRNA to promote assembly of the siRISC complexes. RNA, 14: 789-796.

Liu, Y. L., Schiff, M. and Kumar, D. S. P., 2003, Virus-induced gene silencing in tomato. Plant

Journal, 31: 777-786.

Lucas, W. J., Yoo, B. C. and Kragler, F., 2001, RNA as a long-distance information macromolecule in plants. Nature Review Molecular Biology, 2: 849-887.

Lusas, E. W. and Jividen, G. M.,1987, Development of high-gossypol cotton plants with low-gossypol seeds using trispecies bridge crosses and in vitro culture of seed embryos. J Am Oil Chem Soc, 64:839–854.

Malik, I. et al. (2006) Comparison of test systems for RNAi. Biochem. Biophys. Res. Commun. 341: 245–253.

Mariani, C., De Beuckeleer, M., Truettner, J., Leemans, J and Goldberg, R. B., 1990, Induction of male sterility in plants by a chimaeric ribonuclease gene. Nature, 347, 737–741

Martinez, J. and Tuschl, T., 2004, RISC is a 5' phosphomonoester-producing RNA endonuclease. Genes Dev, 18:975-980.

Martinez, J., Patkaniowska, A., Urlaub, H., Lührmann, R. and Tuschl, T., 2002, Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell, 110:563-574.

Matzke, M. A. and Matzke, A. J. M., 1991, Differential inactivation and methylation of a transgene in

plants by 2 suppressor loci containing homologous sequences. Plant Molecular Biology, 16:

821-830.

Matzke, M., Matzke, A. J. and Kooter, J. M., 2001, RNA: guiding gene silencing. Science., 293: 1080-1083.

Metzlaff, M., O’dell, M., Cluster, P. D. and Flavell, R. B., 1997, RNA-mediated degradation and

chalcone synthase A silencing in petunia. Cell, 88: 845-854.

Mol, J. N. M., Blokland, V. R., Lange, P., Stam, M. and Kooter, J. M., 1994, Post-transcriptional inhibition of gene expression: sense and antisense genes. In: Homologous Recombination and Gene Silencing in Plants (Paszkowski, J.,ed. ). Dordrecht:Kluwer, 309-334.

Moritoh, S., Miki, D., Akiyama, M., Kawahara, M., Izawa, T., Maki, H. and Shimamoto, K., 2005, RNAi-mediated silencing of OsGEN-L (OsGEN-like), a new member of the RAD2/XPG nuclease family, causes male sterility by defect of microspore development in rice. Plant Cell Physiol, 46: 699-715.

Nam, N. H. and Parang, K., 2003, Current targets for anticancer drug discovery. Current Drug Targets, 4:159-179.

Noris, E., Lucioli, A., Tavazza, R., Caciagli, P., Accotto, G. P. and Tavazza, M., 2004, Tomato yellow leaf curl Sardinia virus can overcome transgene-mediated RNA silencing of two essential viral genes. The Journal of general virology, 85:1745-1749.

Ogita, S., Uefujis, H., Morimotos, M. and Sano, H., 2004, Application of RNAi to confirm theobromine as the major intermediate for caffeine biosynthesis in coffee plants with potential for construction of decaffeinated varieties. Plant Molecular Biology, 54: 931–941.

Ooms, G., Hooykaas, P. J. J., Moolenaar, G. and Schilperoort, R. A., 1981, Crown gall plant tumors of abnormal morphology, induced by Agrobacterium tumefaciens carrying mutated octopine Ti plasmids; analysis of T-DNA functions. Gene, 14: 33–50.

Papenbrock, J., Pfundel, E., Mock, H. P. and Grimm, B., 2000, Decreased and increased expression of the subunit CHL I diminishes Mg chelatase activity and reduces chlorophyll synthesis in transgenic tobacco plants. Plant J, 22:155-164.

Pare, P. W. and Tumlinson, J. H., 1997, Induced synthesis of plant volatiles. Nature, 385:30-31.

