universidad politÉcnica de madrid escuela ...oa.upm.es/48105/1/nuria_fernandez_bautista_abad.pdfdr....
TRANSCRIPT
UNIVERSIDAD POLITÉCNICA DE MADRID
ESCUELA TÉCNICA SUPERIOR DE INGENIERÍA AGRONÓMICA, ALIMENTARIA Y DE BIOSISTEMAS
(CENTRO DE BIOTECNOLOGÍA Y GENÓMICA DE PLANTAS)
FUNCTIONAL CHARACTERIZATION OF THE ARABIDOPSIS HSP70-HSP90 ORGANIZING PROTEIN (HOP) FAMILY IN RESPONSE TO STRESS
TESIS DOCTORAL
NURIA FERNANDEZ BAUTISTA-ABAD
Licenciada en Ciencia y Tecnología de Alimentos
Diplomada en Nutrición Humana y Dietética
2017
iii
Departamento de Biotecnología ESCUELA TÉCNICA SUPERIOR DE INGENIERÍA AGRONÓMICA, ALIMENTARIA Y DE BIOSISTEMAS
UNIVERSIDAD POLITÉCNICA DE MADRID Tesis doctoral FUNCTIONAL CHARACTERIZATION OF THE ARABIDOPSIS HSP70-HSP90 ORGANIZING PROTEIN (HOP) FAMILY IN RESPONSE TO STRESS
Autor: Nuria Fernández Bautista-Abad, Diplomada en Nutrición Humana y Dietética y Licenciada en Ciencia y Tecnología de Alimentos Directores: María del Mar Castellano Moreno, Investigadora titular de OPIS Marta Berrocal Lobo, Profesor Titular Interino
2017
v
UNIVERSIDAD POLITÉCNICA DE MADRID Tribunal nombrado por el Magfco. y Excmo. Sr. Rector de la
Universidad Politécnica de Madrid, el día de de 20 .
Presidente:
Secretario:
Vocal:
Vocal:
Vocal:
Suplente:
Suplente:
Realizado el acto de defensa y lectura de Tesis el día de de
20 en la E.T.S.I. de Ingeniería Agronómica, Alimentaria y de
Biosistemas.
EL PRESIDENTE LOS VOCALES EL SECRETARIO
vii
ACKNOWLEDGMENTS This PhD Thesis has been carried out in the laboratory of Dr. Mar Castellano Moreno at the Centre for Plant Biotechnology and Genomics (CBGP, UPM – INIA) of the Universidad Politécnica de Madrid. Dr. Mar Castellano Moreno and Dr. Marta Berrocal Lobo have directed this research work and my predoctoral scientific training. I would like to acknowledge the following people for their contribution to this work:
Dr. Mar Castellano (CBGP, INIA) for her supervision during this Thesis, valuable comments and helpful discussion, being directly involved in all experiments related to abiotic stress.
Dr. Marta Berrocal Lobo (CBGP, INIA) for her contribution to the attainment of this PhD Thesis, supervising all the work of biotic stress and collaborating in the experimental work to obtain the results presented.
Dr. Lourdes Fernández Calvino (CBGP, INIA) for her help in the analysis of the involvement of AtHOP3 in the alleviation of ER stress, specifically her contribution to the confocal microscopy analysis, pollen germination, as well as her assitance and valuable knowledge in qPCR. In addition, for her collaboration in the characterization of AtHOPs in response to heat stress.
Dr. Alfonso Muñoz (CBGP, INIA) for his direct contribution in all proteomic analysis, performing immunoprecipitation analysis, as well as for his technically advice during the performance of all biochemical techniques for protein analysis.
Dr. Rene Toribio (CBGP, INIA) was in charge of the RNA-seq analysis and has made useful comments and critical suggestions to the advancement of this research work.
Dr. Hans-Peter Mock (Leibniz institute for plant genetics and cultural plant research, IPK) for hosting me during my PhD stage at IPK and her assistance in my training during my stage.
Ana B. Castro Sanz, PhD student, for kindly providing the RNAs from the different Arabidopsis tissues in the analysis of HOP3 expression under control conditions.
Patricia Olivares Pacheco and Cristina Pietro, former laboratory technicians at Dr. Mar Castellano Moreno´s group, for helping me in the preparation of culture mediums and other solutions, as well as for their help in performing seed sterilization and germination.
Dr. J. Zouhar and Dr. Alejandro Ferrando for their kind advice in implementing the ER stress and in vitro pollen germination assays, respectively.
I greatly appreciate the collaboration of Dr. Mar Castellano Moreno’s laboratory former and current members for their useful discussion and technical assistance.
The research leading to these results has received funding from the European Research Council under the European Union’s Seventh Framework Programme (FP/2007–2013)/ERC Grant Agreement n. 260468 to M. Mar Castellano and from the grants RTA2013-00027-00-00 and S2013-ABI2748.
My PhD was supported by the UPM predoctoral fellowship and INIA contracts, associated with the European Research Council under the European Union’s Seventh Framework Programme (FP/2007–2013)/ERC Grant Agreement n. 260468, granted to Dr. Mar Castellano Moreno. The stage at Dr. Mock’s laboratory was supported by UPM predoctoral fellowship.
ix
AGRADECIMIENTOS En muchas ocasiones he pensado qué diría llegado este momento y ahora que me enfrento a la hoja en blanco no sé por dónde empezar. Demasiadas ideas y no quiero dejarme ninguna en el camino.
En primer lugar quiero agradecer a Mar la oportunidad que me brindó para realizar este trabajo y por confiar en mí. No fue fácil empezar de cero pero gracias a su constancia, trabajo y tenacidad este trabajo ha sido posible. Gracias por enseñarme a tener un pensamiento crítico que espero me acompañe durante toda mi vida. Te deseo todo lo mejor.
Agradecer también a Marta Berrocal por todas sus enseñanzas y apoyo, no puedes negar que eres profesora, lo llevas en las venas. Admiro tu ilusión y optimismo y espero que no lo pierdas nunca.
Realizar una tesis doctoral es una carrera de obstáculos, aprendes a caer y levantarte con tanta frecuencia que al final aprendes a relativizar los problemas y a seguir adelante. Esa visión optimista es en parte gracias a un tan buen ambiente de trabajo en el laboratorio, sin todos mis compañeros creo que no hubiera sido posible.
Quiero empezar con mis chicas Anita y Lourdes. Gracias a Anita. Juntas emprendimos esta carrera y juntas espero que terminemos. Sin tus bromas y sentido del humor todo hubiera sido muy aburrido. Ya eres parte de mí, he adquirido vocabulario que cada vez que lo digo me acuerdo de ti. Eres una persona UNICA, te lo digo de corazón. Ojalá todo lo que nos deparé el destino no nos separe y sigamos en contacto, mi castorcito. Lourdes ya no recuerdo cuando viniste al laboratorio porque me parece que siempre estuviste ahí. Hay pocas personas tan buenas como tú. Siempre dispuesta ayudar, siempre optimista y atenta. Me duele mucho pensar que ya no vamos estar juntas pero espero que aunque estemos lejos sigamos estando cerca. Mucha suerte, seguro que te va genial.
René, ese chico que de primeras parece muy serio y formal pero que al final te canta una canción de los gandules, se mete en una cueva o se sabe todos los bailes latinos posibles… No puedo dejar de dedicarte unas palabras porque me has ayudado muchísimo. ¿Tienes un problema? ¡Pues ahí está René con una solución! En serio, te deseo todo lo mejor.
Alfonso por enseñarme a trabajar meticulosamente. Por ayudarme siempre que te lo he pedido, muchas gracias, sin ti este trabajo no habría sido posible. Gracias por tu paciencia. También agradecer a Laura, que siempre nos echas una mano y eres un encanto.
Tampoco puedo olvidarme de gente que ya no está pero que fueron claves en estos años. Me acuerdo en muchas ocasiones de dos personas brillantes, Sira y Emilio. Ambos me enseñaron desde el principio y los dos años con ellos estuvieron llenos de buen sentido del humor. La nutria os dedica este trabajo. No puedo dejar de mencionar a Patri, que era como la mami de laboratorio, siempre pendiente de todos. No cambies nunca. Me alegro que ahora la vida te sonría, te lo mereces.
La verdad que en estos años he conocido gente maravillosa y tengo que decir, que aunque este mundillo científico tiene fama de competitivo, yo siempre he ido encontrando buena gente y dispuesta a ayudar. Agradecer al Dr. Jose Antonio Jarillo por brindarme la oportunidad de realizar el proyecto fin de máster en su laboratorio. Gracias a Ana Lázaro por enseñarme cómo funciona un laboratorio de biología molecular de plantas desde cero. Aprendí muchísimo de ti. Agradecer a toda la gente del CBGP que siempre estuviera dispuesta a ayudar y que sean como una gran familia. Bea, Marta, Andrea, Blanca, Ana, Estrella, Rocío, Alfonso, Sara, Iván, Mar, Chendo… En definitiva muchas gracias a todos.
No puedo dejar de mencionar a todos mis amigos que tantos momentos he compartido con ellos en estos últimos años. Me gustaría empezar con Martita. Parece que el destino nos juntó ese primer día de Universidad y desde entonces hemos ido de la mano. Siempre estaré ahí y no importará donde estemos porque siempre te siento muy cerquita. A mis chicas Lauri y Evi. Por fin chicas se ve la luz al final del túnel. Gracias por estar siempre pendientes y preocuparos por mí. A mis cuchifletas, Alba, Ana, Andrea y
x
Terín. Me emociona tanto pensar que nos hicimos amigas cuando entramos en el cole y pasados los años el destino nos haya vuelto a juntar, parece que siempre estuvimos juntas. A mi lindo guetito, a Carlitos, Raúl, Santi y Andrés. Hacéis que me sienta orgullosa de vosotros. Con vosotros el tiempo pasa deprisa. No olvidarme de mis mosqueteras, Patri y Sofi. Juntas empezamos ese master y aunque el destino nos ha separado por toda Europa, estoy deseando tener tiempo para poder vernos todas de nuevo. A todos vosotros espero devolveros este último año, que he estado bastante desconectada.
Por último mencionar a las personas más importantes en mi vida. En primer lugar mis padres. Por ser los mejores del mundo. Por su apoyo, comprensión y ánimo en estos años. Espero que os sintáis orgullosos de mí, yo estoy tremendamente orgullosa de vosotros. Os quiero mucho.
Estás últimas palabras se las quiero dedicar a mi compañero de viaje, Keke. Sin su apoyo y amor no hubiera sido capaz. Con tú alegría y optimismo, me has alegrado en los malos momentos y me has dado la fuerza para seguir luchando. Me has ayudado hasta en el último momento. Estoy ilusionada de empezar esta nueva etapa y me emociona pensar que todo está por venir. Te quiero.
xi
ABBREVIATIONS AHA1: Activator Of HSP90 Atpase 1 ABRC: Arabidopsis Biological Resource Center BiP: Immunoglobulin Binding Protein bZIP17: Basic Leucine Zipper 17 bZIP28: Basic Leucine Zipper 28 CCT: Chaperonin-Containing TCP-1 CCT: eukaryotic chaperonin-containing TCP1 CD: C-Terminal Dimerization Domain CFU: Colony Forming Units CHIP: Terminus Of HSP70 Interacting Protein CHIP: C-terminus of HSP70 interacting protein CIRV: Carnation Italian Ringspot Tombusvirus CNXs: Calnexins
CRTs: Calreticulins CTT: Chaperonin-Containing TCP1 DPs: Aspartic Acid-Proline Domains DPs: acid-proline domains DTT: Dithiothreitol EFR: EF-Tu Receptor ER: Endoplasmic Reticulum ERAD: ER-Associated Degradation System ET: Ethylene
ETI: Effector-Triggered Immunity ETS: Effector-Triggered Susceptibility Foc: Fusarium oxysporum sp conglutinans FWL: fresh weight lost GA: geldanamycin gDNA: genomic DNA GEO: Gene Expression Omnibu GFP: Green Fluorescent Protein GO: Gene Ontology GUS: Β-Glucuronidase HIP: HSP70 Interacting Protein HIP: HSP70 interacting protein HOP: HSP70-HSP90 Organizing Protein HR: Hypersensitive Response HSE: heat shock promoter element HSFs: Heat Shock Factors HSGs: Heat Stress Granules HSP70: Heat Shock Protein 70 HSR: Heat Shock Response INRA: Versailles Arabidopsis Stock Center IRE1: Inositol-Requiring Protein-1 JA: Jasmonic Acid
xii
LAT: Long Term Acquired LB: Luria-Bertani Ler: Landsberg erecta MAMPs: Microbe-Associated Molecular Patterns MD: Middle Domain MeJA: Methyl jasmonate MS: Murashige Skoog NBD: N-Terminal Nucleotide-Binding Domain ND: N-Terminal Atpase Domain NLS: Nuclear Localization Signal NPR1: nonexpressor of PR genes 1 p23 : acidic 23-kDa protein PAMPs: Pathogen-Associated Molecular Patterns PCD: Plant Cell Death PDA:
PR: Pathogenesis-Related PR1: Pathogenesis Related 1 PRRs: Pattern Recognition Receptors Psm: Pseudomonas syringae pv. Maculicola PTI: PAMP-Triggered Immunity PVPP: poly(vinylpolypyrrolidone) QC: Protein Quality Control R: Resistance
RCA: Ribulose Biphosphate-Carboxylase Activase RIDD: Regulated IRE1-Dependent Decay Of Mrna ROS: Reactive Oxygen Species SA: Salicylic Acid SAR: Systemic Acquired Resistance SBD: C-Terminal Substrate-Binding Domain SDF2: stromal-derived factor 2 SGs: Stress Granules SHR: Steroid Hormone Receptors SR: steroid receptor STI-1: stress-inducible protein 1 TFs: transcription factors TM: Tunicamycin TMD: transmembrane domain TPR: Tetratricopeptide-Repeat TUDCA: Tauroursodeoxycholic Acid UPR: Unfolded Protein Response WGE: Wheat Germ Extract Ws: Wassilewskija
INDEX
14
Acknowdledgments……………………………………………………………………………………………………………. vii Agradecimientos………………………………………………………………………………………………………………… ix Abbreviations…………………………………………………………………………………………………………………….. xi Abstract……………………………………………………………………………………………………………………………… 19 Resumen……………………………………………………………………………………………………………………………. 21
Index
1. CHAPTER 1. GENERAL INTRODUCTION .............................................................................. 22
1.1 The challenge of environmental stresses for plants ................................................... 24
1.1.1 Abiotic stresses: Impact of heat stress on plant physiology ............................... 24
1.1.2 Biotic stresses and plant immunity ..................................................................... 25
1.2 Protein folding and cellular integrity .......................................................................... 27
1.2.1 Molecular chaperones ......................................................................................... 27
1.3 Protein folding in the ER.............................................................................................. 28
1.3.1 N-glycosylation-dependent pathway .................................................................. 28
1.3.2 N-glycosylation-independent pathway ............................................................... 28
1.4 ER stress ...................................................................................................................... 29
1.5 The Unfolded Protein Response (UPR) ....................................................................... 29
1.5.1 Inositol-requiring protein-1 (IRE1) ...................................................................... 29
1.5.2 Basic Leucine Zipper 28 (bZIP28) and Basic Leucine Zipper 17 (bZIP17) ............. 30
1.5.3 PKR-like ER kinase (PERK) .................................................................................... 31
1.6 The ER has a prominent role during plant response to environmental challenges .... 31
1.6.1 UPR activation during plant response to abiotic stresses ................................... 32
1.6.2 ER has a prominent role during response to biotic stress .................................. 32
1.7 Protein folding in the cytoplasm ................................................................................. 33
1.7.1 Heat shock protein 70 (HSP70) family ................................................................. 34
1.7.2 Heat shock protein 90 (HSP90) family ................................................................. 35
1.7.3 HSP70 and HSP90 as regulators of HSR ............................................................... 35
1.8 Role of HSP70 and HSP90 in the response to abiotic and biotic stresses ................... 36
1.9 HSP70-HSP90 complex ................................................................................................ 37
1.10 HOP proteins ............................................................................................................... 37
1.10.1 The role of HOP in other eukaryotes ................................................................... 38
1.10.2 The role of HOP in plants .................................................................................... 40
2. CHAPTER 2. OBJECTIVES ..................................................................................................... 42
3. CHAPTER 3. MATERIALS AND METHODS ............................................................................ 46
3.1 Biological material ....................................................................................................... 48
INDEX
15
3.1.1 Plant material and growth conditions ................................................................. 48
3.1.2 Phytopathogens employed, storage and growth conditions .............................. 48
3.1.3 Escherichia coli and Agrobacterium tumefaciens strains used in this study ...... 49
3.1.4 Escherichia coli and Agrobacterium tumefaciens transformation ...................... 49
3.1.5 Arabidopsis thaliana transformation .................................................................. 49
3.1.6 Transient expression of proteins in N. benthamiana leaves ............................... 49
3.2 Constructs and molecular cloning ............................................................................... 49
3.3 Nucleic acid extraction and analysis ........................................................................... 50
3.3.1 gDNA and RNA isolation ...................................................................................... 50
3.3.2 Electrophoresis of DNA and RNA samples .......................................................... 50
3.4 Gene expression analysis by quantitative real-time PCR (qRT-PCR) ........................... 50
3.5 RNA-sequencing (RNA-seq) analysis ........................................................................... 50
3.6 Biochemical techniques for protein analysis .............................................................. 51
3.6.1 Immunoprecipitation analyses in N. benthamiana ............................................. 51
3.6.2 Immunoprecipitation analysis in Arabidopsis ..................................................... 52
3.6.3 Western-blot analysis .......................................................................................... 52
3.6.4 Insoluble protein isolation and Western-blot ..................................................... 52
3.7 Two-hybrid analyses .................................................................................................... 53
3.8 Phenotypic analysis ..................................................................................................... 53
3.8.1 Chemical treatments ........................................................................................... 53
3.8.2 Long-term thermotolerance assays .................................................................... 53
3.8.3 Analysis of plant response to phytopathogens infection and disease monitoring ………………………………………………………………………………………………………………………..54
3.8.4 Analysis of physiological parameters .................................................................. 55
3.9 Histological analysis .................................................................................................... 55
3.9.1 Determination of β-glucuronidase (GUS) activity ............................................... 55
3.9.2 Determination of cell death by Trypan blue staining .......................................... 55
3.9.3 Determination of H2O2 production by 3,3’-Diaminobenzidine (DAB) staining ... 55
3.10 Microscopy analyses ................................................................................................... 55
3.11 Other informatics resources and bioinformatics tools used in this study .................. 56
4. CHAPTER 4. HOP3, A MEMBER OF THE HOP FAMILY IN ARABIDOPSIS, INTERACTS WITH BiP AND PLAYS A MAJOR ROLE IN THE ER STRESS RESPONSE .......................................................... 58
4.1 INTRODUCTION ........................................................................................................... 60
4.2 RESULTS ....................................................................................................................... 62
4.2.1 HOP3 is expressed in different tissues ................................................................ 62
4.2.2 HOP3 interacts with HSP90, HSP70 and unexpectedly with the ER resident chaperone BiP ..................................................................................................................... 63
INDEX
16
4.2.3 HOP3 interacts with the ATPase binding domain of BiP ..................................... 64
4.2.4 HOP3 is localized in the cytoplasm and the ER ................................................... 65
4.2.5 HOP3 is induced during the UPR and its expression is controlled by IRE1 ......... 66
4.2.6 HOP3 has a major role during the ER stress response ........................................ 67
4.2.7 The hop3-1 hypersensitive phenotype to ER stress is not due to a general misactivation of the UPR transcriptional cascade ............................................................... 69
4.2.8 The addition of TUDCA reverts the hop3-1 sensitivity to ER stress agents ......... 70
4.3 DISCUSSION ................................................................................................................. 70
4.3.1 HOP3, a member of the HOP family in Arabidopsis, has an unexpected role in the ER stress ........................................................................................................................ 70
4.3.2 HOP3 interacts with BiP and may assist BiP during the alleviation of the ER stress response .................................................................................................................... 71
4.3.3 Consistent with its role in the ER stress response, HOP3 is partially localized at the ER ……………………………………..…………………………………………………………………………………72
4.3.4 HOP3 is induced during the UPR elicited by chemical inducer agents and at specific stages of plant development .................................................................................. 72
4.3.5 Within the AtHOP family, HOP3 per se is required for the proper establishment of the ER stress response in plants ..................................................................................... 73
4.4 SUPPLEMENTAL DATA ................................................................................................. 74
5. CHAPTER 5. HOP3 A COCHAPERONE INVOLVED IN PLANT IMMUNITY .............................. 76
5.1 INTRODUCTION ........................................................................................................... 80
5.2 RESULTS ....................................................................................................................... 82
5.2.1 HOP3 is involved in plant defense response against Botrytis cinerea in Arabidopsis .......................................................................................................................... 82
5.2.2 HOP3 is necessary for the effective defense against Fusarium oxysporum in Arabidopsis .......................................................................................................................... 84
5.2.3 HOP3 interacts with COI1 .................................................................................... 85
5.2.4 HOP3 is involved in plant response to JA ............................................................ 86
5.2.5 HOP3 is involved in plant defense response against Pseudomonas syringae pv tomato DC3000 (Pst DC3000) ............................................................................................. 87
5.3 DISCUSSION ................................................................................................................. 90
5.3.1 HOP3 is involved in defense response against B. cinerea ................................... 90
5.3.2 HOP3 is required for resistance to Foc ................................................................ 91
5.3.3 HOP3 is involved in JA-mediated defense response and interacts with COI1 .... 91
5.3.4 HOP3 is involved in defense response to Pst DC3000 ........................................ 92
6. CHAPTER 6. HOP FAMILY PLAYS A MAJOR ROLE IN LONG TERM ACQUIRED THERMOTOLERANCE IN ARABIDOPSIS AFFECTING THE HSR AND PROTEIN QUALITY CONTROL 96
6.1 INTRODUCTION ........................................................................................................... 98
INDEX
17
6.2 RESULTS ..................................................................................................................... 100
6.2.1 The members of the AtHOP family show different induction under heat ........ 100
6.2.2 AtHOP3 is highly regulated by heat and during the early events leading to recovery ………………………………………………………………………………………………………………………100
6.2.3 Despite its fine regulation, HOP3 alone does not seem to be essential for the establishment of long-term acquired thermotolerance in Arabidopsis ........................... 102
6.2.4 The three members of the HOP family act redundantly during the acquisition of long-term thermotolerance in Arabidopsis ...................................................................... 103
6.2.5 HOP forms complexes with different proteins under heat stress conditions ... 105
6.2.6 HOPs change their subcellular localization under heat stress .......................... 105
6.2.7 HOPs have a main role in the proper establishment of the transcriptional response to heat in Arabidopsis ........................................................................................ 108
6.2.8 The absence of AtHOPs leads to misregulation of some Hsf1A/B/D/E and HsfA2-dependent genes during the heat challenge .................................................................... 109
6.2.9 AtHOP3 forms a complex with Hsf1A under heat stress conditions ................. 110
6.2.10 AtHOPs also participate in the tight control of transcription under control conditions .......................................................................................................................... 111
6.2.11 hop1 hop2 hop3 phenotype is also associated with a QC failure ..................... 111
6.3 DISCUSSION ............................................................................................................... 113
6.3.1 HOP3 is highly induced by heat, but HOP1 and HOP2 act redundantly with HOP3 during LAT ......................................................................................................................... 113
6.3.2 AtHOPs interact very tightly with HSP90 under heat stress conditions............ 113
6.3.3 Part of the HOP bulk is localized to the nucleus in response to heat ............... 113
6.3.4 Localization of HOP to SGs ................................................................................ 114
6.3.5 HOP seems to participate along with HSP90 in the attenuation of the HSR in plants ………………………………………………………………………………………………………………………114
6.3.6 A defect in QC is observed in the hop1 hop2 hop3 triple mutants during heat treatments ......................................................................................................................... 116
6.4 SUPPLEMENTAL DATA ............................................................................................... 118
7. CHAPTER 7. GENERAL CONCLUSIONS ............................................................................... 124
8. CHAPTER 8. PUBLICATIONS ............................................................................................... 128
9. CHAPTER 9. REFERENCES.................................................................................................. 132
ABSTRACT
19
ABSTRACT HSP70-HSP90 organizing protein (HOP) is a conserved family of cytosolic cochaperones, whose role as scaffolding proteins of the chaperones HSP70 and HSP90 has been profusely studied in mammals and yeast. Although HOP family is also conserved in plants, their involvement in different protein complexes and their biological role in plant physiology has remained extremely elusive.
Arabidopsis genome codes for three AtHOP proteins, AtHOP1, AtHOP2 and AtHOP3. In an attempt to determine the possible role of these proteins in response to different stresses, we started with the characterization of AtHOP3. HOP3 interacts in vivo with cytosolic HSP90 and HSP70, and, unexpectedly, with binding immunoglobulin protein (BiP), a member from the HSP70 family located in the endoplasmic reticulum (ER). Consistent with this interaction with BiP, HOP3 is partially localized at the ER. Moreover, HOP3 is induced both at transcript and protein levels by unfolded protein response (UPR) inducer agents by a mechanism dependent on inositol-requiring enzyme 1 (IRE1). Importantly, hop3 loss-of-function mutants show a reduction in pollen germination and a hypersensitive phenotype in the presence of ER stress inducer agents, a phenotype that is reverted by the addition of the chemical chaperone tauroursodeoxycholic acid (TUDCA). All these data demonstrate, for the first time in any eukaryote, a main role of HOP as an important regulator of the ER stress response.