Pasquinelli, A. E., 2002, MicroRNAs: deviants no longer. Trends Genetics, 18:171-173.

Petrovska, N., Wu, X., Donato, R., Wang, Z., Ong, E. K., Jones, E., Forster, J., Emmerling, M., Sidoli, A., O’Hehir, R. and Spangenberg, G., 2005, Transgenic ryegrasses (Lolium spp.) with down-regulation of main pollen allergens. Mol. Breed, 14: 489–501.

Pooggin, M., Shivaprasad, P. V., Veluthambi, K. and Hohn, T., 2003, RNAi targeting of DNA virus in plants. Nature biotechnology, 21:131-132.

Risco C. A. and Chase, C. C., 1997, in Handbook of Plant and Fungal Toxicants, edD’Mello JPF CRC Press, Boca Raton, FL,PP 87 – 98.

Sangare, A., Deng, D., Fauquet, C. M. and Beachy, R. N., 1999, Resistance to African cassava mosaic virus conferred by a mutant of the putative NTP-binding domain of the Rep Gene (AC1) in Nicotiana benthamiana. Mol. Breed. 5: 95–102

Schramke, V. and Allshire, R., 2003, Hairpin RNAs and Retrotransposon LTRs Effect RNAi and Chromatin-Based Gene Silencing. Science, 301: 1069-1074.

Schuch, W., Bird, C. R., Ray, J., Smith, C. J., Watson, C. F., Morris, P. C., Gray, J. E., Arnold, C., Seymour, G. B. and Tucker, G. A., 1989, Control and manipulation of gene expression during tomato fruit ripening. Plant Molecular Biology, 13 : 303-311.

Schwarz, D. S., Hutagner, G., Du, T., Xu, Z., Aronin, N. and Zamore, P. D., 2003, Asymmetry in the

assembly of the RNAi enzyme complex. Cell, 115: 199-208.

Selker, E. U., 2003, Molecular biology.a self help guide for a trim genome. Science, 300: 1517-1518.

Sen, G. L. and Blau, H. M., 2006, A brief history of RNAi: the silence of the genes. FASEB J, 20:1293-1299.

Senior, I. J., 1998, Uses of plant gene silencing. Biotechnology and Genetic Engineering Review, 15 : 79-119.

Serio, F.D., Schob, H., Iglesias, A., Tarina, C., Bouldoires, E. and Meins, F. J., 2001, Sense and

antisense mediated gene silencing in tobacco is inhibited by the same viral suppressors and is

associated with accumulation of small RNAs. Proceedings of National Academy of Science,

98:6505-6510.

Sijen, T., Fleenor, J., Simmer, F., Thijssen, K. L., Parrish, S., Timmons, L., Plasterk, R. H. A. and Fire,

A., 2001, On the role of RNA amplification in dsRNA-triggered gene silencing. Cell, 107:

465-476.

Smith, N. A., Singh, S. P., Wang, M., Stoutjesdijk, P. A., Green, A. G. and Waterhouse, P. M., 2000,

Total silencing by intron-spliced hairpin RNAs. Nature, 407: 319-320.

Smith, T. M. B., Jeffrey, C., Anderson., Gregory, B., Martin and Kumar, D. S. P., 2004, Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal, 39: 734-742.

Stipanovic, R. D., Bell, A. A. and Benedict, C. R., 1999, in Biologically Active Natural Products: Agrochemicals, eds Cutler HG, Cutler SJ (CRC Press, Boca Raton, FL), pp 211–220

Stoutjesdijk, P., Singh, S. P., Liu, Q., Hurlstone, C., Waterhouse, P. and Green, A., 2002, hpRNA-

mediated targeting of the Arabidopsis FAD2 gene gives highly efficient and stable silencing.

Plant Physiology, 129: 1723-1731.

Subramanian, S., Madge, Y., Graham., Oliver, Y. U., Terrence, L. and Graham., 2005, RNA Interference of Soybean Isoflavone Synthase Genes Leads to Silencing in Tissues Distal to the Transformation Site and to Enhanced Susceptibility to Phytophthora sojae. Plant Physiology, 137:1345-1353.