ER stress response is a process intimately associated with important specific developmental programs and to environmental stress sensing and response in plants, such as during pathogen infection. Therefore, we have studied the involvement of HOP3 in plant defense response to different phytopathogens, specifically, to the necrotrophic fungus Botrytis cinerea, the vascular and hemibiotrophic fungus Fusarium oxysporum sp conglutinans and the hemibiotrophic bacteria Pseudomonas syringae pv. tomato DC3000. This study demonstrates that HOP3 is required for the establishment of the defense response to these different pathogens. In addition, we have demonstrated that HOP3 interacts with CORONATINE INSENSITIVE1 (COI1) in the yeast two-hybrid system and that the hop3-1 loss-of-function mutant shows a reduced sensitivity to MeJA. These data indicate that HOP3 is required for jasmonic acid (JA) signaling in plants.
Finally, we have characterized the molecular role of the different members of the AtHOP family in thermotolerance. This analysis demonstrates that the three members of this family play a redundant role in the acquisition of long-term thermotolerance in Arabidopsis. Additionally, our data show that these proteins interact strongly with HSP90 and that part of the bulk of HOP shuttles from the cytoplasm to cytoplasmic foci and to the nucleus in response to heat stress. Consistent with this latter location and with the formation of a HOP complex with the heat shock factor HsfA1a, the heat shock response is altered in the hop1 hop2 hop3 triple mutant. This triple mutant also displays an unusual high accumulation of insoluble and ubiquitinated proteins under the heat challenge. These data reveal that HOPs are involved in two different aspects of the response to heat: the maintenance of protein homeostasis and the proper establishment of heat shock response, affecting the plant capacity to acclimate to heat stress for long periods.
The data presented in this Thesis provides new evidences for the essential role of different members of the HOP family in response to different environmental stresses.
RESUMEN La proteína organizadora de HSP70 y HSP90 (HOP) es una familia conservada de cochaperonas citosólicas, cuyo papel como proteína de andamio de las chaperonas HSP70 y HSP90 se ha estudiado profundamente en mamíferos y levaduras. A pesar de que la familia HOP también se conserva en plantas, su participación en la formación de diferentes complejos de proteínas y su papel biológico en la fisiología de las plantas se ha mantenido extremadamente difícil de elucidar.
El genoma de Arabidopsis codifica tres proteínas HOP: AtHOP1, AtHOP2 y AtHOP3. En un intento de determinar el posible papel de estas proteínas en respuesta a diferentes estreses, hemos comenzado con la caracterización de AtHOP3. HOP3 interactúa in vivo con HSP90 y HSP70 citosólicas, e inesperadamente con la proteína inmunoglobulina (BiP), un miembro de la familia HSP70 que se localiza en el retículo endoplámico (RE). Concordante con esta interacción con BiP, HOP3 se localiza parcialmente en el RE. Por otra parte, HOP3 se induce tanto a nivel transcripcional y traduccional por la respuesta a proteínas desplegadas (“Unfolded Protein Response” (UPR), en inglés) mediante un mecanismo dependiente de la enzima “Inositol-requiring enzyme 1” (IRE1). Es importante destacar que los mutantes de pérdida de función de HOP3 muestran una reducción en la germinación de polen y un fenotipo hipersensible en presencia de agentes inductores de estrés asicado a RE, un fenotipo que se revierte al estar presente la chaperona química, ácido tauroursodeoxicólico (TUDCA). Todos estos datos demuestran, por primera vez en eucariotas, un papel principal de HOP como un importante regulador de la respuesta de estrés del RE.
La respuesta al estrés celular relacionado con el RE es un proceso íntimamente asociado a importantes programas específicos de desarrollo y durante la percepción del estrés medioambiental y la consecuente respuesta en plantas, como ocurre durante la infección por patógenos. Por lo tanto, hemos estudiado la implicación de HOP3 en la respuesta de defensa de las plantas a diferentes fitopatógenos, específicamente, al hongo necrotrófo Botrytis cinerea, el hongo vascular y hemibiotrófo Fusarium oxysporum sp conglutinans y la bacteria hemibiotrófa Pseudomonas syringae pv. tomato DC3000. Este estudio demuestra que HOP3 es necesario para un correcto establecimiento de la respuesta de defensa a estos diferentes patógenos. Además, hemos demostrado que HOP3 interacciona con la proteína CORONATINE INSENSITIVE1 (COI1) mediante un ensayo de doble híbrido en levaduras y que el mutante con pérdida de función de HOP3 muestra una sensibilidad reducida a un precursor de ácido jasmónico (JA). Estos datos indican que la proteína HOP3 es necesaria para la señalización mediada por JA en plantas.
Por último, hemos caracterizado el papel molecular de los diferentes miembros de la familia AtHOP en termotolerancia. Este análisis demuestra que los tres miembros de esta familia desempeñan un papel redundante en la adquisición de termotolerancia a largo plazo en Arabidopsis. Además, nuestros datos muestran que estas proteínas interactúan fuertemente con HSP90 y que en respuesta al estrés por calor, una fracción de HOP cambia su localización subcelular del citoplasma a gránulos citoplasmáticos y se transloca al núcleo. Consistente con esta última ubicación y con la formación de un complejo entre HOP y el factor de choque térmico HsfA1a, el triple mutante hop1 hop2 hop3 muestra una respuesta al choque térmico alterada. Este triple mutante también muestra una inusualmente alta acumulación de proteínas insolubles y ubiquitinadas bajo el estrés por calor. Estos datos revelan que las proteínas HOPs están involucradas en dos aspectos diferentes de la respuesta al calor: el mantenimiento de la homeostasis proteica y en el establecimiento adecuado de la respuesta al choque térmico, afectando la capacidad de la planta para aclimatarse al estrés por calor durante largos períodos de tiempo.
Los datos presentados en esta Tesis proporcionan nuevas evidencias para comprender el papel esencial de los diferentes miembros de la familia HOP de Arabidopsis en respuesta a diferentes estreses medioambientales
1. CHAPTER 1. GENERAL INTRODUCTION
CHAPTER 1
24
General Introduction
1.1 THE CHALLENGE OF ENVIRONMENTAL STRESSES FOR PLANTS
Plants, as sessile organisms, are constantly exposed to a wide spectrum of stress conditions and are forced to adapt to them in order to complete their life cycle. For this reason, they have developed complex mechanisms to accurately detect and respond to environmental changes, minimizing the stress damage while conserving valuable resources for growth and reproduction.
In plant physiology, the term ‘stress’ can be defined as any stimulus that negatively affects plant growth, development or reproduction. In their natural environment, plants face a wide range of stresses that can be divided into two main categories: abiotic stresses (resulting from physical and chemical factors such as drought, extreme temperatures, salinity or pollutants, etc.) and biotic stresses (resulting from their negative interaction with other living organisms, such as fungi and insects).
These two types of stresses also affect crop production, causing millionaire economic losses each year (Bita and Gerats, 2013). This current situation may even worsen because of climate change, as predictions foresee temperature increases in many areas of the globe, with waves of heat and drought occurring more often and lasting longer. These climatic conditions are not only expected to harden the effects of abiotic stresses but also to facilitate pathogen spread affecting the habitat of pest and pathogens (Elad et al 2014). Besides climate change, the world must also face the major problem of food security in the coming years. This challenge will require an important increase in food production to meet the demand to feed an expected population of 9 billion in 2050 (Bita and Gerats, 2013). In light of this distressing scenario, the Food and Agriculture Organization of the United Nations (FAO) recommends the development and use of new crop varieties better adapted to environmental challenges (FAO, 2010); an approach that can only be reached from the precise knowledge of how plants respond and adapt to both abiotic and biotic stresses.
1.1.1 Abiotic stresses: Impact of heat stress on plant physiology
Abiotic stresses are responsible for significant economic losses in crop production worldwide. In fact, it has been estimated that these stresses can reduce to 50% the theoretical estimates of crop yield (Wang et al., 2003).
Among different abiotic stresses, drought and extreme heat have the most devastating effects on crop yield and quality (Kang et al., 2009). Specifically, heat stress has caused important reductions in crop production in the last three decades. For example, heat-related losses reached more than 1 billion dollars in USA in 2011 (data from the United States Environmental Agency, EPA).
Because plants cannot escape the heat, they have developed different mechanisms to survive under elevated temperatures in a process called thermotolerance. In general terms, most
CHAPTER 1
25
plants display two main mechanisms of thermotolerance: 1) Basal thermotolerance, which defines the inherent ability of plants to survive to temperatures above their optimal for growth and 2) acquired thermotolerance, which refers to the capacity to cope with otherwise lethal temperatures by prior exposure to a conditioning treatment, which may be a exposure to a sublethal temperature or to a moderate stress (Larkindale et al., 2005). This latter mechanism is critical for plant homeostasis, since it allows plants to cope with large temperature fluctuations and high-temperature changes between seasons (Hong et al., 2003; Larkindale and Vierling, 2008).
Heat stress is a complex trait whose effects on plant physiology depend on different aspects as heat intensity and duration or the plant developmental stage, among others (Ahsan et al., 2010; Larkindale et al., 2005; Larkindale and Vierling, 2008; Wahid et al., 2007). In general terms, plant exposure to high temperatures induces the generation of reactive oxygen species (ROS) and modifies plant membrane fluidity, compromising its physiology and metabolism (Camejo et al., 2006; Hofmann, 2009; Weis and Berry, 1988). In addition, heat increases the free energy of proteins imposing changes in their conformation that usually lead to general protein dysfunction and degradation. Since protein degradation targets proteins involved in photosynthesis- and chlorophyll- biosynthesis (Echevarria-Zomeno et al., 2016), one of the main effects associated with heat is the reduction of plant photosynthetic activity. This reduction, along with the modification of the primary and secondary metabolisms, affects cell division and growth (Luo et al., 2011). High temperatures also cause detrimental effects on different aspects of plant reproduction such as pollen viability and germination rate. Even more, severe treatments can lead to the irreversible inhibition of protein translation and induce plant death (Echevarria-Zomeno et al., 2016).
Although the exact mechanisms involved in the perception of heat stress remain unclear in plants, it is widely accepted that one of the most significant molecular responses to heat is the activation of the heat stress response (HSR). This response, which will be addressed in more depth in a later section, aims at alleviating the damage caused by heat through the transcriptional induction of genes involved, among other processes, in protein folding, plant photosynthesis preservation and ROS signaling.
1.1.2 Biotic stresses and plant immunity
In addition to abiotic stresses, plants also face the infection by different pathogens (as bacteria, fungi, viruses and nematodes) as well as the attack of insect and herbivore pests, which cause important losses in yield and quality (Atkinson and Urwin, 2012).
Plants defense mechanisms are constitutive and inducible by the presence of the pathogen. The basal or constitutive defense barriers are non-specific and include both physical barriers (such as the cuticle) and chemical barriers (antimicrobial compounds with a direct toxic effect on the pathogens), preventing the penetration of the pathogen and delaying the infection process at early stages (Malinovsky et al., 2014; Osbourn, 1996; VanEtten et al., 1994; Wittstock and Gershenzon, 2002).
Additionally, plants have evolved a more sophisticated inducible immune system, activated only in the presence of the pathogen, which allows plants to recognize pathogens to initiate effective defense responses. The first kind of defense response produces an innate or non-
CHAPTER 1
26
adaptative response, activated upon recognition of non-specialized microorganisms. The perception of the pathogen is made through the recognition of non-specific pathogen or microbe-associated molecular patterns (PAMPs or MAMPs respectively), conserved on whole classes of pathogens, such as bacterial flagellin or the fungal chitin (Newman et al., 2013). Plants recognize those molecular patterns by trans-membrane pattern recognition receptors (PRRs) (Zipfel, 2008; Zipfel, 2014). The recognition of PAMPs by PRRs leads to activation of the PAMP-triggered immunity (PTI), preventing pathogen penetration and further attack (Schwessinger and Zipfel, 2008). A second and more sophisticated kind of defense response allows plant recognition of specific pathogens. This response is called host resistance or adaptive immune response, which is developed through the continuous contact between the plant and the pathogen. In this process successful pathogens secrete effector proteins that deregulate plant innate immunity responses, contributing to pathogen virulence. This pathogen action interferes with PTI, resulting in an effector-triggered susceptibility (ETS) (Jones and Dangl, 2006; Pieterse et al., 2009). Plants recognize these specific pathogen effectors by intracellular specific receptors, activating a second and more robust immune response called effector-triggered immunity (ETI) (Cui et al 2015) (Figure 1.1). ETI is accompanied by a localized programmed cell death (PCD), which consists of a high accumulation of reactive oxygen species (ROS). This response is called hypersensitive response (HR) (Chisholm et al., 2006; Jones and Dangl, 2006). ETI also produces the propagation of a distal defense response, known as systemic acquired resistance (SAR), a long-term resistance dependent on salicylic acid (SA) pathway (Durrant and Dong, 2004).
Figure 1.1. Schematic model of plant immune system. Upon pathogen attack, PAMPs such as flagellin or chitin activate PRRs in the host, resulting in a downstream signalling cascade that leads to PTI response. Specialized and successful pathogens can suppress the PTI by releasing effectors into host cells, resulting in ETS. To counteract ETS, plants have evolved R proteins that recognize and block these specific effectors, triggering ETI response and disease resistance. The activation of effective defense responses depends strongly on the regulation of gene expression
CHAPTER 1
27
mediated by the plant hormones SA, ET and JA (shown in circles). These signal transduction pathways allow the expression of defensive genes, such as PR1 or PDF1.2 by different subsets of transcription factors (TFs), such as ERFs or WRKYs.
In parallel, ETI regulates also the transcriptional induction of pathogenesis-related (PR) genes activated by phytohormones, as salicylic acid (SA), jasmonic acid (JA) and ethylene (ET) (Bari and Jones, 2009; del Pozo et al., 2004; Denance et al., 2013; Loake and Grant, 2007; van Loon et al., 2006).
Usually, SA positively regulates the immunity response against biotrophic and hemibiotrophic pathogens, such as Pseudomonas syringae pv tomato DC3000 (Pst DC3000), while ET /and JA pathways activate defense responses against necrotrophic pathogens, such as Botryitis cinerea fungus, existing many exceptions (Bari and Jones, 2009; del Pozo et al., 2004; Denance et al., 2013; Jiang et al., 2010; Loake and Grant, 2007; van Loon et al., 2006) (Antico CJ, 2012). This network of signals is also interconnected and the activation of SA pathway is known to interfere with JA and ET pathway and vice-versa, making defense response signaling quite complex (Berrocal-Lobo et al., 2002; El Oirdi et al., 2011; Pieterse et al., 2009; Wang et al., 2017b).
1.2 PROTEIN FOLDING AND CELLULAR INTEGRITY
Proteins have a great diversity of enzymatic functions and structural properties, determining every aspect of life. In order to carry out these functions, proteins must adopt a suitable native structure to allow optimal activity and protein interactions (Bartlett and Radford, 2009). For this reason, misfolded proteins usually show impaired function (Hartl et al., 2011). In addition, they tend to inappropriately interact with other cellular components, forming aggregates that result toxic to the cell (Muchowski, 2002).
Besides correct protein folding is a prerequisite for ensuring cellular growth and organism development, protein folding has a critical role in plant adaptation to environmental challenges. It has to be noted that during the response to both abiotic and biotic stresses, the requirement for the massive production of stress-related proteins usually exceeds the folding capacity, leading to an accumulation of misfolded proteins in the cell (Nakajima and Suzuki, 2013; Saijo et al., 2009; van Loon et al., 2006).
1.2.1 Molecular chaperones
As cited above, proteins have to fold into a native structure to become functional. Despite it was initially assumed that this process was accomplished in a spontaneous process (Hartl et al., 2011; Hartl and Martin, 1995), this view was extensively revised after the discovery of molecular chaperones (Ellis, 1987; Gething and Sambrook, 1992; Kim et al., 2013b)
Molecular chaperones can be defined as proteins that interact, stabilize or help other proteins to acquire their active conformation, without being present in the final structure (Ellis, 1987). These proteins bind to emerging peptides during protein synthesis and assist different steps of folding (Frydman, 2001; Hartl, 1996). In addition, molecular chaperones are responsible for dictating the balance between folding, degradation and aggregation in a process known as protein quality control (QC). During QC, chaperones avoid the toxic accumulation of unfolded
CHAPTER 1
28
proteins in the cell by promoting protein re-folding. However, if the proper conformation is not finally achieved, chaperones recognize and target misfolded proteins for proteasome degradation (Houck et al., 2012). Finally, it has recently been reported that chaperones can also mitigate cell toxicity by sequestering aberrant proteins in specialized compartments (Kaganovich et al., 2008).
Protein folding takes place mainly in two different compartments: the endoplasmic reticulum (ER) and the cytoplasm. In these compartments, unfolded protein-perception, -signaling and -response are carried out by different sets of specialized proteins. (Buchberger et al., 2010).
1.3 PROTEIN FOLDING IN THE ER
ER is a complex system of membranes, which extends through the cell, reaching the vicinity of the plasma membrane (Wang et al., 2017a). ER is organized into two morphological and functional domains: the rough ER and the smooth ER. ER hosts the synthesis and folding of membrane and secreted proteins (Voeltz et al., 2002). These proteins are synthesized by the ribosomes attached to the rough ER and are deposited in the ER lumen. They eventually progress through the smooth ER to reach their final destination in the cell (Vitale and Denecke, 1999).
Protein folding in the ER is achieved by a complex orchestra of ER-located chaperones, lectins and foldases that help proteins to acquire their mature form (Gidalevitz et al., 2013). ER-protein folding depends on two pathways: the N-glycosylation-dependent and the N-glycosylation-independent pathways.
1.3.1 N-glycosylation-dependent pathway
Most proteins that are targeted to the secretory pathway contain in their sequences N-glycosylation sites (Asn-X-Ser/Thr). These glycosylation sites are recognized as soon as the nascent proteins enter the ER lumen and lead to a protein modification process known as N-glycosylation (Hammond et al., 1994). This modification involves the addition of oligosaccharides linked to lipid carriers at the Asn residue of the glycosylation sites. The presence of these oligosaccharide allows the loading of the chaperones calnexins (CNXs) and calreticulins (CRTs) (Crofts et al., 1998; Huang et al., 1993; Michalak et al., 2009). In addition, they play an essential role in QC, since their modification reflects the protein folding status and serve as markers for the exit or maintenance of proteins in the CNX/CRT cycle or for their degradation (Caramelo and Parodi, 2008; Ware et al., 1995).
1.3.2 N-glycosylation-independent pathway
Apart from CNX and CRT, another main player in protein folding in the ER is the Immunoglobulin Binding Protein (BiP) (Hendershot, 2004). This chaperone recognizes and binds to exposed hydrophobic peptides that are usually buried inside the final protein structure.
BiP belongs to the Heat Shock Protein 70 (HSP70) protein family, and therefore, its ability to bind, fold and release unfolded proteins is tightly regulated by a cycle of ATP binding, hydrolysis and nucleotide exchange (Awad et al., 2008).
CHAPTER 1
29
BiP is the most abundant chaperone in the ER and is involved in all aspect of protein folding in this compartment: BiP is required for protein translocation of newly synthesized polypeptides through the ER membrane (Matlack et al., 1999; Plemper et al., 1997). In addition, BiP assists the folding of non-glycosylated proteins and tags unfolded proteins for proteasomal degradation (Kabani et al., 2003; Nishikawa et al., 2005; Steel et al., 2004).
Arabidopsis genome encodes three BiP members: BiP1, BiP2, and BiP3 (Noh et al., 2003). AtBiP1 and AtBiP2 are constitutively expressed and code for proteins with 99% amino acid identity, whereas AtBiP3 encodes a less conserved protein whose expression is highly upregulated by different stresses (Iwata et al., 2010; Noh et al., 2003).
1.4 ER STRESS
Protein folding demand and capacities are usually in equilibrium at the ER. However, during different developmental processes and under stressful conditions, the demand for protein folding usually exceeds the ER capacity, leading to a high accumulation of misfolded proteins that cause the so-called ER stress. ER stress is potentially lethal and, therefore, the efficiency to overcome this imbalance is crucial for maintaining ER homoeostasis and cell survival.
1.5 THE UNFOLDED PROTEIN RESPONSE (UPR)
Since cells should maintain ER function to assure protein homeostasis, they have evolved a sophisticated program, the UPR, to preserve ER activity under ER stress. UPR is a highly conserved process that promotes the transcriptional expression of genes involved in protein folding and in the removal of unfolded proteins by the ER-associated degradation system (ERAD) (Deng et al., 2013; Howell, 2013; Liu and Howell, 2010b; Liu and Howell, 2016; Ruberti and Brandizzi, 2014; Ruberti et al., 2015; Urade, 2007; Williams et al., 2014). In mammals, the activation of the UPR upon ER stress depends on the activity of three signaling mechanisms: IRE1, ATF6 and PERK, while the PERK branch seems to be missed in plants (Chakrabarti et al., 2011) (Figure 1.2).
1.5.1 Inositol-requiring protein-1 (IRE1)
IRE1 was primarily identified in yeast (Cox et al., 1993; Mori et al., 1993), and, from this point onwards, homologues were identified in different species of animals and plants (Koizumi et al., 2001; Wang et al., 1998). Arabidopsis contains two IRE1 genes (IRE1a and IRE1b), both of which are functionally redundant (Nagashima et al., 2011)
Structurally, IRE1 is a transmembrane protein with an RNAse domain on its cytoplasmic surface and a C-terminal domain, which serves as an ER-stress sensor facing the lumen (Chen and Brandizzi, 2013) (Figure 1.2). In mammals, IRE1 monomers associate to BiP under control conditions. Upon ER stress, IRE1 activation depends on BiP disassociation, which allows IRE1 dimerization or oligomerization in response to stress (Li et al., 2010). Despite IRE1 has been reported to oligomerize in Arabidopsis (Deng et al., 2013), the mechanism for IRE1 activation and of its possible dependence on BiP is not fully understood in plants.
The function of IRE1 in UPR activation is well conserved among eukaryotes. In plants, IRE1 promotes the unconventional splicing of bZIP60 mRNA under ER stress. The unspliced form of bZIP60 codes for a protein that contains a “functional” bZIP transcription factor fused to a transmembrane domain (TMD), which anchors this full-length protein in the ER membrane
CHAPTER 1
30
(Figure 1.2). Upon ER stress, IRE1 is activated, cleaving out a small intron in the bZIP60 mRNA. This splicing leads to a frameshift that removes the TMD from the protein (Deng et al., 2011; Nagashima et al., 2011). This short (but active) bZIP60 protein is now able to translocate to the nucleus where it promotes the transcriptional activation of the UPR cascade (Martinez and Chrispeels, 2003).
In addition to its role in the establishment of UPR, IRE1 also promotes mRNA degradation under severe stress in a process known as IRE1-dependent decay of mRNA (RIDD) (Mishiba et al., 2013). Since this degradation is mainly exerted on mRNAs ready to be translated and translocated to the ER, RIDD also impinges on ER stress alleviation by the reduction of protein load in the ER (Deng et al., 2013).
1.5.2 Basic Leucine Zipper 28 (bZIP28) and Basic Leucine Zipper 17 (bZIP17)
bZIP28, as its orthologue ATF6 in mammals, is a major ER stress sensor in plants (Urade, 2007; Vitale and Boston, 2008). Full-length bZIP28 also contains a bZIP domain and a TMD (Liu et al., 2007a). Under control conditions, bZIP28 localizes to the ER membrane and binds to BiP (Srivastava et al., 2013). However, when the amount misfolded proteins increases in the ER, BiP is competed away and disassociates from bZIP28. bZIP28 is then translocated to the Golgi apparatus, where it is proteolytically processed by the subtilisin-related protease S2P (Iwata et al., 2017). This proteolysis removes the TMD, generating an activated bZIP28 form (Iwata et al., 2017; Liu et al., 2007a; Srivastava et al., 2012; Srivastava et al., 2013). This active bZIP28 relocates to the nucleus where it binds, along with NF-Y transcription factors, to specific cis-elements in the promoters of ER stress-responsive genes (Liu and Howell, 2010a; Srivastava et al., 2014) (Figure 1.2).
Figure 1.2. A schematic illustration of UPR activation in plants.
CHAPTER 1
31
Under control conditions bZIP60 and IRE1 are anchored in the ER membrane through their transmembrane domains (TMD). Despite the exact mechanism that leads to IRE1 activation remains unknown in plants (red question mark), it is well established that IRE1 mediates the splicing of bZIP60 mRNA (bZIP60u) under ER stress, removing a short intron (1). The resultant spliced form (bZIP60s) encodes a protein that contains a bZIP domain and a trans-activation domain (AD) but that lacks the TMD. This protein is then transported to the nucleus to induce the expression of UPR responsive genes. Moreover, IRE1 also seems to catalyze specific mRNA degradation (RIDD) in Arabidopsis (2), alleviating ER stress by reducing the load of proteins to be folded in this compartment. In addition, bZIP28 localizes at the ER membrane and binds to BiP under control conditions. However, under ER stress, BiP dissociates from bZIP28. bZIP28 is then translocated to the Golgi apparatus where it is proteolytically processed by the protease S2P(3), removing its TMD. Analogously to bZIP28, bZIP17 is synthesized as a precursor protein that is anchored in the ER membrane under control conditions. During ER stress, bZIP17 is proteolytically cleaved by S1P and S2P in the Golgi apparatus (4), releasing to the cytoplasm the activated bZiP domain. Both bZIP28 and bZIP17 are translocated to the nucleus where they bind to the promoters of the UPR responsive genes (5). It has been proposed that bZIP60, bZIP28 and bZIP17 act in concert with other TFs in the activation of the UPR. This has been studied in more depth in the case of bZIP28 that binds along with to different members of the NF-Y family to the promoters of the UPR responsive genes.
Interestingly, plant genomes encode a third membrane-associated transcription factor involved in the establishment of the UPR, bZIP17 (Liu et al., 2007b). As in the case of bZIP28, bZIP17 is synthesized as a precursor protein anchored in the ER membrane (Figure 1.2). During ER stress, bZIP17 is proteolytically cleaved by S1P and S2P, generating an activated transcription factor, which enters the nucleus to promote the transcriptional activation of UPR related genes (Liu et al., 2008) (Figure 1.2).
Despite the observed overlap among the genes regulated by bZIP60 and bZIP28, the activation of these transcription factors seems sequential since the bZIP60 expression is dependent on bZIP28 function (Iwata et al., 2008; Iwata and Koizumi, 2005; Liu and Howell, 2010a).
1.5.3 PKR-like ER kinase (PERK)
Mammals have a third ER stress sensor that depends on the activation of the protein kinase PERK. Upon ER stress, PERK phosphorylates the α subunit of the eukaryotic translation initiation factor 2 (eIF2α), blocking protein translation (Harding et al., 1999). No PERK orthologues have been identified in the plant genomes sequenced to date, and therefore, it is completely unclear whether a similar mechanism of translational repression could be involved in ER stress alleviation in plants.
1.6 THE ER HAS A PROMINENT ROLE DURING PLANT RESPONSE TO ENVIRONMENTAL CHALLENGES
Besides its main role as the gateway to the secretory pathway, the ER is also a central regulator of plant adaptation to abiotic and biotic threats. In general terms, it has been speculated that, under environmental stresses, the strong demand for folding of proteins involved in the stress response exceeds the folding capacity of the ER, leading to ER stress (Liu and Howell, 2010b; Moreno and Orellana, 2011). This hypothesis is supported by the observation that UPR is activated under different stress conditions and that mutants in different components of the ER stress response (sensors, chaperones and co-chaperones)
CHAPTER 1
32
display an altered reaction to different biotic and abiotic threats (Korner et al., 2015; Liu and Howell, 2010b; Moreno and Orellana, 2011).
1.6.1 UPR activation during plant response to abiotic stresses
As stated above, different evidences support UPR activation during plant adaptation to abiotic challenges. In fact, different abiotic stresses as heat, salt and drought promote the induction of UPR-reporter genes through the activation of specific UPR arms (Wang et al., 2010; Wang et al., 2011). Specifically, it was recently demonstrated that heat stress induces AtbZIP60 splicing and bZIP28 proteolytic activation (Deng et al., 2011) (Gao et al., 2008). In addition, this challenge also triggers the translocation of both AtbZIP17 and AtbZIP28 to the nucleus (Che et al., 2010). Similarly, salt stress promotes AtbZIP17 proteolysis by S1P and the activation of bZIP17-dependent UPR arm (Liu et al., 2007b). Consistent with the main role of these sensors in the acquisition of plant stress tolerance, bzip28 mutant displays salt- and heat-hypersensitive phenotypes while s1p and bzip17 mutants show an enhanced sensitivity to salt (Gao et al., 2008; Liu et al., 2007b). In addition, overexpression of bZIP60 results in increased tolerance to saline stress (Fujita et al., 2007).
Besides the main role of the different ER sensors, UPR downstream targets also seem to play an essential role in abiotic stress tolerance in plants. Specifically, BiP overexpression was shown to attenuate osmotic- induced cell death and to improve drought tolerance in soybean (Glycine max) and wheat (Triticum vulgare), highlighting the central role of this ER- chaperone in plant adaptation to abiotic stresses (Jia et al., 2008; Valente et al., 2009).
1.6.2 ER has a prominent role during response to biotic stress
Probably the best illustrative example of the role of ER in environmental stresses is the response to pathogen attack since this response is mainly based on the considerable production of immune receptors and secreted defense-related proteins which are mostly folded and matured in the ER (Eichmann and Schafer, 2012; Tintor and Saijo, 2014). The increase in protein synthesis caused by the phytopathogen presence sometimes exceeds the ER folding capacity. QC by the ER assists PRRs and PR proteins to fold them properly, preventing their aggregation, so it is crucial for a rapid and effective plant immune system (Nekrasov et al., 2009; Saijo, 2010; Wang et al., 2005).
The main four functions attributed to ER during plant defense responses are summarized below and they have been related to the activity of specific proteins, including the BiP proteins (Eichmann and Schafer, 2012; Wang et al., 2005).
1.6.2.1 Transcriptional regulation of defense-related genes.
Several ER stress marker genes are up-regulated during early stages of immune responses, suggesting that enhanced ER capacity is needed for immunity (Korner et al., 2015). For instance, the application of SA triggers AtbZIP60 splicing (Moreno et al., 2012) and this hormone also promote the up-regulation of UPR responsive genes, as AtBIP3, and activation of AtbZIP28 protein in Arabidopsis (Nagashima et al., 2014).
CHAPTER 1
33
1.6.2.2 Biogenesis and secretion of antimicrobial and PRs proteins.
It has been reported that BiP proteins attenuate ER stress and promote PRs secretion. Silencing of BiP2 reduces the induction and secretion of PR1 by SA treatment and shows an impaired resistance to the bacterial Pseudomonas syringae pv. Maculicola (Psm) ES4326 in Arabidopsis (Wang et al., 2005). Conversely, BiP4 overexpression produces an increased steady state of PR1 and PR5 compared to wt plants in soybean (Carvalho et al., 2014). In parallel, IRE1 has also been shown to play an integral role in the secretion of PR proteins; indeed low levels of secreted PR1 were found in SA-treated ire1a ire1b Arabidopsis double mutants, showing enhanced susceptibility to the bacterial pathogen Psm ES4326 and impaired SAR (Moreno et al., 2012).
1.6.2.3 Stabilization of immune receptors:
BiP interacts with a wide range of membrane-resident proteins related to defense response, particularly PRRs, mediating their maturation. For instance, in rice (Oryzae sativa), over-expression of BiP3 regulates the processing and stability of XA21 PRR (Park et al., 2010). Arabidopsis BiPs, in collaboration with an ER-resident cochaperone (AtERdj3B), participate in the biogenesis of EF-Tu receptor (EFR) PRR (Nekrasov et al., 2009). ERdj3-BiP also form a multi-protein complex with an ER-resident protein, stromal-derived factor 2 (SDF2), mediating resistance to Pst DC3000 (Meunier et al., 2002). Consistent with this function, BiP2 mutants show impaired resistance against Pseudomonas syringae pv. maculicola (Psm) and BiP2 also participated in SAR mediated by the nonexpressor of PR genes 1 (NPR1) (Wang et al., 2005).
1.6.2.4 Modulation of PCD during the HR:
It seems that BiPs can function as modulators of pathogen-induced cell death events in plants, although with contrasting results. For instance, both overexpression and silencing of BIP2 are associated with a delay in the establishment of hypersensitive cell death by ectopic expression of the Potato virus X TGBp3al protein or by Xanthomonas oryzae pv oryzae in Nicotiana benthamiana (N. benthamiana) or rice respectively (Xu et al., 2012a; Ye et al., 2011). On the contrary, in soybean and Nicotiana tabacum, BiP4 overexpression produces accelerated PCD during HR after Pst DC3000 inoculation (Carvalho et al., 2014). In addition to BiPs, AtIRE1 could play a role in cell death modulation, as it has been reported that PCD has been enhanced in ire1a and ire1b mutants, under ER stress conditions (Mishiba et al., 2013).
Additionally, it should be highlighted that several proteins, directly related to plant defense responses, have been localized in the ER membrane. The ethylene receptor, EIN2, responsible for ethylene perception in plants (Bisson et al., 2009) or ATL9, an E3 ligase implicated in ubiquitination during defense response against G. cichoracearum in Arabidopsis (Berrocal-Lobo et al., 2010) are located at ER membrane.
1.7 PROTEIN FOLDING IN THE CYTOPLASM
Apart from the high accumulation of unfolded proteins in the ER, different environmental challenges also promote a rapid and extensive accumulation of misfolded proteins in the cytoplasm. As in the case of ER, this accumulation must be tightly controlled and minimized to allow protein function and cell viability, especially under heat stress. This alleviation, as mentioned before, is mainly achieved by the activation of the HSR.
CHAPTER 1
34
HSR is a highly conserved response that promotes the transcriptional upregulation of genes coding for molecular chaperones and proteins from the cytoplasmic QC (Vierling, 1991). Despite the establishment and function of HSR has been studied in depth in relation to heat stress, HSR is also activated during the course of specific physiological conditions, such as cell growth and differentiation, and in response to multiple environmental stresses, such as heavy metals or oxidative stress (Koizumi et al., 2013; Morimoto, 2011). In this sense, HSR activation induces cross-protection not only against subsequent exposures to the same type of stress but also against exposures to other types of environmental or chemical stresses (Morimoto, 2011).
HSR activation is exerted by the coordinated function of the heat shock transcription factors (Hsfs) (Akerfelt et al., 2010; Trinklein et al., 2004; Wu, 1995). Specifically, Arabidopsis thaliana has 21 Hsfs assigned to three classes (A, B and C) that are further divided into 14 subgroups (Nover et al., 2001; Scharf et al., 2012). Among them, the different members of the HsfA1 family (Hsf1A/B/E/D) act redundantly as primary master regulators of the HSR (Liu et al., 2011; Yoshida et al., 2011). Conversely, this function is carried out in tomato by a single protein, the HsfA1, highlighting the complexity of the HSR in plants (Mishra et al., 2002). During the first stages of plant exposure to high temperatures, HsfA1 is transported to the nucleus where it induces the transcriptional activation of different transcription factors that act as positive regulators (HsfA2A, DREB2A and MBF1c) and negative regulators (HsfBs) of the HSR (Czarnecka-Verner et al., 2004; Charng et al., 2007; Ikeda et al., 2011; Liu and Charng, 2013; Liu et al., 2011; Nishizawa-Yokoi et al., 2011; Sakuma et al., 2006; Yoshida et al., 2011; Yoshida et al., 2008). The crosstalk among these transcription factors, but especially of HsfA1, HsfA2 and HsfB1, is central to the activation, maintenance and attenuation of the HSR.
HSFs bind to the heat shock promoter element (HSE), which are defined as multiple units of the sequence 5′-nGAAn-3′, arranged in alternating orientation. These sequences are located in the promoters of Hsf-target genes that include a large number of the molecular chaperones (Pelham, 1982; Sorger, 1991). Most of these chaperones were originally identified as heat shock proteins (HSPs) because of their high transcription at high temperature and their important role in thermotolerance. In general terms, HSPs are grouped into at least five highly conserved families according to their molecular weight: low molecular weight sHSPs, HSP40, HSP60, HSP70, HSP90 and HSP100 (Vierling, 1991). Among them, different members of the HSP70 and HSP90 families play critical roles in protein homeostasis and are essential players of plant QC.
1.7.1 Heat shock protein 70 (HSP70) family
HSP70 proteins constitute a highly conserved family of ATPases that are found in almost all organisms and cell types (Boorstein et al., 1994; Gupta and Golding, 1993). These proteins bind to unspecific hydrophobic regions exposed in non-native substrates and, in such a way, they participate in the early stages of almost all aspects of protein maturation: folding of nascent proteins, protein translocation across membranes, prevention of protein aggregation and targeting of unfolded proteins towards degradation (Hartl et al., 2011). In addition, HSP70 proteins assist the refolding of non-native proteins, alleviating protein aggregation under stress.
At the structural level, HSP70 proteins are characterized by the presence of a conserved substrate binding domain (SBD), which allow client recognition, and an N-terminal ATPase
CHAPTER 1
35
domain (also called nucleotide binding domain; NBD) (Dragovic et al., 2006). Moreover, the cytosolic members of the HSP70 family contain a highly conserved EEVD sequence in their C-terminal end that is involved in the interaction with tetratricopeptide repeats (TPR) cochaperones (Scheufler et al., 2000) (see Figure 1.5 for detail).
In plants, HSP70 proteins have been identified in different species (Vierling, 1991). Arabidopsis genome contains at least 17 genes encoding members of the HSP70 family (Lin et al., 2001). Proteins of this family are localized at different cellular organelles, with representative members in the cytoplasm (HSP70.1-HSP70.5, HSP70.14, HSP70.15 and HSP70.16), chloroplast (HSP70.6, HSP70.7 and HSP70.8), mitochondria (AtHSP70.9 and AtHSP70.10) and ER (HSP70.11, HSP70.12, AtHSP70.13 and AtHSP70.17) (Sung et al., 2001). HSP70s are also localized to other subcellular compartments, such as glyoxysomes and protein bodies (Wimmer et al., 1997). The expression of some of them, as AtHSP70.4 or AtHSP70.5, are highly induced in response to different challenges such as heat, cold, anoxia, and heavy metals (Koizumi et al., 2013; Li et al., 1999; Lin et al., 2001; Sung et al., 2001).
1.7.2 Heat shock protein 90 (HSP90) family
HSP90 family constitutes an evolutionarily conserved group of molecular chaperones in both prokaryotes and eukaryotes (Chen et al., 2006). They are one of the most abundant cellular proteins representing 1-2% of cytosolic proteins under control conditions (Pratt and Toft, 1997). HSP90 function is essential for cell viability and promotes the correct conformation and activation of a large number of proteins usually involved in cell signaling, growth and differentiation (Frydman et al 2001). These proteins referred as HSP90 clients include kinases, nuclear hormone receptors and transcription factors, among others (McClellan et al., 2007; Picard, 2002; Pratt and Toft, 1997; Xu et al., 2012b; Zhao et al., 2005).
HSP90 proteins are characterized at the structural level by the presence of three highly conserved domains: the N-terminal ATPase domain (ND), the middle domain (MD) that is important for client binding, and the C-terminal dimerization domain (CD), which contains a highly conserved MEEVD motif that allows the association of HSP90 to TPR cochaperones (Breiman, 2014; Pearl and Prodromou, 2006). HSP90 proteins are found in different dynamic conformations that depend on binding and hydrolysis of ATP (see Figure 1.5 for detail).
In plants, different HSP90 family members are found in different cellular compartments. Specifically, Arabidopsis genome encodes four cytosolic (HSP90.1-HSP90.4), one chloroplastic (HSP90.5), one mitochondrial (HSP90.6) and one ER-localized HSP90 (HSP90.7) (Krishna and Gloor, 2001). Although these proteins have a different location in the cell, the high percentage of amino acid identity suggests that these proteins share conserved biochemical functions.
1.7.3 HSP70 and HSP90 as regulators of HSR
Besides their importance in protein folding, HSP70 and HSP90 have also been involved in the regulation of HSR in mammals and plants. In these latter eukaryotes, novel findings in tomato have allowed generating a model in which these two chaperones play an essential role in the attenuation of the HSR in plants (Hahn et al., 2011). In this proposed model, HSP70 and HSP90 function as negative regulators of HSF1A activity under control conditions, blocking HSR
CHAPTER 1
36
activation in the absence of heat challenge (Kim and Schöffl, 2002; Yamada et al., 2007; Yamada and Nishimura, 2008). However, upon plant exposure to high temperatures, HSP70 and HSP90 are associated with the increasing amounts of unfolded proteins, releasing HSFA1. HSFA1 is then transported and retained in the nucleus, inducing HSR activation. When the stress is overcome, restoration of the free pool of HSP70 and HSP90 result in (a) the inactivation of the HSFA1 by HSP70-induced release from DNA (b) HSP90 inactivation of the HsfA1/HsfA2 complex, c) HSP90-induced DNA binding of the HSR repressor HSFB1 and, finally, (d) HSFB1 degradation (Hahn et al., 2011) (Figure 1.3).
Figure 1.3. Model of HSP70 and HSP90 role as regulator of the HSR. Under control conditions, HsfA1 is in an inactive state in complex with HSP70 and HSP90. Both chaperones contribute to the low level of HsfB1 protein due to its rapid degradation. After heat stress, the amount of denatured proteins increases in the cytoplasm and HSP70 and HSP90 are competed away to assist their folding. In such conditions, HsfA1 is released and binds to the HSEs, present in the promoters of heat stress-responsive (HR) genes, inducing their transcription. During the recovery phase, restoration of the free pool of HSP70 and HSP90 results in a decreased transcription of HR genes. HSP70 interacts with HsfA1, leading to its DNA release. In addition, the binding of HSP90 to HsfB1 promotes the HsfB1-affinity binding to HSEs, promoting inhibition of transcription and triggering HsfB1 degradation. Furthermore, HSP90 seems to be involved in the negative regulation in HsfA1-HsfA2 complex, although the exact mechanism is still unresolved. Despite most of the experimental details were elaborated for tomato, it is probably that basic aspects of this model are also valid for other plants. Figure adapted from (Hahn et al., 2011; Scharf et al., 2012).
1.8 ROLE OF HSP70 AND HSP90 IN THE RESPONSE TO ABIOTIC AND BIOTIC STRESSES
As cited above, specific members of the HSP70 and HSP90 family are induced by different abiotic and biotic stresses (Grigorova et al., 2011; Guy and Li, 1998; Krishna and Gloor, 2001; Lin et al., 2001; Sung et al., 2001; Wójcik and Tukiendorf, 2011). In addition, the analysis of plants with an increased or reduced expression of some of their members has reinforced the role of these two major families of chaperones in response to environmental stresses. Specifically, Arabidopsis plants with decreased expression of HSP70.14 and HSP70.15 show reduced tolerance to moderate temperatures (Jungkunz et al., 2011). In contrast, lines overexpressing HSC70.1 display an increased tolerance to a wide variety of abiotic stresses as heat, salt, cadmium and arsenic, but increased hypersensitivity to Ɣ-irradiation. Interestingly, these plants also show an enhanced water loss under dark conditions (Alvim et al., 2001; Cazale et al., 2009; Clement et al., 2011; M Suginoa, 1999; Sung and Guy, 2003), a phenotype
CHAPTER 1
37
that is also observed in Arabidopsis lines expressing a dominant negative mutation in HSP90.2 (Clement et al., 2011). Moreover, the use of HSP90 inhibitors such as geldanamycin (GA) and monocillin I have revealed the pivotal role of HSP90 in the attenuation of the HSR in Arabidopsis (McClellan et al., 2007; Yamada et al., 2007; Yamada and Nishimura, 2008). These data are consistent with the higher sensibility to high temperatures and salinity observed in Arabidopsis lines overexpressing HSP90.5, HSP90.2 and HSP90.7 (Song et al., 2009a).
In contrast to the increasing knowledge of the role of HSP70 in response to abiotic stresses, the exact role of this family of proteins in defense is not completely understood. It is reported that HSP70.2 and HSP70.4 transcription levels increased substantially following inoculation with avirulent Pst DC3000 strains (Noel et al., 2007). On the one hand HSP70.1 is required for HR to Pseudomonas cichorii in N. benthamiana (Kanzaki et al., 2003), but the over-expression of HSP70.1 in Arabidopsis has been reported to induce hypersusceptibility to Pst DC3000 and to non-virulent bacteria derivatives (Noel et al., 2007). Additionally, HSP70 is the major target of HopI1, a virulence effector of pathogenic Psm ES4326 (Jelenska et al., 2010).
Additionally, HSP90 interacts with plant immunity related kinases and transcription factors that are necessary for activation of the defense response. In Arabidopsis, HSP90 interacts with two known disease resistance-related proteins: SGT1 (the suppressor of G-two allele of Skp1) and RAR1 (required for Mla12 resistance) (Azevedo et al., 2002; Boter et al., 2007; Takahashi et al., 2003). This complex is required for the activation of different cytosolic R proteins, such as MLA or RPM1, which are essential for the recognition of powdery mildew (Golovomyces cichoracearum) and Pst DC3000, respectively (Bieri et al., 2004; Hubert et al., 2003; Liu et al., 2004).
1.9 HSP70-HSP90 COMPLEX
Folding of different proteins as mammalian steroid hormone receptors (SHR), transcription factors or kinases requires the coordinated action of HSP70 and HSP90 proteins (Wegele et al., 2004). These chaperones act in complexes with different accessory proteins known as cochaperones. These cochaperones participate in the assembly, stabilization and regulation of the HSP70´s and HSP90´s ATPase activity and on the recruitment and maturation of client proteins (Prodromou et al., 1999). The best well known HSP70-HSP90 cochaperones in plants include SGT1b, HSP40, HSP70 interacting protein (HIP), C-terminus of HSP70 interacting protein (CHIP), acidic 23-kDa protein (p23) or HSP70-HSP90 organizing protein (HOP) (Ballinger et al., 1999; Blatch et al., 1997; Hohfeld et al., 1995; Johnson et al., 1994; Nicolet and Craig, 1989; Qiu et al., 2006; Webb et al., 2001; Yan et al., 2003; Zhang et al., 2015; Zhang et al., 2003; Zhang et al., 2010b).
1.10 HOP PROTEINS
HOP, also known as stress-inducible protein 1 (STI-1), is a conserved family of cochaperones with representative homologues in different eukaryotes as mammals, yeasts, insects or plants (Blatch et al., 1997; Demand et al., 1998; Hombach et al., 2013; Honore et al., 1992; Nicolet and Craig, 1989; Song et al., 2009b; Webb et al., 1997; Zhang et al., 2003).
These proteins are structurally defined by the presence of three TPR-domains (called TPR1, TPR2A and TPR2B) and two aspartic acid-proline domains (DPs) in their sequence (Odunuga et al., 2003; Scheufler et al., 2000). TPR domains consist on three or more TPR motifs, which are
CHAPTER 1
38
highly degenerate 34 amino acid repeats able to form structural modules that allow protein-protein interactions (Blatch and Lassle, 1999; Lamb et al., 1995; Odunuga et al., 2004) (Figure 1.4).
HOP interaction with the molecular chaperones HSP70 and HSP90 has been profusely studied. Specifically, HSP70 binds primarily to the N-terminal TPR1 domain, while the central TPR2A motif is known to be essential for HSP90 binding (Van Der Spuy et al., 2000) (Odunuga et al., 2003). In both cases, as described before, these associations depend on the GPTIEEVD and the MEEVD sequences found at the C-terminal ends of HSP70 and HSP90, respectively. (Scheufler et al., 2000). Additionally, to the main role of TPR1 and TPR2A, a possible involvement of TPR2B and DP2 domains in the interaction with HSP70 and HSP90 has also been speculated (Flom et al., 2007; Odunuga et al., 2004; Song and Masison, 2005).
Figure 1.4. Domain organization of HOP proteins in S. cerevisiae (scSTI1), human (hHOP) and Arabidopsis (AtHOPs). Sequence analysis of the different HOP proteins reveals the presence of three TPR domains (TPR1, TPR2A and TPR2B) and two DP repeat regions (DP1 and DP2). In addition, human and Arabidopsis HOPs display a conserved nuclear location signal (NLS), which seems to be missed in scSTI1.
1.10.1 The role of HOP in other eukaryotes
HOP derives its name from its well-known role as an adapter protein that can bind HSP70 and HSP90 simultaneously. In such a way HOP brings these chaperones in close proximity to optimize their cooperation in protein folding (Chen and Smith, 1998). HOP function in assisting HSP70 and HSP90 has been studied in depth in the case of the mammalian steroid receptor (SR) regulation (Chen et al., 1996). This study has allowed generating a simplified and widely
CHAPTER 1
39
accepted model for the folding of most HSP70-HSP90 client proteins (Hernandez et al., 2002; Pratt and Toft, 2003) (Figure 1.5).
HOP has a high affinity for HSP90 binding and, therefore, it has been speculated that most HOP is associated with HSP90 in the cells. Protein folding begins with the binding of the client protein to HSP40. This complex interacts to HSP70 promoting HSP70´s ATP hydrolysis. This ternary client-HSP40-HSP70 complex further associates with HOP, which, as described, is already in a complex with HSP90. Within this intermediate complex, HOP serves as a “bridge” that connects the two HSP70 and HSP90 chaperones and facilitates the transfer of client proteins from the initial complex (HSP70-HSP40) to HSP90. ATP binding promotes, on the one hand, a strong conformational change in which HSP90 progresses to acquire its closed conformation, and, on the other hand, the disassociation of HSP70 and of its cochaperones including HOP. This state, called mature complex, is stabilized by the presence of p23, allowing the client protein to complete its maturation. The cycle finishes with the hydrolysis of ATP. During this hydrolysis, HSP90 returns to its open conformation and the client protein is released (Li et al., 2012; Shiau et al., 2006).