Svoboda, P., Stein, P. and Schultz, R. M., 2001, RNAi in mouse oocytes and preimplantation embryos: effectiveness of hairpin dsRNA. Biochem. Biophys. Res. Commun, 287:1099-1104.

Svoboda, P., Stein, P., Hayashi, H. and Schultz, R. M., 2000, Selective reduction of dormant maternal mRNAs in mouse oocytes by RNA interference. Development, 127:4147-4156

Tomari, Z., Yamamoto, Y. and Sato, F., 2004, A Protein Sensor for siRNA Asymmetry. Plant Biology Science, 56:1377-1380.

Vaistij, F. E., Jones, L. and Baulcombe, D. C., 2002, Spreading of RNA targeating and DNA

methylation in RNA silencing requires transcription of the target gene and a putative RNA-

dependent RNA polymerase. Plant Cell, 14: 857-867.

Vance, V. and Vaucheret, H., 2001, RNA silencing in plants-defense and counter defense. Science, 292:2277-2280.

Vanitharani, R., Chellappan, P. and Fauquet, C. M., 2003, Short interfering RNA-mediated interference of gene expression and viral DNA accumulation in cultured plant cells. Proceedings of the National Academy of Sciences of the United States of America, 100: 9632-9636.

Vaucheret, H., 2006, Post-transcriptional small RNA pathways in plants: mechanisms and regulations. Genes Development, 20: 759-771.

Voinnet, O., 2001, RNA silencing as a plant immune system against viruses. Trends Genet, 17:449-459.

Voinnet, O., 2002, RNA silencing: small RNAs as ubiquitous regulators of gene expression. Current

Opinion of Plant Biology, 5: 444-451.

Voinnet, O., Vain, P., Angell, S. and Baulcombe, D. C., 1998, Systemic spread of sequence-specific transgene RNA degradation in plants is initiated by localized introduction of ectopic promoterless DNA. Cell, 95: 177-187.

Wagner, A., Phillips, L., Narayan, R. D., Moody, J. M. and Geddes, B., 2005, Gene silencing studies in the gymnosperm species Pinus radiata. Plant Cell Report, 24: 95-102.

Waterhouse, P. M. and Helliwell, C. A., 2002, Exploring Plant Genomes By RNA-Induced Gene Silencing.Nature Reviews Genetics, 4 : 29 - 38.

Waterhouse, P. M., Graham, H. W. and Wang, M. B., 1998, Virus resistance and gene silencing in

plants can be induced by simultaneous expression of sense and antisense RNA. Proceedings

of National Academy of Science, 95: 13959-13964.

Waterhouse, P. M., Wang, M. B., and Finnegan, E. J., 2001, Role of short RNAs in gene silencing. Trends in Plant Science, 6:297-301.

Wesley, S. V., Helliwell, C. A., Smith, N. A., Wang, M., Rouse, D. T., Liu, Q., Gooding, P. S., Singh,

S. P., Abbott, D., Stoutjesdijk, P. A., Robinson, S. P., Gleave, A. P., Green, A. G. and

Waterhouse, P. M., 2001, Construct design for effective and high-throughput gene silencing

in plants. Plant Journal, 27: 581-590.

Xiong., Ai-Sheng., Yao., Quan-Hong., Peng., Ri-He., Li., Xian., Han., Pei-Lai., Fan., Hui-Qin., 2005, Different effects on ACC oxidase gene silencing triggered by RNA interference in transgenic tomato. Plant Cell Reports, 23 :639-646.

Yan, H., Chretien, R., Ye, J. and Rommens, C. M., 2006, New Construct Approaches for Efficient Gene Silencing in Plants. Plant Physiology, 9: 536-545.

Yao, M. C., Fuller, P. and Xi, X., 2003, Programmed DNA deletion as an RNA guided system of genome defence. Science, 300: 1581-1584.