Figure 1.5. Minimal HSP70-HSP90 protein folding cycle. Protein folding begins with the association of the client protein with HSP40 and HSP70 to form the initial complex, where HSP40 stimulates HSP70´s ATP hydrolysis. HSP70-ADP conformation favours the association of HOP, which is already in complex with HSP90. In this complex, called
CHAPTER 1
40
intermediate complex, HOP acts as a “bridge” bringing in close proximity HSP70 and HSP90 through the interaction of HOP´s TPR1 and TPR2A domains with the C-terminal sequences GPTIEEVD and MEEVD present in HSP70 and HSP90, respectively. This “bridge” allows the transfer of the client protein from HSP70 to HSP90. This step is followed by ATP binding that promotes a conformational change that drives the release of HOP, HSP70 and its cochaperones and the formation of the mature complex. This mature complex, which includes the cochaperone p23, allows the client protein to complete its maturation. The subsequent hydrolysis of ATP returns HSP90 to its open conformation, releasing the folded client protein.
As cited above HOP interactions with HSP70 and HSP90 are the best characterized, however, HOP associations to other proteins as HSP104, prion protein (PrPC) and to the eukaryotic chaperonin-containing TCP1 (CCT) have also been reported (Abbas-Terki et al., 2001; Gebauer et al., 1998; Zanata et al., 2002), suggesting that HOP may assist other chaperone complexes that may be involved in HSP70- and HSP90-independent processes.
At the physiological level, HOP has been involved in thermotolerance in Saccharomyces cerevisiae and Caenorhabditis elegans (Nicolet and Craig, 1989; Song et al., 2009b). In addition, HOP shows a protective effect against the progression of prion and neurodegenerative diseases (Lopes et al., 2005; Zanata et al., 2002). All these data highlight that the biological function of HOP is considerably broader than previously envisaged.
1.10.2 The role of HOP in plants
In plants, HOP homologues have been described in different species as soybean, wheat, rice, tobacco and by in silico searches in Arabidopsis (Chen et al., 2010; Fellerer et al., 2011; Nakashima et al., 2008; Prasad et al., 2010; Xu et al., 2014; Zhang et al., 2003). In some of these organisms, HOP is encoded by gene families. In this sense, only one HOP member has been described in soybean; two genes have been identified in rice while three members are present in the Arabidopsis genome (Figure 1.5). These three Arabidopsis proteins (AtHOP1, AtHOP2 and AtHOP3) show a high percentage of homology but differential expression since, based on the information available in public repositories, AtHOP1 and AtHOP2 have a constitutive expression while the expression of AtHOP3 seems to be highly induced by heat stress (Arabidopsis eFP Browser at www. http://bar.utoronto.ca/efp).
CHAPTER 1
41
Figure 1.5. Phylogenetic analysis of HOP family in specific model species. Neighbor-joining phylogenetic tree is showing the evolutionary relationship among the human HOP and the HOP families in rice, soybean and Arabidopsis. The analysis was performed with MEGA6. The scale bar represents evolutionary distance (amino acid replacements). Accession numbers are given in brackets.
Despite the conservation of HOP family, the knowledge on HOP function is extremely scarce in plants. GmHOP interacts with HSP90 in vitro and this interaction has been corroborated in vivo in rice (Chen et al., 2010; Zhang et al., 2003). Conversely, in vivo complexes with HSP70 have not been described so far in plants, although in vitro binding analysis in wheat germ lysate has revealed that HOP forms complexes containing this major chaperone (Krishna and Kanelakis, 2003). Additionally, HOP associates along with HSP90 with pre-proteins synthesized in wheat germ extract, suggesting a role of HOP in maintaining these proteins into a competent state until they are transported to the chloroplast (Fellerer et al., 2011).
In rice, the interaction of HOP to HSP90 promotes the efficient transport of the chitin receptor CERK1 to the plasma membrane, modulating plant immunity against rice blast (Chen et al., 2010). In addition, HOP has been described as a cell-intrinsic virus restriction factor of the mitochondrial Carnation Italian Ringspot Tombusvirus (CIRV) in N. benthamiana (Xu et al., 2014). Despite the involvement of HOP in these specific immune responses, the role of HOP during the plant response to ER stress or any other biotic or abiotic stresses remains largely unknown.
2. CHAPTER 2. OBJECTIVES
CHAPTER 2
44
Objectives
HOPs (“HSP70-HSP90 organizing proteins”) are a family of cochaperones with representative members in different eukaryotes including diverse plant species. There is some evidence to suggest a major role of HOP proteins in response to a wide range of environmental conditions, although a full characterization of it is lacking. In contrast, in plants, the role of this protein during the response to abiotic or biotic stresses remains largely unknown
The general objective of this PhD Thesis is the molecular characterization of the AtHOP proteins in response to different stresses, using Arabidopsis thaliana as a model organism.
In order to achieve this general objective, the following specific objectives have been undertaken:
1. Analysis of the involvement of AtHOP3 in the alleviation of ER stress (Chapter 4). 2. Characterization of AtHOP3 function, by phenotypic analysis, in plant defense response to
phytopathogens of agronomical interest, specifically to Botrytis cinerea, F. oxysporum f. sp. Conglutinans and Pseudomonas syringae pv tomato DC3000 (Chapter 5).
3. Molecular characterization of the role of AtHOP3 and other members of the AtHOP family in response to heat stress (Chapter 6).
3. CHAPTER 3. MATERIALS AND METHODS
CHAPTER 3
48
Materials and methods 3.1 BIOLOGICAL MATERIAL
3.1.1 Plant material and growth conditions
Arabidopsis thaliana Columbia (Col-0) ecotype was generally used throughout this study, although Landsberg erecta (Ler) and Wassilewskija (Ws) ecotypes were also used when specified. Arabidopsis T-DNA insertion mutants hop3-1 (SALK_00794), hop3-3 (FLAG_015B01) hop1-1 (GK-420A10.15), hop2-1 (GK-399G03.03), hsfa2 (SALK_008978C), bzip28-1 (SALK_123659), bzip17 (SALK_104326), ire1a (SALK_018112) and ire1b (SAIL_238_F07) were acquired from the Arabidopsis Biological Resource Center (ABRC) and the Versailles Arabidopsis Stock Center (INRA). xrn4-5 (Souret et al., 2004) and jar1-1 mutants were kindly provided by Dr Pamela Green (Delaware Biotechnology Institute, EE.UU) and Dr Roberto Solano (National Centre for Biotechnology, CNB CSIC, Spain), respectively. The hop1 hop2 hop3 triple mutant was obtained from sequential crosses between hop3-1, hop1-1 and hop2-1 lines.
For in vitro analysis, Arabidopsis seeds were surface sterilized and stratified at 4°C for 48 h. The sterilized seeds were germinated on Murashige Skoog (MS) medium (Duchefa) supplemented with 1% sucrose and 7 or 9 gL-1 of plant agar (for plant growth in horizontal or vertical position, respectively) under long-day photoperiodic conditions (16/8 hours light/dark schedule) and at a constant temperature of 20°C. For the analysis of plant growth on soil, Arabidopsis Col-0 and transgenic plants were grown on a mixture of soil-vermiculite (3:1) under long-day photoperiodic conditions at 22°C/19°C day/night temperature, 65% relative humidity and of 120 μEm-2s-1 of light intensity. Nicotiana benthamiana (N. benthamiana) plants were grown on soil at 22°C under the same conditions described for Arabidopsis. For pathogen inoculation, Arabidopsis seedlings were also grown hydroponically in a recipient (Araponics system, http://www.araponics.com/) containing 2.5 mL of water per plant. After inoculation, plants were transferred to a growth chamber under a 10/14 hours light/dark schedule and 100 μEm-2s-1 light intensity at the same temperature regime and relative humidity previously mentioned.
3.1.2 Phytopathogens employed, storage and growth conditions
The fungal pathogen Botrytis cinerea (B. cinerea) (Denby et al., 2004) was grown on potato dextrose agar (PDA) medium at 28°C for 8 days. Spores were collected in sterile water, quantified with a Neubauer chamber and stored in 20% glycerol at -80°C until use.
The fungus Fusarium oxysporum f. sp. conglutinans strain 699 transformed with the sGFP coding region (Foc 699-GFP) (Hou et al., 2014) was grown in half strength PDA at 28°C for 2 to 3 days and was stored as microconidial suspensions in 20% glycerol at -80°C.
The bacterium Pseudomonas syringae pv. tomato DC3000 (Pst DC3000) (Whalen et al., 1991) was cultured at 28°C on King's B (KB) medium supplemented with 20 µgmL-1 rifampicin (Sigma-Aldrich). Bacteria were collected in sterile water and stored in 20% glycerol at -80°C until use.
CHAPTER 3
49
B. cinerea, Foc 699-GFP and Pst DC3000 were kindly provided by Dr Antonio Molina (Plant Response Biotech collection, Madrid), Dr Antonio di Pietro (Cordoba University, Spain) and Dr Emilia Lopez Solanilla (Centre for Plant Biotechnology and Genomics, CBGP, Madrid), respectively.
3.1.3 Escherichia coli and Agrobacterium tumefaciens strains used in this study
Escherichia coli (E. coli) DH10B and Agrobacterium tumefaciens (A. tumefaciens) GV3101 strains were used for transformation and propagation of plasmids of interest. Cultures of transformed Agrobacterium were also used for generation of Arabidopsis transgenic plants or for transient expression of proteins in N. benthamiana leaves (see below).
3.1.4 Escherichia coli and Agrobacterium tumefaciens transformation
E.coli and A. tumefaciens electrocompetent cells were generated as described in (Sambrook et al., 1989). 250 ng of plasmid DNA were used to transform the cited cells using a BIO-RAD micropulse electroporator (following the manufacturer´s instructions). Both bacteria were cultured at 37°C or 28°C, respectively, in Luria-Bertani (LB) medium supplemented with the corresponding antibiotics for plasmid selection.
3.1.5 Arabidopsis thaliana transformation
Transgenic plants were obtained by introducing the different constructs under study in the corresponding Arabidopsis background via A. tumefaciens GV3101 using the floral dip method (Clough and Bent, 1998).
3.1.6 Transient expression of proteins in N. benthamiana leaves
For the transient expression of proteins in N. benthamiana leaves, cultures of A. tumefaciens transformed with the binary plasmids of interest were infiltrated into N. benthamiana leaves using the method described in (Johansen and Carrington, 2001).
3.2 CONSTRUCTS AND MOLECULAR CLONING
The constructs HOP3pro-HOP3-(GUS, GFP or HA) and HOP1pro-HOP1-(GUS or GFP) were obtained by cloning the genomic fragments -1716 / +2371 pb of HOP3, and -1804 / +2944 pb of HOP1 in frame with GUS, GFP or HA using the Gateway binary vectors pGWB3, pGWB4 and pGWB13, respectively (Nakagawa et al., 2007a). The constructs p35S-GFP-(HOP1, HOP2 or HOP3) were generated by cloning corresponding cDNA sequences in frame with GFP in the pGWB6 vector (Nakagawa et al., 2007a). The construct p35S-mCherry-UBP1b was obtained by subcloning the mCherry-UBP1b fragment from the pRTdS-Cherry-AtUbp1b plasmid (kindly provided by Dr Markus Fauth, Institute of Molecular Bioscience) into the Gateway binary vector pGWB402𝛀 (Nakagawa et al., 2007b). Generation of p35S-ER-RFP construct was previously described (Thomas et al., 2008) and the AtBiP1 and AtBiP2 expression plasmids (DKLAT5G28540 and DKLAT5G42020) were obtained from the ABRC stock, respectively. The fusion proteins of ΔBiP1, ΔBiP1_NBD, ΔBiP1_SBD to Gal4-binding domain (BD), used for two-hybrid analyses, were generated by cloning the AtBiP1 fragments coding for the amino acid
CHAPTER 3
50
positions 28 to 666, 28 to 410 and 411 to 666, respectively into pDEST-GBKT7. The construct of COI1 cloned into pDEST-GBKT7 was kindly provided by Dr Roberto Solano (CNB CSIC, Spain). For both two-hybrid analyses, a fusion protein of HOP3 to Gal4-activation domain (AD) was cloned into pDEST-GADT7. Molecular cloning was done using the Gateway cloning system (Life Technologies), following the manufacturer´s instructions. All fusion constructs were verified by sequencing.
The primers used are listed in Table 1.
3.3 NUCLEIC ACID EXTRACTION AND ANALYSIS
3.3.1 gDNA and RNA isolation
To quantify Foc 699-GFP biomass, total genomic DNA (gDNA) was extracted according to CTAB method as described in (Doyle, 1987).
Total RNA from Arabidopsis tissues was obtained using the Trizol reagent (GIBCO-Invitrogen-Life Technologies) following the manufacturer's instructions.
3.3.2 Electrophoresis of DNA and RNA samples
DNA and RNA samples were visualized using agarose and denaturing formaldehyde agarose gels, respectively, as described in (Sambrook et al., 1989).
3.4 GENE EXPRESSION ANALYSIS BY QUANTITATIVE REAL-TIME PCR (QRT-PCR)
For analysis of gene expression under ER stress conditions, 7 day-old Arabidopsis seedlings grown in MS liquid medium were incubated in the absence (control) or presence of 2.5 mM of DTT or 0.1 µg mL-1 of TM for 4 h. For the analysis of the expression levels of the different members of the Arabidopsis HOP family, 7 day-old seedlings were grown continuously under control conditions (22°C) or heat stressed at 38°C for 3 hours, as indicated in legend figures. RNA isolation and qRT-PCR were performed as described in (Echevarria-Zomeno et al., 2015), using TUB5 (At1g20010) for normalization.
For gene expression analysis of plants inoculated with B. cinerea or Pst DC3000 plants, four leaves from four different inoculated plants per genotype were harvested at 1 dpi. RNA isolation and qRT-PCR was performed as described in (Berrocal-Lobo et al., 2010), using β-ACTIN (At3g18780) for normalization. Each experiment was conducted in three technical replicates with at least three biological replicates.
The primers used for the qRT-PCRs analysis are listed in Table 1.
3.5 RNA-SEQUENCING (RNA-SEQ) ANALYSIS
Three biological replicates of 7 day-old Arabidopsis seedlings from wt and hop1 hop2 hop3 mutant grown under control conditions or challenged at 38°C for the last 3 hours were used for total RNA isolation. Library construction and sequencing on Illumina HiSeq2000 was carried
CHAPTER 3
51
out at CNAG (National Centre for Genomic Sequencing, Barcelona, Spain), resulting in 30-40 million 150 bp paired-end reads (2 x75) per sample.
All steps for data analysis were performed on a Linux computer using a combination of command-line software tools, R packages from Bioconductor and Python scripts.
FASTQ files, deposited at Gene Expression Omnibus (GEO) (https://www.ncbi.nlm.nih.gov/geo/), were demultiplexed into individual libraries and total reads were mapped to the Arabidopsis genome (TAIR10) using the splice-aware read aligner TopHat (version 2.1.0) (Kim et al., 2013a), allowing only unique alignments and not more than two nucleotide mismatches. The values of the minimum and maximum intron lengths were adjusted as 20 bp and 4000 bp, respectively (Filichkin et al., 2010).
The mapped RNA-seq reads were transformed into a count per transcript for each replicate/condition using the script htseq-count of the HTSeq library (Anders et al., 2015) with option intersection-nonempty and the features annotated in the Arabidopsis GTF file (TAIR10). Differential expression analysis, based on the negative binomial distribution, was performed using DESeq2 R package (version 1.1.14). AgriGO software (version 1.2) (Du et al., 2010) was used for gene ontology analysis, and Singular Enrichment Analysis (SEA) was performed.
3.6 BIOCHEMICAL TECHNIQUES FOR PROTEIN ANALYSIS
3.6.1 Immunoprecipitation analyses in N. benthamiana
N. benthamiana leaves were agroinfiltrated with the corresponding constructs and were harvested 3 days after the agroinfiltration. 1.2 g of leaf tissue were ground in liquid nitrogen and incubated in 4 mLg-1 of extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5% glycerol, 0.1% Triton X-100, 5 mM DTT, 2% poly(vinylpolypyrrolidone) (PVPP), supplemented with protease inhibitors (Sigma-Aldrich)) for 15 min with end over end shaking. After centrifugation at 2500 g for 20 min, the supernatants were centrifuged at 20,000 g for 30 min. These supernatants were collected and their protein concentration was measured by the Bradford method (Sigma-Aldrich). Immunoprecipitation mixtures containing the same amounts of total protein in the same volume were mixed with 30 μL of the corresponding agarose beads (i.e. rabbit IgG (Sigma-Aldrich), anti-GFP (Roche), anti-Flag (Sigma-Aldrich) or anti-HA (Sigma-Aldrich), depending on the starting material), previously blocked to avoid unspecific binding with 1 mgmL-1 of BSA in extraction buffer without Poly(vinylpolypyrrolidone) (PVPP) for 2 h. The immunoprecipitation mixtures were incubated with the beads at constant rotation for 1.5 h. Subsequently, the beads were collected by centrifugation, washed 5 times with 1 mL of the extraction buffer without PVPP and eluted by low pH (using 100 μL of 50 mM glycine-HCl (pH 3), 150 mM NaCl, 0.1% Triton X-100 at room temperature for 5 min, followed by neutralization adding 10 μL of 1 M Tris-HCl (pH 8)), by boiling in 100 μL sample buffer or by an additional incubation with 100 μL of extraction buffer lacking PVPP supplemented with specific HA (Sigma-Aldrich) or Flag (Sigma-Aldrich) peptides, as specified in the figure legends. All these procedures were carried out at 4°C, unless otherwise stated. Equal volumes of elutions were run in SDS-PAGE gels and subjected to Western blot using specific antibodies.
CHAPTER 3
52
For the analysis of HOP3 interaction with HSFA1a the agroinfiltrated leaves were subjected to a heat stress treatment at 38°C for 2h prior to leaf harvesting.
3.6.2 Immunoprecipitation analysis in Arabidopsis
10 day-old and 7 day-old Arabidopsis seedlings from HOP3pro-HOP3-HA transgenic lines or from Col-0 (as control) were used for HOP interaction with BiP and proteomics analyses, respectively. In both cases, the seedlings were heat stressed at 38°C for 3 h prior being harvested. In each case, either 1.2 g or 6 g of tissue were ground in liquid nitrogen and incubated in 4 mLg-1 of the same extraction buffer described before but lacking PVPP. After the extraction, a similar protocol used for immunoprecipitation in N. benthamiana leaves was carried out with minor modifications. Immunoprecipitation mixtures for proteomics analysis were incubated with constant rotation for 2 h with 0.3 mL anti-HA agarose beads (Sigma-Aldrich). Then, the beads were collected in columns and the columns were washed with 20 mL of extraction buffer lacking PVPP. Proteins were eluted from the columns with 0.5 mL of extraction buffer lacking PVPP supplemented with 125 µgmL-1 of HA peptide at room temperature. These elution fractions were used for mass spectrometry analysis. Nano liquid chromatography coupled to electrospray tandem mass spectrometry (LC- ESI-MS MS) analysis was performed at the CNB Proteomics Facility (CNB-CSIC, Madrid) using an Eksigent 1D- nanoHPLC coupled to a 5600TripleTOF QTOF mass spectrometer (ABSciex, Framinghan, MA,USA).
3.6.3 Western-blot analysis
Protein concentrations were determined by the Bradford assay (Bradford, 1976) (Sigma-Aldrich). 20 μg of total soluble protein extracts were loaded on SDS-PAGE gels, blotted to nitrocellulose membranes and analysed with specific antibodies, which specifically recognize BiP (Santa Cruz Biotechnology), MYC epitope (Millipore), HA epitope (Roche) and ubiquitinated proteins (Biomol International). In all cases, the incubation with the primary and secondary antibodies was carried out following the manufacturer´s instructions. Amersham ECL Select Western Blotting Detection Reagent (Sigma-Aldrich) was used for chemiluminescent western blot detection.
3.6.4 Insoluble protein isolation and Western-blot
7 day-old Arabidopsis seedlings were grown under control conditions or heat stressed at 45°C for the last 1-3 hours. Then, plant material was ground in liquid nitrogen and homogenized in extraction buffer (100 mM Tris/HCl, pH 8.0, 10 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.2% ß-mercaptoethanol, 1 mM PMSF and 1X protease inhibitor cocktail (Roche)). The obtained homogenate was filtered through Miracloth and the protein concentration was quantified by the Bradford method (Bradford, 1976). 200 µg of each homogenate was separated by centrifugation at 12,500 rpm for 15 min. The insoluble pellet was washed twice with extraction buffer supplemented with 2% NP-40 (Sigma-Aldrich) and resuspended in sample buffer containing 8 M urea. Total insoluble proteins were separated using a denaturing (8 M urea) 10% SDS-polyacrylamide gel electrophoresis. Gels were stained with Coomassie Brilliant Blue
CHAPTER 3
53
G-250 (Sigma-Aldrich), following the manufacturer´s instructions. Ubiquitinated proteins were detected by Western-blot (as previously described).
3.7 TWO-HYBRID ANALYSES
Yeast growth, transformation and transformants growth on selective medium were carried out as described in Matchmaker™ GAL4 Two-Hybrid System 3 & Libraries User Manual (http://www.clontech.com/ES/Products/Protein_Interactions_and_Profiling/Yeast_Two-Hybrid).
3.8 PHENOTYPIC ANALYSIS
3.8.1 Chemical treatments
3.8.1.1 ER stress chemical induction
The different mutant lines were germinated side by side with their corresponding wild-type (wt) plants on MS agar plates in the absence (control) or the presence of 2.5 mM of dithiothreitol (DTT) or 0.1 µg mL-1 of tunicamycin (TM). For quantitative analysis of the phenotype, the percentage of fully-expanded green cotyledons in the presence of DTT or TM was calculated and plotted. For each genotype, the percentage of seedlings with fully expanded green cotyledons under normal conditions was 100%, otherwise, the batch was discarded for this analysis. For tauroursodeoxycholic acid (TUDCA) assay, the seeds were germinated as described above in the presence of 0.1 µgmL-1 TM supplemented with 0.5 mM of TUDCA (Calbiochem). All the phenotypes were analysed 7 days after transferring the plates to the growth chamber. Each treatment was performed in triplicate with 100 seeds for genotype and each experiment was independently repeated at least three times. The phenotype was also assayed in different seed batches, obtaining (in all cases) similar results.
3.8.1.2 Treatment with Methyl jasmonate (MeJA)
Arabidopsis seedlings were grown in a vertical position on MS medium supplemented with 2.5 µM, 5 µM and 10 µM of MeJA (Sigma-Aldrich). After 7 days, pictures were taken and Arabidopsis root length was measured. Each treatment was performed in triplicate with more than 20 seedlings per genotype and each experiment was independently repeated at least three times.
3.8.2 Long-term thermotolerance assays
Seeds from the different hop mutants were germinated side by side in the same plate along with their corresponding wt and hsfa2 control plants on MS medium at 22°C for 3 days. Then, the seedlings were either allowed to continue their growth at 22°C or subjected to an acclimation event at 38°C for 3 h, followed by a recovery period at 22°C for 2 days. After this recovery period, the acclimated seedlings were further heat stressed at 45°C for 90 min and 100 min and left back to recover at 22°C for 7 days, when the different pictures were taken. Three independent biological replicates were analysed, each of them included three plates for each control and heat assayed conditions. Heat treatments were carried out by submerging
CHAPTER 3
54
the plates in a temperature-controlled water bath. In all cases, except during the heat treatment, the plates were placed in vertical position.
3.8.3 Analysis of plant response to phytopathogens infection and disease monitoring
3.8.3.1 Response to B. cinerea
Either 2 or 3 week-old Arabidopsis plants were used for all pathogen inoculation experiments. For inoculation with B. cinerea, plant leaf surfaces were inoculated with 5 μL of B. cinerea fungal inoculum (2 x 105 sporesmL-1) in potato dextrose broth medium (PDB). Inoculated plants were transferred to a plastic tray with a transparent lid and were placed in a growth chamber to allow fungal growth until harvested. Infection progress, necrosis and cell death development in infected leaves were followed from 2nd to 7th dpi, as detailed below.
3.8.3.2 Response to Fusarium oxysporum
In the case of Foc 699-GFP, a novel method of inoculation in hydroponically growth conditions was optimized in order to follow the fungus infection progress into the roots over the time. With this purpose, 2 week-old seedlings grown in vitro were transferred to the hydroponic system, as previously explained. After 3-4 days, plants were inoculated with a suspension of 1 x 106 spores mL-1 of Foc 699-GFP and mock inoculations were done with the same volume of sterile water. After inoculation, plants were covered with the plastic lid of the Araponics system to maintain high humidity and were placed in a growth chamber. The progress of fungal infection was monitored for 5-11 days by checking the symptoms and the fluorescence GFP signal into the plant roots by microscope analysis (see details below).
Currently, after 7 dpi, the percentage of fresh weight lost (FWL) (± standard error) of the pathogen- inoculated and mock-inoculated plants was calculated as (FWL (%) = 100 × (1–fresh weight (FW) of inoculated plant/average FW of mock-inoculated plants)). To quantify Foc 699-GFP biomass, total genomic DNA (gDNA) was used, along with GFP specific primers, for qPCR analysis as described in (Hou et al., 2014).
3.8.3.3 Response to Pst DC3000
In order to determine infection rate and disease symptoms at short times, 2 week-old Arabidopsis seedlings were spray-inoculated with a bacterial suspension of Pst DC3000 (0.01 OD600), in a solution containing 10 mM of MgCl2 and 0.1% silwett L-77 (Momentive). Symptoms were evaluated after 7 days, assigning different disease rating to the inoculated plants as it is indicated in the legend figures. For bacterial growth counting and staining methods or gene expression analysis, 3 week-plants were inoculated by immersion method (0.001 OD600) or by injection with a bacterial suspension, without Silwet L-77, (0.01 -0.001 OD600) as described in (Debener and Dangl, 2001), respectively. Bacterial counting expressed as colony forming units (cfu) was performed as described in (Berrocal-Lobo et al., 2002) and histological analysis and gene expression analysis were carried out as explained below.
CHAPTER 3
55
3.8.4 Analysis of physiological parameters
3.8.4.1 In vitro pollen germination
5-6 flowers from each genotype (day 0 anthesis) were collected and used to spread their pollen on the surface of an agarose pad containing 500 µL of germination medium as described in (Boavida and McCormick, 2007). Microscope slides were then placed into moisture incubation boxes at 22°C in dark conditions for 16 hours. Pollen germination rate (from a minimum of 500 pollen grains) was analysed under a microscope using bright field (10x). Three independent replicas from each genotype were assayed.
3.8.4.2 Ion leakage measurements
Cell death in B. cinerea-inoculated leaves was monitored by ion leakage analysis. Conductivity measurements and calculations were performed as described in (Fernández-Bautista, 2016).
3.9 HISTOLOGICAL ANALYSIS
3.9.1 Determination of β-glucuronidase (GUS) activity
14 day-old HOP3pro-HOP3-GUS seedlings grown on MS medium were subjected to different stress treatments. For ER stress treatments, the plants were transferred to MS liquid medium and incubated in the absence (control) or presence of 2.5 mM DTT or 5 µg mL-1 TM for 4 hours. For heat stress treatments, seedlings were incubated at 38°C for 2 h. In addition, to analyze HOP accumulation during the attenuation period, heat stressed plants were left to recover at 22°C for 1 hour. For the analysis of HOP3 expression in response to biotic challenge, plants were inoculated with B. cinerea or Pst DC3000, as described in section 8.3. After these treatments, GUS activity was assayed throughout an overnight incubation with 5-bromo-4-chloro-3-indolyl-β-d-glucuronide as described (Jefferson et al., 1987). In the case of heat stress and biotic stress treatments plants were fixed as described in (Li, 2011) prior to GUS activity determination.
3.9.2 Determination of cell death by Trypan blue staining
Pathogen and mock-inoculated leaves were stained with Trypan blue as described in (Fernández-Bautista, 2016). Three independent replicates were assayed. Each experiment included at least ten leaves per genotype.
3.9.3 Determination of H2O2 production by 3,3’-Diaminobenzidine (DAB) staining
Inoculated leaves were incubated with 1 mgmL-1 DAB (Sigma-Aldrich) as previously described in (Berrocal-Lobo et al., 2010).
3.10 MICROSCOPY ANALYSES
For HOP1 and HOP3 subcellular localization in Arabidopsis root tips, 7 day-old HOP1pro-HOP1-GFP or HOP3pro-HOP3-GFP seedlings were analysed for GFP expression. Microscopy analyses
CHAPTER 3
56
were carried out in control and heat stressed plants subjected to a treatment of 38°C for the last 3 h. In addition, heat stressed plants were also left to recover from the challenge for different time-points as it is indicated in the figure legend.
Co-localization analyses in 3 week-old N. benthamiana leaves were carried out by transient expression of HOP1-GFP, HOP2-GFP, HOP3-GFP, RFP-ER and mcherry-UBP1b under the control of the 35S promoter. Plant tissue was imaged 3 days post-agroinfiltration using a Leica SP8 confocal microscope (Leica Microsystems) with an Argon ion laser. GFP and RFP were excited at 488 nm or 561 nm and the corresponding emitted light was captured at 495-520 nm or 590-630 nm, respectively. Sequential scanning was used to image GFP and RFP or mCherry.
Microscopic observation of Arabidopsis roots inoculated with Foc 699-GFP was prepared in 60% glycerol and visualization were performed using CCD Leica Microsystems.
3.11 OTHER INFORMATICS RESOURCES AND BIOINFORMATICS TOOLS USED IN THIS STUDY
• SIGnAL T-DNA Primer Design (http://signal.salk.edu/tdaprimers.2.html) and Primer3Plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi/) were used for oligonucleotide design.
• The Arabidopsis Information Resource (TAIR) database, specifically the Seqviewer tool, was used to retrieve the AtHOP1, AtHOP2 and AtHOP3 gDNA and cDNA sequences.
• Vector NTI Express Designer Software was used for visualization and sequence editing. • The BLAST on-line database was employed for sequence alignment
(http://blast.ncbi.nlm.nih.gov/Blast.cgi). • MEGA software was used to produce a phylogenetic tree using Neighbor-joining as
clustering method and for the visualization FIGTREE software was used. • ImageJ software U. S. National Institutes of Health, USA, was used to measure root
length and for quantitative analysis of the seed germination (http://imagej.nih.gov/ij/). • Graphad Prism Version 5 (GraphPad Software Inc.) was employed for all statistical
analysis in this work. • The LASX software from Leica Microsystems CMS was used to analyse confocal
microscopy images.
CHAPTER 3
57
Primer Sequence 5´-3´ Use
Tubulin Fw GCAACAATGAGCCGTGTGACT
qPCR
Tubulin Rv GAAATGGAGACGAGGGAATGG
AtActin 2 Fw ACCTTGCTGGACGTGACCTTACTGAT
AtActin 2 Rv GTTGTCTCGTGGATTCCAGCAGCTT
AtBIP3 Fw CACGGTTCCAGCGTATTTCAAT
AtBIP3 Rv ATAAGCTATGGCAGCACCCGTT
AtSDH Fw GCACAATGATGACAGCCAGT
AtSDH Rv CCCAGAGGGAGATAGGGAAG
AtPDIL1-1 Fw TGATGCCAGTGAGGAAACAA
AtPDIL1-1 Rv CCCAACCACAACAACCTTCT
AtCNX1 Fw TGGTTGTGGTGAATGGAAGA
AtCNX1 Rv ATGGGTTCGTAATCGGGTCT
AtCRT1B Fw TCCGCCCAGATGCTACTTAC
AtCRT1B Rv CCGGTCAGGTTTCTTGTCTTCA
AtHOP3 Fw TGAGGGCATATAGCAACAGAG
AtHOP3 Rv CACGGCTCGCTTTGTTTATCT
AtHOP1 Fw CGGAGGTGACAGAGGAGAAG
AtHOP1 Rv ACAGCAGCACGATTTGTGAG
AtHOP2 Fw GGAGCATCGTAACCCTGAAA
AtHOP2 Rv GCATTGTCATACTCCTTCA
AtXRN4-5 Fw ACCACCTGAACCGATAGACG
AtXRN4-5 Rv CAAACCCAGCACAAACCTTC
GUS Fw CAGCCAAAAGCCAGACAGAG
GUS Rv GCGTAAGGGTAATGCGAGGT
PR1 fw CGAGAAGGCTAACTACAACTAC
PR1 rv TCCGAGTCTCACTGACTTT
PDF1.2 fw GCTTTTGGTCATAAATGCAACC
PDF1.2 rv TCCCCACATTTCTCACATCA
ERF1 fw CCGATCAAATCCGTAAGC
ERF1 rv CGAGCCAAACCCTAATACC
GFP fw TGGAAGCGTTCAACTAGCAG
GFP rv AAAGGGCAGATTGTGTGGAC
AtHOP3 gene attb1 Fw GGGGACAAGTTTGTACAAAAAAGCAGGCTTTTGAATTTATAAAATAGTCAAAAATC
Genomic amplification
AtHOP3 gene attb2 Rv GGGGACCACTTTGTACAAGAAAGCTGGGTCCCGGACCTGAACAATTCCG
AtHOP1 gene attb1 Fw GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCTTTAATCACTATACCATGC
AtHOP1 gene attb2 Rv GGGGACCACTTTGTACAAGAAAGCTGGGTCTTTCATCTGGACGAT
AtHOP3 CDS Fw attb1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCGGAAGAAGCAAAATC
CDS amplification AtHOP3 CDS Rv attb2 GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACCGGACCTGAACAATTCC
AtHOP1 CDS Fw attb1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCAGAAGAAGCTAAAGCTAAA
AtHOP1 CDS Rv attb2 GGGGACCACTTTGTACAAGAAAGCTGGGTCTTATTTCATCTGGACGAT
Table 1. Primers used in this study. List of forward (Fw) or reverse (Rv) primers used for qPCR analysis or for the
amplification of the genomic and coding sequences of the different genes under study.
4. CHAPTER 4. HOP3, A MEMBER OF THE HOP FAMILY IN ARABIDOPSIS, INTERACTS WITH BiP AND PLAYS A MAJOR ROLE IN THE ER
STRESS RESPONSE
CHAPTER 4
60
HOP3, a member of the HOP family in Arabidopsis, interacts with BiP and plays a major role in the ER stress response
4.1 INTRODUCTION
The endoplasmic reticulum (ER) is the central organelle in the eukaryotic secretory pathway and an important player in plant environmental stress sensing and response to both biotic and abiotic stress such as drought, heat, salinity or pathogen attack (Zhu, 2016).
The ER hosts the synthesis and folding of membrane and secreted proteins. This function is achieved by a complex orchestra of ER-located chaperones, lectins and foldases that help proteins to acquire their mature form (Gidalevitz et al., 2013). Under stressful conditions, the ER protein folding machinery reaches a limit as the demands for protein folding exceeds the capacity of the system. Under these conditions, misfolded or unfolded proteins accumulate in the ER, triggering the unfolded protein response (UPR). UPR is a highly conserved response that in plants mitigates ER stress by promoting (i) the upregulation of the expression of chaperones and foldases to facilitate protein folding, and (ii) the removal of unfolded proteins by the ER-associated degradation system (ERAD) (Deng et al., 2013; Howell, 2013; Liu and Howell, 2010b; Liu and Howell, 2016; Ruberti and Brandizzi, 2014; Ruberti et al., 2015; Urade, 2007; Williams et al., 2014). Probably, the best studied UPR related mechanism is the transcriptional induction of ER- related genes that, in plants, depends on the activation of three main ER stress sensor/transducers, IRE1 (Moreno et al., 2012; Nagashima et al., 2011) and the transcription factors bZIP17 (Liu et al., 2007b) and bZIP28 (Liu et al., 2007a).
Within the ER, BiP is the most abundant chaperone and it is identified as one of the major targets induced during UPR in plants (Martinez and Chrispeels, 2003; Nishizawa et al., 2006). Apart from its roles in protein translocation across the ER membrane, protein folding and quality control, BiP has two major functions during the UPR in plants. On the one hand, BiP is the major ER-resident chaperone that helps to prevent protein aggregation by assisting protein maturation and folding (Gupta and Tuteja, 2011). On the other hand, BiP is indirectly involved in the activation of the UPR transcriptional response as it also regulates the activity of bZIP28 (Liu et al., 2007a; Srivastava et al., 2013). In Arabidopsis, there are three BiP isoforms that belong to the Heat Shock Protein 70 (Hsp70) family. However, these proteins have some important particularities compared to their cytosolic counterparts. Firstly, AtBiPs contain a signal peptide and an ER- retention peptide and, importantly, AtBiPs lack a conserved octapeptide GP(K/T)IEEVD that is located in the carboxy-terminal end of their cytosolic counterparts (where K is present in all the Arabidopsis´ and T is usually present in the mammalian's cytosolic Hsp70 proteins). This domain has been described essentially in mammals to mediate the Hsp70 interactions with TPR-containing cochaperones as HOPs (Scheufler et al., 2000).
HOPs belong to a conserved family of cochaperones with representative homologues in different eukaryotes as mammals, insects, plants or yeasts (Blatch et al., 1997; Demand et al., 1998; Honore et al., 1992; Nicolet and Craig, 1989; Song et al., 2009b). These proteins are defined structurally by the presence in their sequence of three tetratricopeptide-repeat (TPR)-domains (called TPR1, TPR2A and TPR2B). These domains consist of three or more TPR motifs,
CHAPTER 4
61
which are highly degenerate 34 amino acid repeats (Lamb et al., 1995) able to form structural modules that direct protein–protein interactions (Blatch and Lassle, 1999; Odunuga et al., 2004). Although HOP´s TPR domains could be involved in other interactions, the associations of HOP to the molecular chaperones Hsp70 and Hsp90 have been profusely studied. Specifically, Hsp70 binds primarily to the N-terminal TPR1 domain (Van Der Spuy et al., 2000) while the central TPR2A motif is known to be essential for Hsp90 binding (Odunuga et al., 2003). In both cases, their binding to HOP depends on the C-terminal ends of both Hsp70 and Hsp90. Specifically, the sequences GPTIEEVD of Hsc70 and MEEVD within Hsp90 have been proven to bind, respectively, to the TPR1 and TPR2A domains in human HOP. The involvement of these sequences in HOP binding has been resolved by crystal structure (Scheufler et al., 2000). Since HOP has no chaperone activity on its own (Bose et al., 1996; Freeman et al., 1996), the function of HOP was generally thought to be limited to a mere linker protein that brings and holds together Hsp70 and Hsp90; however, this seems a quite narrow view, since HOP appears to be involved in a number of Hsp70- and Hsp90-independent complexes (Daniel et al., 2008; Odunuga et al., 2004).
In plants, HOP homologues have been described in different species as soybean (Zhang et al., 2003), wheat (Fellerer et al., 2011), rice (Chen et al., 2010; Nakashima et al., 2008), N. benthamiana (Xu et al., 2014) and by in silico searches in Arabidopsis (Prasad et al., 2010). In some of these organisms, HOP interaction with cytosolic Hsp90 has been reported (Chen et al., 2010; Zhang et al., 2003). However, in vivo complexes with Hsp70 has not been described so far in plants, although HOP was detected associated to Hsp70 and Hsp90 in wheat germ lysate (Krishna and Kanelakis, 2003). Additionally, HOP has been recently involved in rice blast resistance (Chen et al., 2010) and as a cell-intrinsic virus restriction factor of the mitochondrial Carnation Italian Ringspot Tombusvirus (CIRV) in N. benthamiana (Xu et al., 2014). Besides its role in these biotic stresses, the role of HOP during the plant response to ER stress or to any other abiotic stresses remains largely unknown.
In this study, we have characterized the role of Arabidopsis HOP3 during the ER stress response. HOP3 interacts in vivo with cytosolic HSP90 and HSP70, indicating that it could be a functional member of the HOP family in Arabidopsis. The interaction of other HOP homologs with HSP90 have been previously described in plants (Chen et al., 2010; Zhang et al., 2003), but, to our knowledge this is the first time that the in vivo interaction with HSP70 has been demonstrated in this kingdom. Interestingly, we have shown that HOP3 interacts specifically with BiP, a major ER chaperone. BiP belongs to the Hsp70 family. However, it lacks the conserved octapeptide sequence that has been involved in the interaction between Hsc70 and HOP in other species (Odunuga et al., 2003; Scheufler et al., 2000; Van Der Spuy et al., 2000), making this interaction completely unexpected. Despite the lack of this conserved sequence, interaction analyses indicate that HOP3 binds to the nucleotide binding domain of BiP, demonstrating a noncanonical HOP binding to this major ER- resident protein. Consistent with the interaction with BiP, HOP3 is partly localized at the ER. Moreover, HOP3 is induced both at transcript and protein levels by UPR inducer agents by a mechanism dependent on IRE1. More importantly, hop3 loss-of-function mutants show a hypersensitive phenotype in the presence of the ER stress inducer agents dithiothreitol (DTT) and tunicamycin (TM), demonstrating that this protein plays an essential role during the ER stress response. In line with this observation, the hop3-1 mutant shows a reduction in pollen germination, a developmental process with a high demand in protein folding and secretion and, therefore, especially vulnerable to disturbances in ER protein homeostasis. The hypersensitivity to ER stress could be reverted by
CHAPTER 4
62
the addition of tauroursodeoxycholic acid (TUDCA), a chemical chaperone, further reinforcing a main role of HOP3 in the alleviation of the ER stress response. All these data demonstrate, for the first time in any eukaryote, that HOP3 interacts with BiP and plays an important role as a regulator of the ER stress response in plants.
4.2 RESULTS
4.2.1 HOP3 is expressed in different tissues
In order to characterize the possible role of HOP3 (At4g12400), we started analyzing its expression in different Arabidopsis tissues both at the transcript and protein levels. The selected organs included leaves, buds, flowers, stems, seedlings and roots. RT-qPCR analysis demonstrates that HOP3 is highly accumulated in roots, seedlings and reproductive tissues (Figure 4.1A). These results are in agreement with the data obtained from available microarray analyses, where HOP3 was highly detected in roots and to a minor extent in flowers (Prasad et al., 2010).
Figure 4.1. Analysis of the HOP3 expression pattern at the mRNA and protein level in different Arabidopsis tissues. (A) Relative HOP3 expression analysis by qRT-PCR. Fold change values are related to the expression in leaves that was arbitrarily assigned value 1 after normalization to TUB5 (internal control). (B–H) GUS activity in seedlings and floral organs from transgenic Arabidopsis plants containing the fusion HOP3pro-HOP3-GUS: 7 day-old seedling (B), 14 day-old seedling: aerial part (C), main root (D), lateral root (E) and 4 week-old floral organs (F–H).
To determine the expression of HOP3 protein at the tissue level, transgenic Arabidopsis plants containing a genomic HOP3-β-glucuronidase (GUS) fusion under the control of HOP3 promoter (HOP3pro-HOP3-GUS) were generated and assayed for GUS activity. This analysis demonstrates that, consistent with the transcript expression, HOP3 is expressed mainly in roots on 7 day -old seedlings (Figure 4.1B), and in roots and leaves at older stages (Fig 4.1C). In roots HOP3 highly accumulates at the meristematic zone (Figure 4.1D-E). HOP3 expression is also detected at high levels in reproductive tissues such as anthers, pollen grains and ovules (Figure 4.1F-H).
CHAPTER 4
63
4.2.2 HOP3 interacts with HSP90, HSP70 and unexpectedly with the ER resident chaperone BiP
HOPs have been described as scaffolding proteins able to mediate the formation of functional multiprotein complexes containing cytosolic HSP90 and HSP70 proteins in mammals and yeast (Odunuga et al., 2003; Scheufler et al., 2000; Van Der Spuy et al., 2000). Thus, in order to analyse whether HOP3, a presumed member of the HOP family in plants, was able to mediate these type of complexes, we immunoprecipitated HOP3 from seedlings of transgenic plants expressing HOP3-HA under the control of its own promoter (HOP3pro-HOP3-HA) and we analysed HOP3 interaction with cytosolic HSP90 and HSP70 by western-blot. It was previously described that HOP3 is highly induced under heat stress (Nishizawa et al., 2006; Yanguez et al., 2013). Therefore, we decided to increase the HOP3-HA levels by challenging the seedlings with a heat stress of 38°C for 3 h, in an attempt to enhance the efficiency of the assay. As shown in Figure 4.2A, we can easily immunoprecipitate HOP3-HA from extracts of the HOP3pro-HOP3-HA transgenic plants, and alongside HOP3, we could also detect HSP90.1 and cytosolic HSP70 in the immunoprecipitates. These data demonstrate that HOP3 interacts with cytosolic HSP90 and HSP70 in vivo.
In addition, we also tested HOP3 interaction with BiP. BiP belongs to the HSP70 family, but it lacks the GP(K/T)IEEVD octapeptide that has been proven crucial for HSP70-HOP binding in mammals (Odunuga et al., 2003; Scheufler et al., 2000; Van Der Spuy et al., 2000) and so, no BiP interaction was expected with HOP3. Unexpectedly, we could also detect a clear band that was recognized by commercial specific anti-BiP antibodies in the HOP3 immunoprecipitations (Figure 4.2A), suggesting an interaction between BiP and HOP3.
Figure 4.2. HOP3 interacts in planta with BiP. (A) Seedlings from Arabidopsis plants expressingHOP3-HA under its own promoter or fromCol-0 (as control) were subjected to a heat treatment of 38 °C for 3 h. After the treatment, equal amounts of protein extracts (Input) were subjected to purification with anti-HA beads which were eluted with low pH. Equal amounts in volume of the eluted fractions (IP) were run in sodium dodecylsulphate– polyacrylamide gel electrophoresis (SDS–PAGE) and subjected to Western blot using anti-HA, anti-HSP90.1, anti-cytosolic HSP70 and, after running the samples in a different gel, with anti-BiP antibodies. A crossreacting band is shown as negative
CHAPTER 4
64
control. (B) Protein extracts (Input) from control and N. benthamiana leaves transiently expressing different combinations of BiP1-Myc, BiP2-Myc and HA-HOP3, under the control of the 35S promoter were subjected to purification with anti-IgG agarose beads and to further elution by low pH. Equal amounts in volume of the eluted fractions (Elution) were run in SDS–PAGE and subjected to Western blot using anti-Myc and anti-HA antibodies.
The latter experiments were done using extracts from Arabidopsis seedlings challenged with heat. Therefore, to discard that HOP3-BiP interaction were only supported under heat stress, we agroinfiltrated N. benthamina leaves with the construct p35S-GFP-HOP3 and we carried out HOP3 immunoprecipitations in the absence of any heat challenge. As shown in Figure 4.S1, we could also detect in these assays that HOP3 specifically immunoprecipitates along with the N. benthamiana BiP, further demonstrating this interaction endures in vivo in the absence of heat.
Finally, to corroborate this interaction using different antibodies, and to discard any possible cross-reaction of the commercial BiP antibody to members of the cytosolic HSP70 family, we agroinfiltrated N. benthamina leaves with the constructs p35S-HA-HOP3 and p35S-AtBiP1 and p35S-AtBiP2 tagged in their C-terminal end with the myc epitope and the IgG binding domain of protein A and we carried out BiP1 and BiP2 immunoprecipitations using IgG agarose beads. As shown in Figure 4.2B, HOP3 specifically coimmunoprecipitates with AtBiP1 and AtBiP2, further demonstrating their interaction in vivo.
4.2.3 HOP3 interacts with the ATPase binding domain of BiP
As stated before, BiP lacks the highly conserved GP(K/T)IEEVD sequence that mediates HOP interaction with the cytosolic HSP70 proteins (Brinker et al., 2002; Scheufler et al., 2000). The lack of this sequence implied that other domains should be involved in the interaction with HOP3, and so, to identify the domains within BiP that mediate BiP-HOP3 interaction, we expressed different truncated forms of an AtBiP1 mutant (ΔBiP1) that lacks the ER-signal peptide and the (HDEL) ER- retention signal (Figure 4.3A) and assayed their ability to interact with full-length HOP3 in the yeast two-hybrid system.
Figure 4.3. Identification of BiP domains involved inHOP3 binding. (A) Scheme of the different BiP fragments used in the yeast two-hybrid assay (SP, signal peptide; HDEL ER-retention signal). (B) BiP1 truncations were fused to the GAL4 DNA-binding domain (Gal4-BD) and coexpressed with HOP3-GAL4 activation domain (Gal4-AD) in the yeast strain AH109. As control, the bare Gal4-AD and -BD were coexpressed with the different constructs. Independent transformants were tested for growth in non-selective media (-Leu -Trp) or prototrophy-selective media (-Leu -Trp -His).
CHAPTER 4
65
As shown in Figure 4.3B, yeast transformed with HOP3 along with ΔBiP1 or a truncated version that only contains the nucleotide binding domain (ΔBiP1_NBD) could grow readily under the selective medium, while those co-transformed with HOP3 and the version that only contains the substrate-binding domain (ΔBiP1_SBD) are unable to grow in the absence of His. As negative controls, combinations of the different constructs with Gal4-BD or –AD were also assayed, impairing the yeast growth in the prototrophic- selective media. These data support the HOP3-BiP interaction in the yeast two-hybrid system and demonstrate that the ATPase domain of BiP1 could support HOP3 binding
4.2.4 HOP3 is localized in the cytoplasm and the ER
The data described before demonstrate that HOP3 interacts in vivo with BiP. Since BiP is an ER-resident protein, HOP3 should be localized at some point at the ER to allow this interaction. So, to investigate the subcellular localization of HOP3 protein, transgenic Arabidopsis expressing a genomic HOP3–Green Fluorescent Protein (GFP) fusion driven by its corresponding HOP3 promoter (HOP3pro-HOP3-GFP) were obtained and analyzed for GFP expression. As shown in Figure 4.4A, the green fluorescence suggested that HOP3 is mainly localized in the cytoplasm where GFP containing structures that resemble the ER could be observed (Figure 4.4C), suggesting that HOP3 could also be localized at the ER.
Figure 4.4. Analysis of HOP3 subcellular localization. Subcellular localization of HOP3-GFP in the root tip (A) and in root differentiated cells (D) in 7-day-old transgenic Arabidopsis lines expressing the HOP3pro-HOP3-GFP construct. (B and D) White field of the images in (A) and (C), respectively. Bars = 50 μm. (E–G) Localization ofGFP-HOP3 (E), RFP-ER (F) and merge of both images (G) in N. benthamiana leaves by transient co-expression of the cited proteins.
CHAPTER 4
66
To corroborate this result, we carried out HOP3-GFP co-localization experiments with an ER-specific organelle marker. For these assays, N. benthamiana leaves were co-agroinfiltrated with a construct expressing HOP3 cDNA fused to GFP under the control of a constitutive promoter (p35S-HOP3-GFP) and with the ER marker, ER-RFP (Thomas et al., 2008). As shown in Figure 4.4E-G, we can detect GFP in typical ER structures that further co-localized with ER-RFP. These data demonstrate that HOP3 is localized in the cytoplasm and a portion of this bulk is localized at the ER.