Yuanhuai, H., Griffiths, A., Li., Hongying., Grierson, D., Han, Y. H. and Li, H.Y., 2004, The effect of endogenous mRNA levels on co-suppression in tomato. FEBS Letters, 563: 1-3.

Zamore, P.D., Tuschl, T., Sharp, P.A. and Bartel, D. P., 2000, RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell, 101:25-33.

Appendix I : Formaldehyde agarose Gel (1.2 Per cent)

10X Formaldehyde agarose buffer (100 ml)

200mM 3-(N-morpholino) propanosulfonic acid (MOPS)

50mM sodium acetate

10mM EDTA

Adjust pH to 7.0 with NaOH

1X Formaldehyde running buffer (1000 ml)

Formaldehyde agarose gel buffer(10X) 100 ml

Formaldehyde (37%) 20 ml

RNAse free water 880 ml

5X RNA loading buffer (10 ml)

Saturated aqueous bromophenol blue solution 16 µl

500Mm EDTA Ph 8.0 80 µ

Formaldehyde (37%) 720 µl

Glycerol(100%) 2 ml

Formamide(100%) 3084 µl

10X formaldehyde agarose gel buffer 4 ml

RNAse free water 10 ml

Appendix II : Agarose Gel Electrophoresis

a. Loading dye composition

Loading dye (6x) : 0.25% bromophenol blue

40% (w/v) sucrose in water

b. Ethidium bromide

10 mg/ ml in distilled water. Stored at 4°C in dark bottle.

c. Recipe for 1 per cent agarose gel (40 ml)

Agarose - 400 mg

1x TAE - 40 ml

EtBr (10 mg/ ml) - 2 µl

d. 50x TAE composition

Tris base - 242 g

Glacial acetic acid - 57.1 ml

0.5 M EDTA (pH 8.0) - 100 ml

Total volume 1000 ml with double distilled water.

Appendix III : Conversion table for the amount of a PCR fragment required per ligation reaction

Length of DNA fragment (bp)

picomoles of ends

per 1 µµµµg of DNA

Quantity of PCR fragments for ligation

reaction in µµµµg (0.54 pmol ends)

100 30.0 0.018

300 10.0 0.054

500 6.0 0.090

1000 3.0 0.180

2000 1.5 0.360

3000 1.0 0.540

Appendix IV: Ligation recipe

a. Ligation reaction recipe

Plasmid vector pTZ57R/T DNA (0.165 µg, 0.18 pmol ends) 30 µl

Purified PCR fragment, (Approx. 0.54 pmol ends) X µl

10x ligation buffer 3.0 µl

PEG 4000 solution (10x) 3.0 µl

Deionized water Y µl

T4 DNA ligase, 5U 1.0 µl

Total 30 µl

b. Control ligation reaction recipe

PTZ57R/T DNA (0.165 µg, 0.18 pmol ends) 3.0 µl

Purified PCR fragment (Approx. 0.54 pmol ends) 4.0 µl

10x ligation buffer 3.0 µl

PEG 4000 solution 3.0 µl

Deionized water upto 16.0 µl

T4 DNA ligase, 5 U 1.0 µl

Total 30 µl

Appendix V: Media composition

a. Luria agar

Ingredients Concentration (g/l)

Tryptone 10.0

Yeast extract 5.0

Sodium chloride 5.0

Agar 18.0

PH 7.2

Luria agar Kan50 To 100 ml Luria agar 100 µl of Kan50 (antibiotic) was added at 50°C.

Luria agar Amp100 To 100 ml Luria agar 100 µl of Amp100 (antibiotic) was added at 50°C.

IPTG (200 mg/ ml) 200 mg of IPTG dissolved in 1 ml of sterile water, filter

sterilized and stored at 00C 5 µl/ plate was used.

X-gal solution (20 mg/ ml) 20 mg of X-gal dissolved in 1 ml of N, N-dimethyl formamide.

Stored at 00C, 40 µl/plate was used

b. Recipe for 1.0 per cent agarose gel (40 ml)

Agarose - 400 mg

1x TAE - 40 ml

EtBr (10 mg/ ml) - 2 µl

Appendix VI: Reagents for plasmid isolation

STET buffer

Tris-Cl (pH 8.0) : 10 mM

NaCl : 100 mM

EDTA (pH 8.0) : 1.0 mM

Autoclaved and stored at 4°C

Alkaline lysis solution I

Glucose : 50 mM

Tris-Cl (pH 8.0) : 25 mM

EDTA (pH 8.0) : 10 mM

Autoclaved and stored at 4°C

Alkaline lysis solution II

NaOH (10N) : 0.2 N

SDS (10%) : 1% (w/v)

(Prepared fresh and used at room temperature)

Alkaline lysis solution III

5 M potassium acetate : 60 ml

Glacial acetic acid : 11.5 ml

Double distilled water : 28.5 ml

Autoclaved and stored at 4°C

Appendix VII: Restriction of PCR amplicon and generic ihp vector

PCR amplicon DNA (1 µg) : 1 µl

Enzyme KpnI (10U) : 0.5 µl

10x buffer : 2 µl

Sterile water : 16.5 µl

———————————————————-

Total : 20 µµµµl

———————————————————

PCR amplicon DNA (0.5 µg) : 2 µl

Enzyme BamHI (10U) : 0.5 µl

10x buffer L : 2 µl

1x BSA : 2 µl

Sterile water : 13.5 µl

———————————————————

Total : 20 µµµµl

———————————————————

generic ihp DNA (0.5 µg) : 2 µl

Enzyme KpnI (10U) : 0.5 µl

10x buffer L : 2 µl

Sterile water : 15.5 µl

———————————————————-

Total : 20 µµµµl

———————————————————

generic ihp DNA (0.25 µg) : 4 µl

Enzyme BamHI (10U) : 0.5 µl

10x buffer L : 2 µl

1x BSA : 2 µl

Sterile water : 11.5 µl

———————————————————

Total : 20 µµµµl

———————————————————

Appendix VIII: Restriction of PCR amplicon and generic ihp vector

PCR amplicon DNA (1µg) : 1 µl

Enzyme NcoI (10U) : 0.5 µl

10x buffer E : 2 µl

Sterile water : 16.5 µl ———————————————————-

Total : 20 µµµµl ———————————————————

PCR amplicon DNA (0.5 µg) : 2 µl

Enzyme XhoI (10U) : 0.5 µl

10x buffer E : 2 µl

1x BSA : 2 µl

Sterile water : 13.5 µl ———————————————————

Total : 20 µµµµl ———————————————————

generic ihp DNA (0.5 µg) : 2 µl

Enzyme NcoI (10U) : 0.5 µl

10x buffer E : 2 µl

Sterile water : 15.5 µl ———————————————————-

Total : 20 µµµµl ———————————————————

generic ihp DNA (0.25 µg) : 4 µl

Enzyme XhoI (10U) : 0.5 µl

10x buffer E : 2 µl

1x BSA : 2 µl

Sterile water : 11.5 µl ———————————————————

Total : 20 µµµµl ———————————————————

Restriction of generic ihp vector carrying inserts

generic ihp (ihp) DNA (0.25 µg) : 4 µl

Enzyme pstI(10U) : 0.5 µl

10x buffer : 2 µl

Sterile water : 13.5 µl ———————————————————

Total : 20 µµµµl ______________________________________

Appendix IX: Restriction of pCAMBIA1305.1 vector

pCAMBIA DNA (1 µg) : 1 µl

Enzyme HindIII (10U) : 0.5 µl

10x buffer : 2 µl

Sterile water : 16.5 µl

———————————————————

Total : 20 µµµµl

———————————————————

Alkaline phosphatase treatment of pCAMBIA1305.1 vector

pCAMBIA DNA (1 µg) : 1 µl

Enzyme AP (10U) : 0.5 µl

10x buffer : 2 µl

Sterile water : 16.5 µl

———————————————————

Total : 20 µµµµl

———————————————————

Appendix X: Composition of yeast extract mannitol agar (YEMA) for 100 ml

D-Mannitol : 1 g

KH2PO4 : 20 mg

K2HPO4 : 20 mg

Yeast Extract : 100 mg

MgS04. 7H2O (1 M) : 80 µl

CaCl2 (1 M) : 40 µl

Agar : 1.8 g

Appendix XI: Components of Murashige and Skoog (1962) medium (modified)