4.2.5 HOP3 is induced during the UPR and its expression is controlled by IRE1
HOP3 localization to the ER along with its interaction to BiP, a protein with a prominent role during the UPR, opened the possibility that HOP3 could have a role during the ER stress response in plants. This possibility was especially attractive since, although some members of the HOP family were also detected in the endomembrane system (Chen et al., 2010; Honore et al., 1992), the possible role of HOP during the ER stress and UPR had not been further explored in any organism. Therefore, we analysed if the expression of HOP3 could be regulated during the UPR. As shown in Figure 4.5A, we can detect a clear accumulation of GUS activity in the transgenic plants expressing the construct HOP3pro-HOP3-GUS in the presence of 2.5 mM DTT and 5 µg mL-1 TM, two well-known ER stress inducers (Kamauchi et al., 2005; Martinez and Chrispeels, 2003). These data demonstrate that HOP3 is accumulated at the protein level during the UPR. This induction was also confirmed at the mRNA level by qRT-PCR analysis in wt plants (Figure 4.5B).
Figure 4.5. HOP3 expression is induced by DTT and TM, and this induction is dependent on IRE1. (A) Analysis of GUS activity in 14-day-oldseedlings from transgenic plants containing the construct HOP3pro-HOP3-GUS. (B) Analysis of the expression of the HOP3 by qRT-PCR in 7 day-old Col-0 seedlings. In both cases, the plants were treated in the absence (control) or in the presence of 2.5 mM DTT or 5 μg mL-1 TM as described in Materials and Methods. (C) Analysis of HOP3 expression by qRT-PCR in different mutants in UPR signaling in the absence (light grey bars) or presence of 2.5 mM DTT (dark grey bars). Expression fold change values are related to the Col-0 samples in the absence of treatment, which are arbitrarily assigned value 1 after normalization to TUB5 (internal control). Statistical significant differences (P ≤ 0.01) using ANOVA analyses are highlighted by an asterisk.
CHAPTER 4
67
As stated above, a major component of the UPR signalling pathway in plants is the RNA splicing factor inositol-requiring enzyme 1 (IRE1) that mediates a splicing event on bZIP60 and its further activation (Moreno et al., 2012; Nagashima et al., 2011). In addition to bZIP60, two other membrane-bound bZIP transcription factors, bZIP28 and bZIP17, play important roles in the transcriptional activation of the ER stress signalling. Since the data provided before demonstrate that HOP3 is an UPR responsive gene, we decided to analyse if this HOP3 induction was mediated by some of the described regulators. To do so, we analysed the HOP3 expression in the double mutant of the two members of the IRE1 family ire1a/b and in bzip28 and bzip17 single mutants in the absence and presence of the UPR inducer agent DTT. As shown in Figure 4.5C, HOP3 induction by DTT was only impaired in the ire1a/b double mutant, demonstrating that HOP3 expression is induced specifically by this important UPR arm.
4.2.6 HOP3 has a major role during the ER stress response
To further study the possible role of HOP3 in the establishment of the UPR, we searched for T-DNA lines with insertions in the HOP3 gene. Two lines containing a single T-DNA insertion located in the first and the second exons of HOP3 were identified in Col-0 (hop3-1) and WS (hop3-3) backgrounds, respectively (Figure 4.S2A). Both lines show reduced levels of HOP3 compared to their corresponding wild-type plants (Figure 4.S2B and 4.S2C), revealing that these mutants were null or highly hypomorphic. Interestingly, none of these mutants displays any obvious morphological or developmental abnormality under control conditions (Figure 4.6A, control conditions). However, when the medium was supplemented with 2.5 mM DTT, the growth of hop3-1 was severely impaired, showing a high percentage of yellowish seedlings and a reduction in the percentage of plants with expanded green cotyledons compared to their corresponding wild-type (Figure 4.6). A similar phenotype was also observed for hop3-3. This phenotype is milder than the one displayed by hop3-1, but still clearly noticeable and statistically significant (Figure 4.6).
Figure 4.6. Phenotypic analyses in the presence of DTT of the hop3-1 and hop3-3 mutants compared to their wild-type counterparts (Col-0 and WS, respectively). (A) Representative photographs of the growth of the different mutants and backgrounds in the absence (control, upper panel) or presence of 2.5 mM DTT (lower panel). (B) Quantification of the percentage of seedlings with fully-expanded green cotyledons after germination on a medium containing 2.5 mM DTT. In all cases, the percentage of fully expanded green cotyledons under normal conditions was 100%. Values are shown as means + SEM. Statistical differences (P ≤ 0.01) using one-way ANOVA analysis are highlighted by an asterisk.
CHAPTER 4
68
Since both lines showed a similar phenotype, we decided to focus on hop3-1 for further analysis. Nevertheless, to further confirm that the phenotype observed in the hop3-1 mutant is due to the absence of HOP3 expression, we transformed the hop3-1 line with a construct expressing HOP3 under the control of its own promoter (HOP3pro-HOP3-HA), obtaining different lines with similar induction of the endogenous gene (Figure 4.7C). In these lines, the hop3-1 hypersensitivity phenotype to DTT was completely rescued when HOP3 levels were complemented (Figure 4.7A-B), demonstrating that the observed phenotype is related to the absence of HOP3. Moreover, the genomic HOP3 fragment used for this complementation analysis (HOP3pro-HOP3) was the same used for the fusions to GUS and GFP, further reinforcing the expression data described before.
Figure 4.7. The hypersensitive phenotype to DTT of the hop3-1 mutant is due to the absence of HOP3. (A) Representative photographs of the growth of Col-0, hop3-1 and of two independent hop3-1 lines complemented with the HOP3pro-HOP3-HA construct (lines 3.3 and 4.6) in the absence (upper panels) or presence of 2.5 mM DTT (lower panels). (B) Quantification of the percentage of seedlings with fully expanded green cotyledons from the different lines after germination in the presence of 2.5 mM DTT. In all cases, the percentage of fully expanded green cotyledons under normal conditions was 100%. (C) Analysis by qRT-PCR of HOP3 expression in Col-0, hop3-1 and complemented lines. Fold change expression values are related to Col-0 sample in the absence of treatment, which is arbitrarily assigned value 1 after normalization to TUB5 (internal control). Values are shown as means + SEM. Statistical differences (P ≤ 0.01) using one-way ANOVA analysis are highlighted by an asterisk.
Finally, a clear high percentage of yellowish seedlings and a reduction in the percentage of plants with expanded green cotyledons were also observed when hop3-1 was germinated in the presence of 0.1 µg mL-1 TM (Figure 4.S3), demonstrating the hypersensitivity of this line, not only to DTT, but also to a different ER stress inducer (TM).
CHAPTER 4
69
The hypersensitive phenotype of the hop3 mutants to different ER stress inducers, along with its subcellular localization at the ER, demonstrates that HOP3 has a major role during the ER stress response in plants.
Activation and the proper function of the ER stress response is essential to maintain protein homeostasis during developmental processes with a high demand for protein folding and secretion, as pollen germination (Fragkostefanakis et al., 2016). Since our results clearly demonstrate that HOP3 participates in the ER stress response in plants, we wondered whether HOP3 could play a role during this ER stress-dependent stage of development and, so, we analysed hop3-1 pollen germination in vitro. As shown in Figure 4.8, pollen germination was highly reduced in hop3-1 mutant compared to their corresponding wt plants, demonstrating that HOP3, as other ER stress related proteins (Fragkostefanakis et al., 2016), plays an important role during this ER stress-related developmental process.
Figure 4.8. hop3-1 mutant shows a reduced level of in vitro pollen germination. (A) Representative figures of in vitro pollen germination assays from Col-0 and hop3-1 mutant. (B) Percentage of in vitro pollen germination of three independent replicas, in which a minimum of 500 pollen grains was analyzed from each genotype. This percentage is presented as mean + SEM. Statistical differences (P ≤ 0.01) are highlighted by an asterisk.
4.2.7 The hop3-1 hypersensitive phenotype to ER stress is not due to a general misactivation of the UPR transcriptional cascade
As cited previously, one of the early events during the UPR is the upregulation of the transcriptional expression of a battery of chaperones and foldases involved in alleviating the accumulation of misfolded proteins during ER stress. Thus, it could be possible that the defect in the folding capacity of the hop3-1 mutant is related to the improper activation of the UPR transcriptional response and an accumulation of chaperones and foldases. So, in order to rule out this hypothesis, we decided to investigate if HOP3 could be involved in the early activation of this transcriptional cascade by comparing the expression levels of different UPR regulated genes (BiP3, SHD, PDIL1-1, CRT1B and CNX1) (Liu and Howell, 2010a; Martinez and Chrispeels, 2003) upon the establishment of the UPR in the wild-type control plants and in the hop3-1 mutant.
As shown in Figure 4.S4, and as expected for UPR marker genes, all the selected genes are induced in wild-type plants after the treatment with 2.5 mM DTT for 4 h. A similar induction is also observed in the hop3-1 mutant plants, ruling out the possibility that the hop3-1
CHAPTER 4
70
hypersensitive phenotype was due to a general downregulation of the UPR transcriptional cascade.
4.2.8 The addition of TUDCA reverts the hop3-1 sensitivity to ER stress agents
TUDCA is a bile acid that promotes ER stress alleviation in mammals and plants (Ozcan et al., 2006; Watanabe and Lam, 2008; Williams et al., 2010). So, in order to further corroborate the effect of HOP3 in the ER stress response, we tested if the hop3-1 hypersensitive phenotype could be rescued in the presence of TUDCA. As shown in Figure 4.9, the hypersensitive phenotype of ER-stressed hop3-1 plants was completely reverted by the addition of this compound, further demonstrating the prominent role of HOP3 during the ER stress response in plants.
Figure 4.9. The ER stress hypersensitive phenotype of hop3-1 mutant is reverted by the addition of TUDCA. (A) Phenotypic analysis of the growth of hop3-1 and Col-0 Arabidopsis seedlings germinated in the absence (upper panel), in the presence of TM (middle panel) and in the presence of both TM and TUDCA (lower panel). (B) Quantification of the percentage of Col-0 and hop3-1 seedlings with fully expanded green cotyledons upon germination in the presence of TM or in the presence of TM and TUDCA. In all cases, the percentage of fully expanded green cotyledons under normal conditions was 100%. Values are shown as means + SEM. Statistical differences (P ≤ 0.01) using one-way ANOVA analysis are highlighted by an asterisk.
4.3 DISCUSSION
4.3.1 HOP3, a member of the HOP family in Arabidopsis, has an unexpected role in the ER stress
Eukaryotic cells have evolved sophisticated mechanisms to maintain cellular homeostasis that aims at alleviating the accumulation and aggregation of misfolded proteins during the ER stress conditions. One of these mechanisms is the induction of the expression of chaperones and foldases to facilitate protein folding (Credle et al., 2005; Kamauchi et al., 2005; Martinez and Chrispeels, 2003). Because of their importance, the main chaperones involved in the ER stress
CHAPTER 4
71
response have been deeply studied in different eukaryotes and also in plants. These include BiP, calreticulin and calnexin (Gupta and Tuteja, 2011; Liu and Howell, 2010a). However, although the main chaperones have been deeply characterized, our knowledge about a large number of the proteins regulated during the UPR response is very limited.
In this article, we have identified HOP3 as a novel protein with an essential role in the ER stress in plants. HOP3 is characterized by the presence of 3 TPR domains and shares high homology with known members of the HOP family in eukaryotes. In mammals and yeast, where the function of HOP was deeply studied, HOP activity has been mainly linked to its interaction with cytosolic HSP90 and HSP70 (Odunuga et al., 2004). In plants, so far, HOP has been only described as complexes with cytosolic HSP90 in vivo (Chen et al., 2010). As shown in Figure 4.2, we described that along with HSP90, HOP3 also interacts with cytosolic HSP70, indicating that HOP3 is a true HSP70/HSP90 organizing protein. The fact that the most studied interactors are cytosolic could be the reason why the full characterization of its role in the ER-stress response has remained elusive since this response is compartmentalized in the ER and the proteins involved are mainly ER resident proteins.
4.3.2 HOP3 interacts with BiP and may assist BiP during the alleviation of the ER stress response
As shown in Figure 4.2, we have demonstrated that HOP3 interacts with BiP in vivo. Although BiP belongs to the HSP70 family, the interaction between HOP3 and BiP was unexpected because the three members of the Arabidopsis BiP family lack a highly conserved carboxy-terminal sequence that has been described to mediate the HSP70-HOP binding in other eukaryotes (Scheufler et al., 2000). Since AtBiPs lack this sequence for TPR1 binding, the HOP3 interaction with BiP suggested that new residues within the molecules could be mediating their interaction. In this sense, our yeast two-hybrid analyses demonstrate that HOP3 is able to interact with the NBD domain located at the amino-terminal part of BiP1. Due to the high homology among the members of the AtBiP family in this domain, especially between BiP1 and BiP2, it is likely that a similar interaction could be expected for AtBiP2 and probably for AtBiP3. Interestingly, noncanonical interactions between BiP and IRE1 and PERK, involving the BiP ATPase domain have been recently described in humans (Carrara et al., 2015).
In this article we have demonstrated that hop3 mutants show an enhanced sensitivity to different ER stress inducer agents. In addition, our data establish that the increased sensitivity of the hop3-1 mutant to TM is reverted in the presence of TUDCA, a compound that alleviates ER stress in plants and mammals (Ozcan et al., 2006; Watanabe and Lam, 2008; Williams et al., 2010), further reinforcing the prominent role of HOP3 during ER stress response.
Although there is a high consensus in the bibliography describing TUDCA as a compound that alleviates ER stress, there are strong discrepancies on how TUDCA promotes this alleviation, opening different possibilities for the exact mechanism of HOP3 during the ER stress response. On the one hand, different authors have suggested that TUDCA alleviates ER stress (and mainly the ER- dependent cell death) by impinging on the signal transduction pathway without affecting protein folding (de Almeida et al., 2007; Xie et al., 2002). On the other hand, other authors have recently demonstrated that TUDCA per se or as co-chaperone of other complexes has a suppressive effect on the thermal aggregation of different proteins in vitro (Berger and Haller, 2011; Gani et al., 2015; Song et al., 2011). Based on these hypotheses, the reversion of
CHAPTER 4
72
the hypersensitivity phenotype of hop3-1 by the addition of TUDCA may reflect either a possible role of HOP3 as a survival factor (preventing ER induced plant cell death) under ER stress or a role of HOP3 avoiding protein aggregation in the ER. Interestingly, it has to be noted that both possibilities are not absolutely exclusive, since an increase in ER associated-plant cell death could be also expected by an excessive accumulation of misfolded proteins and, therefore, could be alleviated by a reduction of the load of misfolded proteins in the ER. This is the case of the hypersensitive phenotype of atbi-1, a mutant that also shares with hop3-1 the lack of a clear misregulation of the UPR pathway in the presence of the ER stress inducer agents (Watanabe and Lam, 2008).
Based on the described interaction between HOP3 and BiP and the major role of BiP in protein folding and in the attenuation of the ER-stress cell death in plants (Gupta and Tuteja, 2011; Reis et al., 2011), it is tempting to speculate that, whatever the exact mechanism, HOP3 may assist BiP in the alleviation of the ER stress.
4.3.3 Consistent with its role in the ER stress response, HOP3 is partially localized at the ER
In mouse cells, HOP shows a predominantly cytoplasmic localization under normal growth conditions (Daniel et al., 2008; Lassle et al., 1997). However, a minor proportion of the HOP bulk was also detected in the nucleus (Daniel et al., 2008) and in the plasma membrane, this latter as part of the PrPc protein complex (Zanata et al., 2002). Previous studies have also reported the presence of human HOP in the Golgi apparatus and small vesicles (Honore et al., 1992). More recently, the presence of a member of the HOP family in the ER and plasma membrane rich fractions was also described in rice (Chen et al., 2010), although in no case the role of these proteins in the ER stress response was further addressed. Our results demonstrate that under normal conditions HOP3 is mainly localized in the cytoplasm. However, a fraction of the HOP3 bulk is detected specifically in the ER (Figure 4.4). This statement is based on two different evidences: the colocalization with an ER marker protein in N. benthamiana leaves (Figure 4.4) and its interaction in vivo with BiP, an ER-resident protein (Figure 4.2).
Co-translationally ER translocated proteins usually contain a signal sequence that allows the resultant nascent protein being directly translocated into the ER (Keenan et al., 2001). Although HOP3 is localized in the ER, it lacks the characteristic ER signal peptide found in other ER resident proteins. In line with this evidence and the HOP3 presence in the cytoplasm, we can speculate that probably this protein is not co-translationally translocated, but it is post-translationally transported from the cytoplasm to the ER.
4.3.4 HOP3 is induced during the UPR elicited by chemical inducer agents and at specific stages of plant development
As shown in Figure 4.5, HOP3 is induced by ER stress promoting agents and this induction is dependent on IRE1, a master regulator of the UPR.
In line with its possible role during the ER stress, we can observe HOP3 expression in tissues with a high demand for secretory proteins as it is the case of pollen grains. In this sense, recent
CHAPTER 4
73
transcriptome and proteome analyses have shown that components of the ER-folding machinery and of the UPR are upregulated at specific stages of pollen development (Fragkostefanakis et al., 2016), an observation that, based on our results, also applies in the case of HOP3 (Figure 4.8). Consistent with these observations, we have demonstrated that the hop3-1 mutant shows reduced pollen germination in vitro, reinforcing the role of HOP3 in developmental processes with special needs for protein folding and secretion.
4.3.5 Within the AtHOP family, HOP3 per se is required for the proper establishment of the ER stress response in plants
As stated in the introduction, there are three members of the HOP family in Arabidopsis. All these genes, HOP1, HOP2 and HOP3, are expressed and translated into their subsequent proteins (data not shown). The sequence analyses of these HOP proteins demonstrate that they have a high level of identity ranging from 74% to 82%, sharing HOP1 and HOP2 the highest identity. These three proteins have similar TPR domains and probably they share similar functions. Although some kind of redundancy could not be completely discarded, the analysis of the different hop3 single mutants demonstrate that HOP3 alone seems to be absolutely required for the proper establishment of the ER stress response in plants.
This is the first time, to our knowledge, that the characterization of the role of a member of the HOP family as an essential component of the ER stress response has been done in eukaryotes. In addition, this is also the first time that the interaction of HOP and BiP has been proposed. The ER stress response is highly conserved in eukaryotes and so are HOP and BiP (known as GRP78 in mammals), therefore, these data could also be relevant, not only for plants but also for other eukaryotes including yeast, insects or mammals.
Alleviation of the ER stress and proper establishment of UPR are crucial during specific stages of plant development and during the plant response to different environmental stresses as heat, salinity, drought or pathogen attack (Liu and Howell, 2010b; Moreno and Orellana, 2011). Since our data provides different evidences that HOP3 is involved in the ER stress response, this study opens the possibility that HOP3 or other members of the HOP family, by modulating this function, may have a main role in processes as important for crop productivity as pollen and seed maturation or during the response to environmental challenges.
CHAPTER 4
74
4.4 SUPPLEMENTAL DATA
Figure 4.S1. HOP3 interacts with BiP from N. benthamiana leaves. Protein extracts (Input) from control N. benthamiana leaves or leaves transiently expressing GFP-HOP3 under the control of the 35S promoter were subjected to purification with anti-GFP beads and elution by boiling in loading buffer. Equal amounts in volume of the eluted fractions (IP) were run in SDS–PAGE and subjected to Western blot using anti-GFP and anti-BiP antibodies.
Figure 4.S2. T-DNA insertion lines with insertion in the HOP3 gene. (A) Schematic genomic organization of HOP3. Exons are indicated as rectangles. The triangles mark the position of the T-DNA insertions. (B) qRT-PCR analysis of HOP3 expression levels in hop3-1 and in its corresponding wild-type background (Col-0) under control conditions (light grey bars) or in the presence of 2.5 mM DTT (dark grey bars). Values are shown as means + SEM. (C) Semiquantitative RT-PCR analysis of HOP3 levels in hop3-3 mutant compared to the corresponding wild-type background (WS) under control conditions or in the presence of 2.5 mM DTT.
CHAPTER 4
75
Figure 4.S3. Phenotypic analysis of the hop3-1 mutant upon tunicamycin (TM) treatment. (A) Phenotypic analysis of the growth of hop3-1 and Col-0 Arabidopsis seedlings germinated in the absence (upper panel) or in the presence of 0.1 μg mL-1 TM (lower panel). (B) Quantification of the percentage of Col-0 and hop3-1 seedlings with fully expanded green cotyledons upon germination in the presence of the cited concentration of TM. In all cases, the percentage of green cotyledons under normal conditions was 100%. Values are shown as means + SEM. Statistical differences (P≤ 0.01) using one-way ANOVA analysis are highlighted by an asterisk.
Figure4. S4. qRT-PCR analysis of the relative expression of UPR marker genes in 7 day-old seedlings from Col-0 and hop3-1 mutant after a treatment of 2.5 mM DTT for 4 h. Fold change expression values of BiP3 (At1g09080), SHD (At4g24190), PDIL1-1 (At1g21750), CNX1 (At5g61790) and CRT1b (At1g09210) are related to Col-0 sample in the absence of treatment, which is arbitrarily assigned value 1 after normalization to TUB5 (internal control). Values are shown as means +SE.
5. CHAPTER 5. HOP3 A COCHAPERONE INVOLVED IN
PLANT IMMUNITY
CHAPTER 5
80
HOP3 a cochaperone involved in plant immunity
5.1 INTRODUCTION
Plants defend from pathogens by an evolved battery of defense mechanisms, which are either constitutive or activated upon pathogen recognition (Glazebrook, 2001; Pieterse et al., 2009). In plants, the inducible immune system in plants consists of two interconnected branches termed PAMP-triggered immunity (PTI) and effector-triggered immunity (ETI): PTI is initiated upon the perception, through pattern recognition receptors (PRRs), of well conserved pathogen-associated molecular patterns (PAMPs). Additionally, ETI results from an adaptation mechanism, in which plants acquired resistance (R) proteins that recognize pathogen-specific effectors (Jones and Dangl, 2006). In addition, ETI induces the expression of pathogenesis-related (PR) genes that encode PRs proteins in plants.
One important aspect of plant immunity is that the transcriptional induction depends on the activation of specific signaling pathways activated by phytohormones. Despite the role of these compounds in plant physiological processes such as growth, development, reproduction or senescence, plant hormones have been specifically described as primary signals involved in regulating the plant immune response. Pathogenic infection stimulates the plant to synthesize one or more hormonal signals depending on the type of pathogen (Glazebrook, 2005). According their “style of life”, pathogens can be classified in biotrophic and hemibiotrophic, which require living host tissue to colonize the plant cell using cell nutrients for survival, such as the bacteria Pseudomonas syringae pathovar (pv.) tomato DC3000 (Pst DC3000) or the haustorium forming Golovomyces cichoracearum fungi (Dean et al., 2012; Huckelhoven and Panstruga, 2011) or in necrotrophic pathogens, that produce enzymes and toxins to destroy host tissue and use it as a source of nutrients, for instance, the fungus Botrytis cinerea (B. cinerea) or the bacteria Pectobacterium carotovorum. Fusarium oxysporum sp. conglutinans (Foc) is a vascular fungus also considered into this group of phytopathogens although it requires of living vascular tissue to colonize the plant (AbuQamar et al., 2017; Berrocal-Lobo and Molina, 2008; Berrocal-Lobo et al., 2002; Cianciotto and White, 2017; Mansfield et al., 2012; Mengiste, 2012).
Among all hormone-mediated defense signaling pathways, the best-known are salicylic acid (SA), jasmonic acid (JA) and ethylene (ET) (Bari and Jones, 2009; del Pozo et al., 2004; Denance et al., 2013; Loake and Grant, 2007; van Loon et al., 2006). It is well characterized that the SA signaling process positively regulates PR-1 (pathogenesis-related protein 1) production, which has a toxic effect mainly against biotrophic and hemibiotrophic pathogens. In contrast, under the presence of necrotrophic pathogens, plants commonly activate ET/JA pathways for the production of specific antimicrobial peptides such as defensins, thionins and other PRs (Nawrot et al., 2014; Tam et al., 2015). However, hormone-mediated defense can be quite complex, for instance, some pathogens such as rice blast fungus (Magnaporthe oryzae) activates both SA and ET pathways (Jiang et al., 2010) and different evidences suggest that JA also plays a role in plant resistance against specific types of biotrophic fungi, specifically against several powdery mildews (Antico CJ, 2012). In addition, it should be noted that all
CHAPTER 5
81
defense response mechanisms form a network in which all these signals are interconnected. For instance, activation of SA pathway is known to interfere with JA and ET pathway and vice-versa (Berrocal-Lobo et al., 2002; El Oirdi et al., 2011; Pieterse et al., 2009; Wang et al., 2017b).
Considering that the defense response depends on the high production and secretion of defense-related proteins and is the endoplasmic reticulum (ER) which hosts the synthesis and folding of membrane and secreted proteins; the ER plays a central role in plant defense responses and regulates four principal functions in immunity: the transcriptional regulation of defense-related genes (Korner et al., 2015; Moreno and Orellana, 2011; Nagashima et al., 2014) the secretion of antimicrobial and PR proteins (Moreno et al., 2012; Wang et al., 2005), the biogenesis and intracellular distribution of receptors (Nekrasov et al., 2009; Saijo, 2010; Saijo et al., 2009) and the fine tuning of the plant cell death (PCD) during the ETI-associated hypersensitive response (Carvalho et al., 2014; Mishiba et al., 2013; Xu et al., 2012a; Ye et al., 2011).
During pathogen infection, the synthesis of antimicrobial proteins and the maturation of pathogen receptors increase considerably. This high demand of protein folding overwhelms the folding capacity of the ER, triggering ER stress. ER stress alleviation is critical for plant adaptation to biotic stresses (Eichmann and Schafer, 2012; Korner et al., 2015; Tintor and Saijo, 2014). This observation is supported by numerous reports that demonstrate an essential role of the ER-chaperone BiP to attenuate ER stress, promoting plant immunity (Deng et al., 2013; Korner et al., 2015; Wang et al., 2005). In chapter 4, we have demonstrated that BiP interacts in vivo with an HSP70-HSP90 organizing protein (HOP) in Arabidopsis, specifically HOP3 (Fernandez-Bautista et al., 2017). In animals and yeast, the associations of HOP to the molecular chaperones HSP70 and HSP90 has been profusely studied. Despite in plants the HOP biological function has not yet been elucidated, we also demonstrated that HOP3 interacts with high affinity to cytosolic HSP90 in vivo in Arabidopsis, as described in Chapter 4 (Fernandez-Bautista et al., 2017). It is well characterised that cytoplasmic HSP90 plays critical roles in plant innate immunity since the complex HSP90-RAR1-SGT1 participates in the activation of cytosolic R proteins, that are essential for phytopathogen recognition process (Boter et al., 2007; Hubert et al., 2003; Liu et al., 2004; Takahashi et al., 2003; Young-Su Seo, 2008). Additionally, in rice, HSP90 is implicated in the maturation and transport of the chitin receptor CERK1 to the plasma membrane, curiously by the association with a HOP rice homolog. Indeed, rice mutant of HOP shows increased susceptibility to rice blast fungus (Chen et al., 2010). Although all these data suggest an implication of HOP3 in plant immunity, the knowledge of HOP3 in biotic stresses remains largely unknown, constituting an exciting field of study in plants. Therefore, taking into account the interaction of HOP3 with BiP and HSP90, we proposed to characterize the direct role of HOP3 in defense response in Arabidopsis.
In this study, we have studied the involvement of HOP3 in the plant defense response to different phytopathogens. Specifically, to the necrotrophic fungus B. cinerea, the vascular and hemibiotrophic fungus Fusarium oxysporum sp conglutinans (Foc) and the hemibiotrophic bacteria Pst DC3000. All of them are phytopathogens responsible for substantial economic losses in agriculture and they activate different signaling pathways of plant immunity (AbuQamar et al., 2017; Berrocal-Lobo and Molina, 2008; Dean et al., 2012). B. cinerea is a
CHAPTER 5
82
necrotrophic fungus, also known as grey mould, which infects more than 200 plant species and is the most extensively studied necrotrophic fungal pathogen (AbuQamar et al., 2017). B. cinerea is considered one of the ten most important phytopathogens due to considerable economic losses (Dean et al., 2012). Additionally, we have used in this study F. oxysporum sp. conglutinans. Fusarium oxysporum sp. is composed of over 120 pathogenic strains determined by their primary host plants (Pietro et al., 2003) and causes root rots, damping-off and wilting in more than 100 plants species, including a wide range of economically important horticultural crops, flowers and trees (Dean et al., 2012; Michielse and Rep, 2009). With regard to Pst DC3000, these hemibiotrophic gram-negative bacteria infect both its natural host tomato and Arabidopsis. Genomic analysis shows that Pst DC3000 carries a large repertoire of potential virulence factors, including effectors that are secreted through the type III secretion system. These effectors suppress plant immune responses and promote disease susceptibility (Lo et al., 2017; Mansfield et al., 2012; Xin and He, 2013).
As we show below, HOP3 is involved in plant immunity and is required for an efficient defense response against these mentioned pathogens. We have also demonstrated that HOP3 interacts with COI1 by yeast two-hybrid system and HOP3 seems to be required for an effective JA signaling pathway in Arabidopsis.
5.2 RESULTS
5.2.1 HOP3 is involved in plant defense response against Botrytis cinerea in Arabidopsis
As we have described previously in the general introduction (Chapter 1), a member of the HOP family in rice interacts with CERK1 (Chen et al., 2010). CERK1 recognizes the fungal PAMP chitin, allowing the activation of the immune signal cascade. Therefore, we aimed to study the role of HOP3 in the defense response to B. cinerea, a phytopathogenic fungus, which shows a wide range of host and produces considerable economic losses (Dean et al., 2012).
B. cinerea inoculation assays were performed in leaves from wild-type plants (Col-0) and the hop3-1 mutant. In addition, the transgenic plant expressing the construct HOP3pro-HOP3-HA in the hop3-1 background (Referred as hop3-1 complemented line or 3.3) was included in these assays. After the inoculation, disease symptoms on leaves were monitored for different days. As shown in Figure 5.1A, hop3-1 mutant shows an increament in the size of lesions on leaves compared to Col-0 and line 3.3 in response to B. cinerea at 7 dpi.
With the purpose of quantifying the phenotype observed in the hop3-1 mutant, ion leakage was determined. As shown Figure 5.1B, cell damage is increased in hop3-1 mutant compared to wild-type and the phenotype is recovered in hop3-1 complemented line, similar to wild-type. No differences in ion leakage were detected under control conditions (data not shown). These results demonstrate that the increased cell damage observed on leaves and caused by B. cinerea in the mutant is related to the absence of HOP3 protein. Accordingly, trypan blue staining revealed higher levels of plant cell death in hop3-1 leaves compared to wild-type or line 3.3 (Figure 5.1C).
CHAPTER 5
83
In silico analysis of HOP3 expression indicated that this gene is inducible by elicitors such as FLS22 or NPP1 and by phytopathogens B. cinerea and Pst DC3000 (Arabidopsis Gene Expression Data, eFPBrowser, http://www.bar.utoronto.ca/). To further determine in vivo, whether HOP3 transcription could be induced in response to B. cinerea under our experimental conditions, we analyzed the expression of AtHOP3 by qRT-PCR (see Materials and methods). Our results show that HOP3 transcript is slightly induced in response to B. cinerea at 1 dpi (Figure 5.1D). In addition, we were able to detect a higher accumulation of GUS protein in the transgenic plants expressing the construct HOP3pro-HOP3-GUS at 1 dpi and 2 dpi compared to mock-inoculated plants, confirming that HOP3 is up-regulated in response to B. cinerea (Figure 5.1D).
In order to analyze whether the transcriptional response to B. cinerea infection is impaired in the hop3-1 mutant, we selected two genes whose transcription is induced in the presence of this pathogen: the transcriptional factor ERF1 and one of its target genes PDF1.2 (Berrocal-Lobo et al., 2002). As shown in Figure 5.1E and as expected, infection of Col-0 plants results in an increament of ERF1 and PDF1.2 expression levels, whereas this induction was strongly reduced in the hop3-1 mutant. The level of expression of these two marker genes is rescued when HOP3 levels were complemented, demonstrating that the altered expression of this marker gene in the mutant is specifically related to the absence of HOP3.
In conclusion, all these data demonstrate that HOP3 protein is involved in defense response to B. cinerea.
Figure 5.1. HOP3 participates in the defense response to Botrytis cinerea. (A) Phenotypic analysis of disease symptoms in plants from wt (Col-0), hop3-1 mutant and line 3.3 at 2 and 7 dpi. Disease lesions in leaves are arrowed
CHAPTER 5
84
in white. Scale bar = 1 cm (B) Ion leakage measurement at 2 dpi in the same lines. (C) Cell death symptoms on leaves detected by trypan blue staining. Scale bar = 0.25 cm (D) Histochemical analysis of GUS activity at 1 and 2 dpi in 2 week-old transgenic seedlings expressing the HOP3pro-HOP3-GUS construct. (E) qRT-PCR analysis of AtHOP3, AtPDF1.2 and AtERF1 transcription levels at 1 dpi. The values represent changes in transcript abundance related to mock-inoculated plants. (A, B, C and E) Col-0, hop3-1 and line 3.3 plants of 3 week-old were inoculated with 5 µl of a B. cinerea suspension (5x105 spores mL-1) or mock-inoculated (see Materials and methods). Statistical significant differences (**P< 0.01) using ANOVA test are highlighted by asterisks. Histograms show the mean ± SE of three biological replicates. Each replicate was performed with 4 plants per genotype.
5.2.2 HOP3 is necessary for the effective defense against Fusarium oxysporum in Arabidopsis
F. oxysporum f. sp. conglutinans (Foc) infects Arabidopsis, penetrating through the primary root tip and lateral root emerging points (Czymmek et al., 2007; Di Pietro et al., 2001). Since HOP3 accumulates in Arabidopsis roots, we reasoned that this protein might have a special involvement in plant defense in this tissue. To test this hypothesis, we decided to use for Arabidopsis inoculations the F.oxysporum f. sp. conglutinans strain 699 transformed with the sGFP coding region (Foc 699-GFP). This strain allows monitoring fungal progression by direct visualization of GFP accumulation into vascular tissue (Hou et al., 2014).
CHAPTER 5
85
Figure 5.2. HOP3 is involved in the defense response to Fusarium oxysporum sp. (A) Phenotypic analysis of disease symptoms in (Col-0, hop3-1 mutant and line 3.3 in response to Foc. Scale bar = 1 cm. (B) Percentage of fresh weight loss (FWL) in wild-type, hop3-1 and line 3.3. (C) Trypan blue staining in the same whole plant lines. (D) GFP signal in roots of inoculated plants (E) Fungal biomass (measured as the relative amount of fungal DNA performed by qPCR in Col-0, hop3-1 and 3.3, as described in Materials and methods). Scale bar = 100 μm. (A-E) Plants of 3 week-old inoculated with Foc 699-GFP (106 spores mL-1) at 7 dpi (see Materials and methods). Histograms show the mean ± SE of three biological replicates, each replicate with 4 plants per genotype. Representative results are shown from three independent experiments performed with similar results. Statistical significant differences (**P< 0.01) using ANOVA test are highlighted by
In order to test the possible involvement of HOP3 in the defense against this pathogenic fungus, 3 week-old Arabidopsis Col-0, hop3-1 and the hop3-1 complemented line were grown in a hydroponic system and were subsequently inoculated with a suspension of Foc 699-GFP. Symptoms were analyzed from the 7th to 11th dpi. As shown in Figure 5.2A, hop3-1 mutant display chlorosis in leaves and plant wilting at 7 dpi, whereas these macroscopic disease symptoms were undetectable in wild-type or in line 3.3, demonstrating that hop3-1 shows a higher susceptibility to F. oxysporum infection. These data are in agreement with the higher percentage of fresh weight loss (FWL) in hop3-1 (62%) compared to wt plants (42%) or to line 3.3 (24%) (Figure 5.2B). In addition, trypan blue staining of whole inoculated plants confirmed the presence of more extended cell death in roots and leaves in the hop3-1 mutant, compared to Col-0 and hop3-1 complemented plants (Figure 5.2C).
Since Foc 699-GFP allows monitoring the penetration of the fungus in the roots, we analyzed the fungal progression through the detection of GFP fluorescence signal in the vascular tissue of infected plants. As shown in Figure 5.2D, GFP signal is significantly higher in hop3-1 plants than in Col-0 or in the hop3-1 complemented plants. This observation was further supported by the analysis of fungal biomass by qPCR. Previous work with this strain showed a correlation between fluorescence signal and fungal biomass (Hou et al., 2014), GFP signal from the transgenic Foc 699 was quantified in plant root samples by qPCR (see Materials and methods). As shown in Figure 5.2E, a higher accumulation of fungal DNA is detected in the impaired HOP3 line compared to wild-type plants or line 3.3.
These data demonstrate that HOP3 is involved in the effective response to Foc in Arabidopsis.
5.2.3 HOP3 interacts with COI1
As introduced in Chapter 4, we have previously demonstrated that AtHOP3 interacts in vivo with cytosolic members of HSP70 and HSP90 families. These chaperones were reported to interact with Suppressor of G2 allele of SKP1 B protein (SGT1b), an essential cochaperone of HSP90, and to bind to CORONATINE INSENSITIVE 1 (COI1), an F-box protein with an essential role in JA signaling during the plant defense response (Zhang et al., 2015). Since HOP3, as SGT1b, is proposed to be a cochaperone of the HSP70/HSP90 complex, we wondered whether HOP3 could bind COI1 in yeast two-hybrid assays.
CHAPTER 5
86
As shown In Figure 5.3, yeast cells co-transformed with plasmids that express COI1 (fused to the Gal4-BD) and HOP3 (fused to the Gal4-AD) are able to grow on selective media, while independent co-transformations of the same constructs with vectors expressing the bare Gal4-AD and Gal4-BD, respectively, show impaired growth on the interaction media.
These data demonstrate that HOP3 interacts with COI1 in the two-hybrid assay.
Figure 5.3. HOP3 interacts with COI1 in yeast two-hybrid assays. AtCOI1 fused to the GAL4 DNA-binding domain (Gal4-BD) was co-expressed with HOP3 fused to GAL4 activation domain (Gal4-AD) in the yeast strain AH109. As controls, bare Gal4-AD and Gal4–BD were co-expressed with the different cited constructs. Independent transformants were tested for growth in non-selective medium (-Leu -Trp) or prototrophy-selective medium (-Leu -Trp -His).
5.2.4 HOP3 is involved in plant response to JA
HOP3 interaction with COI1 suggests that HOP3 could be involved in JA signaling. Besides the role of JA in defense response, this phytohormone regulates a broad spectrum of biological processes, including plant growth and development (Creelman and Mullet, 1995; Wasternack and Hause, 2013). Specifically, JA has also been reported to play a crucial role in regulating root growth and development (Ahmad et al., 2016). Methyl jasmonate (MeJA), a JA precursor, inhibits root elongation in a concentration-dependent manner. It has been shown that treatments of seedlings with this chemical are useful to determine the plant capacity to respond to JA in vitro (Feys et al., 1994).
In order to evaluate the sensitivity of the hop3-1 mutant to MeJA and to determine if the activation of this pathway could be impaired in the mutant, the percentage of root length inhibition in the presence of different concentrations of MeJA was analyzed in Col-0, hop3-1, and line 3.3. In addition, jar1-1 mutant (impaired in the JA biosynthetic and JA-signaling pathway) was included as a positive control (Staswick, 1992; Staswick et al., 1998) (Figure 5.4A).
Root lengths were quantitatively measured as the percentage of root length reduction of seedlings grown in MS medium in presence of different concentrations of MeJA, related to control plants (Figure 5.4B). Our results show that hop3-1 seedlings are less sensitive to MeJA, showing a reduced root length inhibition than Col-0; whereas the hop3-1 complemented
CHAPTER 5
87
plants show a restored sensitivity to the chemical, with a similar reduction in root length than wild-type plants.
These data strongly suggest an involvement of HOP3 in JA signaling in Arabidopsis.
Figure 5.4. The hop3-1 mutant shows impaired response to MeJA. (A) Phenotypic analysis of plants from Col-0, hop3-1, hop3-1 complemented line (3.3) and jar1-1 in response to MeJA (0, 2.5, 5 and 10 µM) in vitro. Scale bar = 1 cm (B) Percentage of root length reduction on same lines, quantified using Image J program. Histograms show the mean ± SE of three biological replicates. Statistical significant differences (*P<0.05, **P< 0.01) using ANOVA test are highlighted by asterisks.
5.2.5 HOP3 is involved in plant defense response against Pseudomonas syringae pv tomato DC3000 (Pst DC3000)
As previously demonstrated, HOP3 interacts in vivo with BiP under control conditions and the BiP family has been reported to be involved in SA-mediated induction of PR-1 by NPR1 during plant defense response to Pst DC3000 (Wang et al., 2005). Therefore, in order to extend the characterization of HOP3 function in defense mechanisms, we analyzed the response of hop3-1 mutant to this hemibiotrophic bacteria.
Plants were inoculated with Pst DC3000 and the progress of the infection was monitored for 7 dpi (see Materials and Methods). As shown in Figure 5.5A, hop3-1 mutant shows increased infection symptoms compared to Col-0 plants, whereas line 3.3 results in a reversion of the susceptibility, which confirms the involvement of HOP3 during Pst DC3000-defense response. Representative leaves of the symptoms of each genotype are shown in Figure 5.5B. In order to analyze HOP3-mediated susceptibility to Pst DC3000, 3 week-old plants were inoculated by immersion in a bacterial suspension (0.01 OD600). During the first 2 dpi, bacterial growth was measured as colony forming units (cfu). As shown in Figure 5.5C, Pst DC3000 growth is statistically higher in hop3-1 mutant than in wild-type plants and in hop3-1 complemented line at 1 dpi and 2 dpi.
CHAPTER 5
88
In parallel, cell death in the inoculated leaves was estimated by trypan blue staining and the capacity of hydrogen peroxide production was determined by DAB staining (as described in Materials and Methods). As shown in Figure 5.6D, increased cell death is detected in hop3-1 plants compared to Col-0 or to the hop3-1 complemented plants. In contrast, DAB staining was similar in all leaves tested, discarding H2O2 production deficiencies in the mutant.
Data derived from expression array-experiments indicate a transcriptional upregulation of HOP3 during Pst DC3000 infection (http://bbc.botany.utoronto.ca/efp/cgi-bin/efpWeb.cagi). Therefore, to evaluate whether HOP3 is also transcriptionally regulated under our experimental conditions, we studied its transcriptional response to this bacteria.
As shown in Figure 5.5E, HOP3 transcript is induced by Pst DC3000 at 1 dpi. In order to corroborate the transcriptional activation of HOP3 in the presence of Pst DC3000, transgenic seedlings expressing the HOP3pro-HOP3-GUS construct were inoculated with the bacteria Pst DC3000 and a GUS activity was analyzed. As shown in Figure 5.5F, a higher accumulation of HOP3 protein at 2 dpi is detected in inoculated plants, comparing to mock-inoculated controls.
Additionally, the expression level of a PR-1 gene was analyzed. This gene encodes a protein necessary for an effective SA-mediated defense response to Pst DC3000 (Delaney et al., 1994).
When the expression levels of PR-1 was quantified by qRT-PCR, a statistically significant reduction in the hop3-1 mutant is observed at 1 dpi compared to Col-0 plants. This correlates with the increased susceptibility to Pst DC3000 infection in hop3-1 mutant. Conversely, expression level is reverted in line 3.3 (Figure 5.5E).
These results show that HOP3 is involved in plant defense response against Pst DC3000.
CHAPTER 5
89
Figure 5.5 HOP3 is involved in defense response to Pst DC3000. (A) Phenotypic analysis of disease symptoms in wild-type (Col-0), hop3-1 and line 3.3 from 2 week-old plants at 7 dpi with Pst DC3000 (0.01 OD600). Disease rating is represented as the percent of leaves with symptoms related to 100. The disease is rated as: 0: no infection/necrosis; 1: 1-2 leaves showing necrosis; 2: >3 leaves showing necrosis and 4: dead/decayed plants. (B) Symptoms of infected leaves in the same plants as (A) Scale bar = 0.25 cm. (C) Bacterial growth represented as colony forming units (cfu) in 3 week-old plants from Col-0, hop3-1 and line 3.3 at 1 dpi and 2 dpi with Pst DC3000 by immersion (0.001 OD600). (D) Leave staining with Trypan blue (upper panel) and DAB (lower panel) at 1 dpi in the same plants as (C). Representative leaves are shown in all cases. Scale bar = 0.25 cm and 0.05 cm, respectively. (E) qRT-PCR analysis of AtHOP3 and AtPR-1 in 3 week-old plants from Col-0, hop3-1 and line 3.3 at 1 dpi with Pst DC3000 (0.001 OD600). Expression levels are related to mock-inoculated plants. (F) Histochemical analysis of 2 week-old HOP3pro-HOP3-GUS transgenic seedlings grown in vitro and inoculated with Pst DC3000 (0.01 OD600) at 1 dpi and 2 dpi (right) or mock-inoculated plants (left). Histograms show the mean ± SE of three biological replicates. Each replicate is performed with 4 plants per genotype. Statistical significant differences (*P<0.05) using ANOVA test are highlighted by an asterisk.
CHAPTER 5
90
5.3 DISCUSSION
In our previous study (Chapter 4), we demonstrated that HOP3 is an important regulator of the ER stress response, a process associated with environmental stress response in plants. Additionally, we showed that HOP3 interacts with different members of the cytosolic HSP70 and HSP90 families and with BiP, an HSP70 ER-resident protein, whose role as important regulators of plant immunity have been extensively studied in plants. In this study, we have shown that HOP3 is also necessary for an efficient defense response against important phytopathogens in agriculture, such as B. cinerea and Foc fungi and the phytopathogenic bacteria Pst DC3000 , highlighting the main role of HOP3 in plant immunity against several kinds of biotic stress.
5.3.1 HOP3 is involved in defense response against B. cinerea
The impaired defense response observed in the hop3-1 mutant and the reestablishment of this defense capacity in the hop3-1 complemented line, as well as the increase of HOP3 expression in the presence of the B. cinerea, demonstrate that HOP3 is involved in the plant defense response to this fungus. One of the early stages in the establishment of fungal defense is the recognition of PAMPs, as chitin by receptors (PRRs). These receptors are folded in the ER and are subjected to different steps of maturation and transport (Ben Khaled et al., 2015; Zipfel, 2014). For this reason, HOP interaction with the chitin receptor CERK1 and with HSP90 in rice suggests a HOP involvement in the first steps of fungal recognition, specifically in the maturation and transport of PRRs (Chen et al., 2010). In line with this, we have previously demonstrated that HOP3 is localized in the cytoplasm and the ER under control conditions and that HOP3 interacts with HSP90.1 in Arabidopsis (Fernandez-Bautista et al., 2017). Based on these data, we hypothesized that AtHOP3 could also interact with AtCERK1. In order to test this hypothesis, we conducted co-immunoprecipitation analyses expressing both Arabidopsis proteins in N. benthamiana, however, we have not been able to detect AtHOP3 interaction with AtCERK1 under our experimental conditions (data not shown). Nevertheless, it should be noted that our immunoprecipitation analyses are carried out in stringent conditions that may only allow the detection of direct interactions (as the HOP3 association to HSP90.1, cytosolic HSP70 and BiP). In addition, we cannot discard that this putative AtHOP3-AtCERK1 interaction happens in the presence of the fungus. Finally, in line with the results described in rice, it would also be interesting to analyze whether HOP3 interacts with other chitin receptors as those belonging to the LYK family (Tanaka et al., 2013; Wan et al., 2012). Our results also demonstrate that ERF1 (ethylene response transcription factor 1) and PDF1.2 (ethylene and jasmonate-responsive plant defensin) genes show a lower level of induction in the hop3-1 mutant compared to wild-type plants in the presence of B. cinerea. Taking into account that ERF1 is an upstream component in both JA and ET signaling pathways activating the transcription of PDF1.2 (Berrocal-Lobo et al., 2002; Huang et al., 2016; Lorenzo et al., 2003), our results indicate that a previous step from transcriptional activation of ERF1 is impaired in the mutant. Indeed, the constitutive expression of ERF1 increases Arabidopsis resistance to necrotrophic fungi, such as B. cinerea and Foc (Berrocal-Lobo and Molina, 2004; Berrocal-Lobo et al., 2002).
CHAPTER 5
91
5.3.2 HOP3 is required for resistance to Foc
Under our tested conditions, hop3-1 mutant is also impaired in the defense response to the vascular hemibiotrophic fungus Foc (Czymmek et al., 2007; Di Pietro et al., 2001). In addition, we detected higher levels of the fungus in the roots of hop3-1 mutant compared to wild type plants. Since HOP3 is highly expressed in roots (Chapter 4, Fernandez-Bautista et al., 2017), these data indicate an important role of HOP3, specifically into this tissue. ERF1 plays an important role in the establishment of the transcriptional defense responses both to F. oxysporum and B. cinerea in Arabidopsis (Berrocal-Lobo and Molina, 2004; Kidd et al., 2009; Thatcher et al., 2009). In fact, increased resistance to F. oxysporum is achieved in transgenic plants over-expressing AtERF1 and AtERF2, promoting the downstream induction of defensins and chitinases (Anderson et al., 2004; Berrocal-Lobo et al., 2002; McGrath et al., 2005; Thatcher et al., 2012). Based on these data, it could be interesting to study if the expression of ERF1 and other marker genes, such as JAZ7, recently involved in defense response to Foc (Thatcher et al., 2016) are also impaired into hop3-1 mutant in response to Foc.