Component mg/l concentration

Macronutrients NH4NO3 1650.00

KNO3 1900.00

MgSO4 . 7H2O 370.00

KH2PO4 170.00

CaCl2 . 2H2O 440.00

Micronutrients FeSO4 . 7H2O 27.80

Na2 EDTA 60.00

MnSO4 . 4H2O 22.30

ZnSO4 . 7H2O 8.60

H3BO3 6.30

KI 0.83

Na2MoO4 . 2H2O 0.25

CuSO4 . 5H2O 0.025

CoCl2 . 6H2O 0.025

Organics Thiamine HCl 10.00

Pyridoxine HCl 1.00

Nicotinic acid 1.00

Glycine 10.00

Myoinositol 100.00

Biotin 0.50

Appendix XII: Extraction buffer for DNA isolation (CTAB method)

For 100 ml

10% CTAB : 20 ml

1 M Tris base : 10 ml

4 M NaCl : 35 ml

Sterile water : 34 ml

The solution was autoclaved and added

Mercapto ethanol : 1 ml

PVP : 0.1% (100 mg)

To make the volume 100 ml

Appendix XIII: Reagents for gossypol estimation

95% Ethyl alcohol : 50 ml

Whatman filterpaper no-1 : -

40%Ethanol : 10 ml

80%Ethanol : 100 ml

Diethyl ether : 50 ml

Distilled water : 50 ml

1N HCL : 1 ml

Phloroglucinol : 5 g

ANTISENSE SUPPRESSION OF δ-CADINENE

SYNTHASE GENE IN COTTON

REVATHY CHARAGONDA 2008 I. S. KATAGERI

MAJOR ADVISOR

ABSTRACT

Cotton is the third largest field crop in terms of edible oilseed tonnage in the world. In addition to 21% oil, cottonseed is a source of relatively high-quality protein (23%). However, the ability to use this nutrient-rich resource for food is hampered by the presence of toxic gossypol. Post transcriptional silencing of δ-cadinene synthase gene was envisaged as a way to activate silencing mechanism in cotton, there by blocking the cadinene type sesquiterpenes pathway and abolishing gossypol production in the transformants. PTGS is a specific RNA degradation mechanism of any organism that takes care of aberrant unwanted excess of its own or foreign RNA intracellularly, in a homology dependent manner. In this study, an attempt was made to develop construct for post transcriptional gene silencing of δ-cadinene synthase gene, and analyse its expression in transgenic cotton. A 600bp DNA fragment was amplified using δ-cad gene specific primer from ovules, 45 days after post anthesis. The amplicon was cloned in PTZ57R/T and transformed into E. coli DH5α. Transformants were confirmed through PCR and restriction. The analysis of the sequence revealed maximum of 99.8% homology at nucleotide and 100% homology at aminoacid level with reported sequence in the database (U23205 & Q39760) . Partial δ-cadinene synthase gene was cloned in both sense and antisense direction in ihp vector . The expression cassette carrying insert from generic ihp vector was then subcloned into plant transformation vector pCAMBIA 1305.1 to facilitate plant transformation.The recombinant clones were then mobilized into Agrobacterium tumefaciens LBA4404 by tri parental mating. Then transformed into Sahana cotton genotype. T0 transgenic plants were confirmed through PCR using hptII primers. Gossypol glands counted in control plants were 60-100 per cm

2 and in T0 transgenic

plant were 5 per cm2. Further the gossypol content in control and transgenic plants were 5-8

µg/mg and 0.07 µg/mg respectively.