5.3.3 HOP3 is involved in JA-mediated defense response and interacts with COI1
Considering the evidences of an impaired JA-mediated defense response in hop3-1 upon B. cinerea and Foc infection, we analyzed the response of hop3-1 mutant to the JA precursor, MeJA (Seo et al., 2001). This study confirms that hop3-1 is less sensitive to MeJA treatments in vitro, whereas complementation of HOP3 levels restores the sensitivity to MeJA. This result indicates that HOP3 is involved in the early stages of the JA perception or transduction pathway. This lower sensibility to MeJA could also explain its reduced induction of the ERF1 and PDF1.2 genes in the presence of B. cinerea and the higher susceptibility of the hop3-1 mutant against both fungi. In line with this putative impaired JA-perception, it could be also plausible that HOP3 could assist the maturation of ethylene receptors such as EIN2 and ETR1, which are both, located at the ER membrane and are upstream of ERF1 in the signaling pathway (Gallie, 2015; Li et al., 2015; Schaller, 2017; Zheng and Zhu, 2016). On the other hand, upstream of the ERF transcription factors in the JA-signaling pathway is the COI1 protein. COI1 forms part of the Skp1/Cullin/F-box (SCF) E3 ubiquitin ligase complex SCFCOI1
that perceives the JA-signal (Sheard et al., 2010; Yan et al., 2009). In response to JA, COI1 acts as a receptor mediating the degradation of the JASMONATE ZIM DOMAIN (JAZ) proteins via the 26S proteasome. JAZ proteins repress JA-responsive transcriptions factors, and therefore, their degradation leads to the activation of these transcription factors, such as MYC2, and JA-responsive genes, such as ERF1 (Fonseca et al., 2009; Katsir et al., 2008; Sheard et al., 2010; Thines et al., 2007). Interestingly, COI1 is a client protein of the SGT1b–HSP70–HSP90 chaperone complex, which plays a key role in JA signaling in Arabidopsis during defense response (Zhang et al., 2010a; Zhang et al., 2015). As cited before, we have shown that HOP3 interacts with HSP70 and HSP90 in vivo. In addition, we have also demonstrated that HOP3 interacts to COI1 in a yeast two-hybrid assay. Since the coordinated activity of HSP70 and HSP90 in the maturation of signaling proteins is usually assisted by different cochaperones (Caplan, 2003), it seems possible that HOP3, in a different step than the cochaperone SGT1b, could assist the maturation of COI1 (Chen et al., 2010). This hypothesis should be further
CHAPTER 5
92
validated through the analysis of HOP3 interaction with COI1 in vivo and the study of the specific role of this complex during the plant defense response.
5.3.4 HOP3 is involved in defense response to Pst DC3000
Our results show that hop3-1 mutant is also compromised in resistance to Pst DC3000. This phenotype is accompanied by a reduced induction of SA-regulated PR-1, demonstrating that PR-1 induction in the presence of Pst DC3000 requires HOP3 activity.
Different studies have reported the involvement of HSP90 proteins in the defense response to P. syringae in Arabidopsis (Bao et al., 2014; Hubert et al., 2003; Young-Su Seo, 2008). In fact, treatments with geldanamycin, a specific inhibitor of HSP90, reduce the protein levels of different Nucleotide-binding domain leucine-rich repeat (NLR) proteins (Baggs et al., 2017; Qi and Innes, 2013), including resistance to P. syringae 2 (RPS2) protein (Takahashi et al., 2003). RPS2 is a disease resistance (R) protein that specifically recognizes the AvrRpt2 type III effector of P. syringae (Kunkel et al., 1993). In addition, it has also been demonstrated that the complex involving HSP90.1, the cochaperone SGT1 and RAR1 is essential for RPS2 activity (Takahashi et al., 2003). Taking into account these evidences and the enhanced susceptibility of the hop3-1 to Pst DC3000, it could be possible that HOP3, by its high affinity to HSP90.1, may directly or indirectly regulate RPS2 protein levels. Furthermore, it has also been demonstrated that NPR1 function depends on BiP2 protein (Wang et al., 2005). Taking into account that HOP3 interacts with BiP2, it might also be plausible that HOP3 might contribute to NPR1 function. These observations could agree with a putative common function of HOP3, HSP90.1 and BiP in response to Pst DC3000.
In summary, the interaction of HOP3 with HSP90, HSP70 and BiP proteins, and the reduced sensibility to MeJA of hop3-1 mutant, suggest an involvement of HOP3 on different steps during the activation of signaling pathways against B. cinera, Foc and Pst DC3000, in a complex network that might affect the stabilization of receptors of hormone-dependent signaling pathways during defense response to pathogens in plants.
A scheme of the different putative roles proposed for HOP3 during plant defense responses is shown below (Figure 5.6).
CHAPTER 5
93
Figure 5.6. Putative model of HOP3 function in plant immunity. (1) Proposed HOP3 role in protein maturation of defense-related proteins in the ER. HOP3 through its interaction with BiP could be involved in the maturation of PRRs (as CERK1), R proteins (as RPS2), ethylene receptors (as EIN2 and ETR1) and NPR1. (2) Based on the data described in rice (Chen et al., 2010), HOP3 may also assist the transport of different PRRs to the plasma membrane. (3) HOP3 interacts with COI1 and this interaction may assist JA signaling and the activation of JA-responsive genes. HOP3 interaction with COI1 could be direct or mediated by the HPS90 and HSP70 complex.
CHAPTER 6
96
6. CHAPTER 6. HOP FAMILY PLAYS A MAJOR ROLE IN
LONG TERM ACQUIRED THERMOTOLERANCE IN ARABIDOPSIS
AFFECTING THE HSR AND PROTEIN QUALITY CONTROL
CHAPTER 6
98
HOP family plays a major role in long-term acquired thermotolerance in Arabidopsis affecting the HSR and protein
quality control
6.1 INTRODUCTION
Plants, as sessile organisms are constantly exposed to a wide spectrum of stress conditions and are forced to adapt to them in order to complete their life cycle. Among the different stress factors, heat is especially severe as it adversely impacts on almost all aspects of plant development, including growth, reproduction and yield (Stone, 2001; Wahid et al., 2007; Wheeler et al., 2000).
One of the most prominent effects of the increase in temperature at the cellular level is the rapid and extensive accumulation of misfolded proteins in the cytoplasm. Incorrect protein folding leads to loss of activity, protein aggregation and extensive cell and tissue damage. These evidences highlight the importance of the acquisition of proper of protein conformations to maintain homeostasis under normal conditions, but especially under heat stress (Chen et al., 2011; Houck et al., 2012). To carry out this major homeostatic task, the cell has evolved an extensive protein quality control (QC) system that involves the function of chaperone- and degradative-complexes that, together, ensure that proteins are folded correctly or are degraded by the proteasome if they persist damaged or denatured (Chen et al., 2011; Houck et al., 2012; Sontag et al., 2014). Among the different chaperones involved in the QC, HSP70 and HSP90 play a major role in folding, stability and turnover of proteins under heat stress in the cytoplasm. The activity of these chaperones is modulated by their binding to different cochaperones, which modulate different aspects of chaperone function as substrate selection, ATPase activity or their capacity to form multiprotein complexes (Li et al., 2012; Mayer and Bukau, 2005; Prodromou, 2012). Although, in mammals the role of some of these cochaperones in the folding and degradation of specific substrates, as it is the case of the glucocorticoid receptor (review in (Pratt, 1993)), has been deeply studied, the knowledge of their impact on the maintenance of protein homeostasis during stress conditions is very scarce in plants.
In addition to the QC system, cells have also evolved a mechanism that promotes the transcriptional induction of genes involved in QC and protein homeostasis under heat stress. This highly conserved mechanism is called the heat stress response (HSR) and is exerted by the tight activation of heat shock transcription factors (Hsfs) (Akerfelt et al., 2010; Chen et al., 2011). Specifically, Arabidopsis thaliana has 21 Hsfs assigned to three classes (A, B and C) that are further divided into 14 subgroups (Nover et al., 2001; Scharf et al., 2012). Among them, the different members of the HsfA1 family (Hsf1A/B/E/D) redundantly function as primary master regulators of the HSR (Liu et al., 2011; Yoshida et al., 2011). This function is exerted in tomato by a single protein, the HsfA1 (Mishra et al., 2002), highlighting the complexity of the HSR in plants. When plants are exposed to heat stress, HsfA1 induces the transcriptional activation of the HsfA2 and HsfB1, whose interplay with the HsfA1 is central for the activation, maintenance and attenuation of the HSR.
Besides the importance of HSP70 and HSP90 in protein folding, a major role of these two chaperones in the regulation of the DNA binding activity and stability of HsfA1, HsfB1 and
CHAPTER 6
99
HsfA2 during the HSR has been recently uncovered in tomato (Hahn et al., 2011). Nevertheless, the information about the possible cochaperones that may assist these major chaperones in the regulation of gene expression is very limited. Only a few of them, as it is the case of the HSP90 cochaperones AtROF1 and AtROF2, have been associated with the regulation of the HsfA2 target genes and play a main role in acquisition of long-term thermotolerance (LAT) in plants (Aviezer-Hagai et al., 2007; Meiri et al., 2010).
HOPs (HSP70-HSP90 organizing proteins) belong to the highly conserved TPR family of cochaperones. HOP proteins are defined by the presence of three TPR domains (called TPR1, TPR2A and TPR2B) that mediate the interaction with the molecular chaperones HSP70 and HSP90 (Blatch and Lassle, 1999). For years, the function of HOP was generally linked to the activity in protein folding of these two major cochaperones. However, HOP has also been described as part of a small number of HSP90-independent complexes (Daniel et al., 2008; Odunuga et al., 2004).
HOP homologues have been described in different eukaryotes (Blatch et al., 1997; Demand et al., 1998; Honore et al., 1992; Nicolet and Craig, 1989; Song et al., 2009b) including diverse plant species (Chen et al., 2010; Fellerer et al., 2011; Xu et al., 2014; Zhang et al., 2003) and in some cases their role in different physiological processes has been reported. In mammals, HOP shows a protective effect against the progression of prion and neurodegenerative diseases (Lopes et al., 2005; Zanata et al., 2002). HOP has also been recently involved in blast fungus immunity in rice, promoting the efficient transport of CERK1 to the plasma membrane (Chen et al., 2010). In addition, HOP has been proposed as a cell-intrinsic virus restriction factor of the mitochondrial Carnation Italian ringspot tombusvirus (CIRV) in N. benthamiana (Xu et al., 2014). We have demonstrated that HOP3, one member of the HOP family in Arabidopsis, has an essential role during the ER stress in plants (Fernandez-Bautista et al., 2017). Despite the emerging function of HOP in plant defense against pathogens and as a novel ER stress regulator (as described in chapter 4 and 5), the possible role of HOP3 or of the other members of the family in response to abiotic stresses, and specifically to heat stress, remains largely unknown in plants.
In addition, the knowledge of the molecular role of HOP in thermotolerance is also extremely scarce in other eukaryotes. It was previously reported that a hop mutant in C. elegans shows a significant reduction of brood size and a slight reduction of worm´s survival under extreme heat conditions (Song et al., 2009b). In addition, S. cerevisae cells carrying a disruption in STI1 (the HOP homologue in yeast) showed an increase in doubling time at 37ºC. Despite these observations, the mechanisms involved in these phenotypes were not further evaluated. Moreover, it has to be taken into account that the CeHOP protein lacks the TPR1 domain that is highly conserved in plants and play a major role in HOP function in mammals and yeast (Scheufler et al., 2000; Van Der Spuy et al., 2000). For this reason, any possible assumption of a role of HOP in response to heat stress in plants, based on the data in C. elegans, is purely speculative. These facts, along with (1) the observation that S. cerevisae and C. elegans have only one member of the HOP family while there are three genes in Arabidopsis and (2) the lack of any information about the role of AtHOPs in thermotolerance in plants, make especially novel the study and dissection of the mechanisms regulated by HOP during the response to heat in Arabidopsis.
In this chapter, we have studied the role of the three members of the Arabidopsis HOP family in the plant response to heat. We have demonstrated that, although HOP3 is highly induced at
CHAPTER 6
100
high temperatures at the mRNA and protein level, the LAT response is successfully established in the only absence of HOP3. In contrast to the lack of a LAT related phenotype in the hop3-1 mutant, a hypersensitivity phenotype is observed when the hop1 hop2 hop3 triple mutant is assayed, suggesting a functional redundancy of the different HOP members, and, demonstrating the essential role of HOPs in LAT in plants. In vivo immunoprecipitation analysis demonstrates that HOP3 interacts with different proteins under heat stress conditions. In addition, these assays show that AtHOPs interact very tightly with HSP90, a chaperone with a main role during the heat stress response. Interestingly, subcellular localization analyses demonstrate that part of the bulk of the HOP proteins shuttle from the cytoplasm to the nuclei during the challenge, opening the possibility for HOPs to assist HSR regulation in plants. In this sense, transcriptome comparisons by RNAseq show a clear misregulation of different subsets of genes in the mutant plants that includes an upregulation of specific Hsf1s and HsfA2 target genes during the challenge. These data, along with HOP ability to form a complex with HsfA1a, indicate that HOPs participate in the attenuation of the HSR during heat stress. Finally, an unusually high accumulation of insoluble and ubiquitinated proteins is observed in the hop1 hop2 hop3 triple mutant at high temperatures, suggesting a main role of HOPs in the cytosolic protein QC under this stress. These data reveal that HOP family plays a main role in two different aspects of the response to heat, the maintenance of protein homeostasis and the regulation of the HSR, affecting the plant capacity to acclimate to heat stress for long periods.
6.2 RESULTS
6.2.1 The members of the AtHOP family show different induction under heat
In order to elucidate the role of the different members of the HOP family during the plant response to heat, we studied their expression in 7 day-old Col-0 seedlings grown under control conditions or subjected to a heat stress of 38° C for 3 h. As shown in Figure 6.1A, qPCR analysis using specific primers to monitor the individual expression of HOP1, HOP2 and HOP3 demonstrates that these genes show a different induction pattern under the heat challenge: HOP1 is not significantly induced, HOP2 is modestly upregulated (approximately 6 fold) while HOP3 is highly upregulated by heat.
These data demonstrate that HOP3 is highly induced at the mRNA level at high temperatures. These results are in agreement with previous genome-wide analysis from our laboratory showing that HOP3 mRNA was highly induced in Arabidopsis seedlings under heat stress (Yanguez et al., 2013).
6.2.2 AtHOP3 is highly regulated by heat and during the early events leading to recovery
Since the high accumulation of AtHOP3 suggested that it could have a prominent role during the plant response to high temperatures, we decided to study in more detail HOP3 regulation during the heat challenge and the recovery from the stress. After the sharp heat-induced upregulation of HOP3 (black bars, Figure 6.1B), HOP3 levels rapidly decrease within the first hour of recovery at 22°C, suggesting that this messenger could be quite unstable.
CHAPTER 6
101
A previous report suggested that the 5'-3' exonuclease XRN4 plays an essential role in mRNA degradation at high temperatures (Merret et al., 2013). Thus, to test whether XRN4 could be also involved in HOP3 mRNA degradation during the attenuation phase, we carried out qPCR analysis of HOP3 expression in the xrn4-5 mutant following the same heat regime described before. As shown in Figure 6.1B, the reduction of HOP3 expression during recovery (grey bars) seems to be attenuated in the xrn4-5 mutant (black bars), demonstrating that XRN4 is involved in HOP3 mRNA degradation during the recovery from the challenge.
Figure 6.1. AtHOP3 is the most heat-induced member of the Arabidopsis HOP family. (A) Analysis of the expression of the different members of the HOP family in Arabidopsis. 7 day-old Col-0 seedlings were continuously grown at 22°C or heat stressed at 38°C for the last 3 h. The subsequent qRT-PCR was carried out using specific primers to amplify each of the HOP members in Arabidopsis selectively. Fold change values are related to the expression of each gene under control conditions. (B) Analysis of HOP3 expression by qRT-PCR in Col-0 (light bars) and in the xrn4-5 mutant (black bars). 7 day-old seedlings from each genotype were grown at 22°C (C), heat stressed at 38°C for 3 h (H), or left them to recover at 22°C for 1 hour after the 38°C heat stress challenge (R). Fold change values are related to AtHOP3 expression at 22°C conditions. (C) A representative picture of the analysis of GUS activity in 14 day-old HOP3pro-HOP3-GUS seedlings. In this case, the seedlings were subjected to a heat treatment of 38ºC for 2 h (H) or left to recover for 1 h after the challenge (R). For (A) and (C), values from the analysis of three biological replicates are shown as means + SEM.
Finally, in order to analyse if this transcriptional regulation correlates with HOP3 protein levels, we carried out GUS assays in transgenic Arabidopsis plants expressing the HOP3-GUS fusion protein under the control of the HOP3 promoter (HOP3pro-HOP3-GUS) (Yanguez et al., 2013). In these plants, GUS transcription mimics the expression pattern of the endogenous HOP3 (Supplementary Figure 6.1), suggesting that this construct contains all the regulatory elements that allow the heat induced transcriptional upregulation and its mRNA degradation during attenuation. In these plants, the analysis of GUS activity clearly demonstrated that HOP3 protein is highly accumulated under heat and that this accumulation decreases during the attenuation period (Figure 6.1C). All these data suggest that HOP3 accumulation is mainly dependent on the HOP3 mRNA levels, which are regulated by a high transcription during the heat challenge and a rapid XRN4-dependent degradation during the early events of recovery from the stress.
CHAPTER 6
102
6.2.3 Despite its fine regulation, HOP3 alone does not seem to be essential for the establishment of long-term acquired thermotolerance in Arabidopsis
Since this fine regulation favoured the possibility that HOP3 could have a main role during heat response, we carried out different thermotolerance assays using the hop3-1 mutant, which was characterized in a previous study (Fernandez-Bautista et al., 2017). As expected, no HOP3 expression is detected under normal or heat stress conditions in the hop3-1 mutant (Supplementary Figure 6.2), demonstrating that, even under heat (stress that courses with a high accumulation of HOP3), this mutant is null or highly hypomorphic.
Figure 6.2. AtHOP3 alone does not seem essential for long term thermotolerance acquisition in Arabidopsis. Col-0, hop3-1 and hsfa2 seedlings were either grown at control conditions (upper panel) or subjected to a LAT assay following the heat regimes are chematically shown on the left of each row. Seedlings in the same horizontal file were grown on the same plate. Photographs were taken 7 days after the 45°C heat treatment or after 12 days for those grown at control conditions.
As detailed in the introduction, the function of other TPR genes as ROF1 and ROF2 in thermotolerance was previously evaluated in Arabidopsis (Aviezer-Hagai et al., 2007; Meiri et al., 2010). Both rof1 and rof2 single mutants showed only a marked heat-related phenotype after a period of long-term acclimation. Therefore, as a first step, we focused on the evaluation of long-term acquired thermotolerance (LAT) in our phenotypic assays. For this purpose 3 day-old seedlings were acclimated for 3 h at 38°C, left to recover for 2 days at 22°C and challenged with a severe heat challenge at 45°C for 90 and 100 minutes (Figure 6.2, scheme shown on the left). In contrast to the hypersensitive phenotype of the hsfa2 mutant (Figure 6.2, right panel), hop3-1 mutant does not show any obvious LAT phenotype (Figure 6.2, middle panel). All these data demonstrate that although HOP3 expression is highly regulated by heat, this protein alone is not essential for the proper acquisition of LAT under the assayed conditions.
CHAPTER 6
103
6.2.4 The three members of the HOP family act redundantly during the acquisition of long-term thermotolerance in Arabidopsis
Although HOP3 is highly induced by heat, HOP1 and HOP2 are also expressed during the heat challenge. Therefore, to further analyse the possible role of HOP1 and HOP2 in plant thermotolerance, we searched for T-DNA insertions in the HOP1 and HOP2 genes. The lines GK-420A10.15 (hop1-1) and GK-399G03.03 (hop2-1) were selected for further analysis. These lines contain a single T-DNA insertion located in the fourth and the first exons of HOP1 and HOP2, respectively (Figure 6.3A). Both lines show reduced levels of HOP1 and HOP2 genes, respectively, under control and heat stress conditions when compared to their corresponding wild-type plants (Figure 6.3B and 6.3C), revealing that these mutants are null or highly hypomorphic. Neither of these mutants displays any obvious morphological or developmental abnormality under control conditions at the seedling stage and only, a subtle delay in growth is observed in the hop1-1 mutant during the heat stress (Supplementary Figure 6.3). Despite this observation, as in the case of hop3-1 mutant, neither hop1 nor hop2 single mutants show a strong phenotype when the plants are challenged with the LAT regime described before (Supplementary Figure 6.3).
Figure 6.3. Characterization of hop1-1 and hop2-1 mutants. (A) Schematic genomic organization of AtHOP1 and AtHOP2. Exons and the position of the T-DNA insertions are indicated as rectangles and triangles, respectively. (B-C) qRT-PCR analysis of AtHOP1 (B) and AtHOP2 (C) expression levels in their corresponding mutant compared to Col-0. For each genotype 7 day-old seedlings were grown continuously under control conditions (22°C) or heat stress at 38°C for 3 h. Values from the analysis of three biological replicates are shown as means + SEM. These values are related to the expression level of each gene at 22°C in Col-0. The grey arrows in (A) mark the position of the primers used for the expression analyses in (B) and (C).
CHAPTER 6
104
In order to analyze if the different members of the AtHOP family could have a redundant role during the heat response that precludes the observation of a strong phenotype of their single mutants, we generated hop1 hop3 and hop2 hop3 double mutants and, finally, the hop1 hop2 hop3 triple mutant that, as expected, does not show any significant HOP expression by RT-qPCR (Supplementary Figure 6.4). Interestingly and in contrast to the absence of a clear heat related phenotype of the single mutants, the hop1 hop3 and hop2 hop3 double mutants show a subtle LAT phenotype with a reduction of seedling growth after the severe heat challenge (Supplementary Figure 6.5). This hypersensitivity to the LAT treatment is highly enhanced in the hop1 hop2 hop3 triple mutant (Figure 6.4). In this case, during the recovery from the second heat stress, the mutant plants remain smaller, paler and show a reduced development of true leaves, a phenotype similar to the hsfa2 mutant, a well-known regulator of the LAT response in plants (Charng et al., 2007).
All these data demonstrate that HOP is essential for the proper establishment of LAT in Arabidopsis and that the different members of the HOP family act redundantly in the full establishment of this response.
Figure 6.4. hop1 hop2 hop3 triple mutant shows a marked phenotype under different LAT conditions. Seedlings from Col-0 and from the hop1 hop2 hop3 triple mutant were either grown at control conditions (upper panel) or subjected to a LAT assay following the heat regimes are schematically shown on the left of each row. Seedlings in the same horizontal file were grown on the same plate. Photographs were taken 7 days after the 45°C heat treatment or after 12 days for those grown at control conditions.
CHAPTER 6
105
6.2.5 HOP forms complexes with different proteins under heat stress conditions
HOP has been traditionally considered as a scaffolding protein able to mediate the formation of functional multiprotein complexes in other organisms (Odunuga et al., 2004; Scheufler et al., 2000). So, in order to elucidate the possible role of AtHOPs in thermotolerance, we decided to identify the proteins that specifically interact with HOP during the stress response. For these assays, we carried out HOP3-HA immunoprecipitations using the HOP3pro-HOP3-HA transgenic line described before chapter 4. In addition, Col-0 background plants were assayed as a negative control. In both cases, prior to the immunoprecipitation, the seedlings were heat stressed at 38°C for 3 h. In each case, a small portion of the immunoprecipitation was run on a gel that was further silver-stained. As shown in Supplementary Figure 6.6, a clear differential band that migrates at ~ 75 kDa (left panel) is observed in the eluate from HOP3 expressing plants. This band corresponds to HOP3-HA, as demonstrated by anti-HA western-blot analysis (right panel). Along with HOP3, different bands in these immunoprecipitations could also be specifically detected. Two biological replicas of the above-described experiments were analysed by LC-ESI-MS/MS and the corresponding peptides were subjected to a MASCOT search in an Arabidopsis protein database. After discarding the proteins present in the immunoprecipitation from wild-type plants, the proteins specifically immunoprecipitated along with HOP3-HA in the two replicas were considered HOP interactors. These interactors include different members of the cytosolic HSP90 family, actin, different subunits of the ribulose biphosphate-carboxylase activase (RCA) and, with a lower score a subunit of the chaperonin-containing TCP-1 (CCT) (Table 1).
Based on the results shown in Table 1, HSP90 seems the main HOP3 interactor under the heat challenge. Since the interaction between HOP1 and HOP2 with HSP90 was not previously addressed, we carried out co-immunoprecipitation analysis from N. benthamina leaves expressing AtHSP90.1 and tagged versions of AtHOP1, AtHOP2 and AtHOP3. As shown in Supplementary Figure 6.7, the different members of the AtHOP family specifically co-immunoprecipitate with HSP90.1, demonstrating that the interaction with HSP90 is also conserved for HOP1 and HOP2.
6.2.6 HOPs change their subcellular localization under heat stress
Previous analyses in other eukaryotes suggested that HOP proteins are mainly located in the cytoplasm under control conditions; however, changes in subcellular localization were also documented during cell cycle progression and under stress in mammalian cells (Daniel et al., 2008; Pare et al., 2009). Thus, in an attempt to determine the subcellular location of Arabidopsis HOPs and to study whether their localization could change during the course of the heat stress, we took advantage of the HOP3pro-HOP3-GFP transgenic lines. GFP analyses on these plants clearly demonstrate that HOP3 shows a diffuse cytoplasmic localization under control conditions, but this localization abruptly changes when seedlings are exposed to 38°C for 3 h. During this treatment, part of the signal from HOP3-GFP can be observed at nuclei and at discrete cytoplasmic foci (Figure 6.5). Although we could not generate transgenic plants expressing HOP2pro-HOP2-GFP, precluding the analysis of HOP2 localization, the analysis of GFP localization in the transgenic lines HOP1pro-HOP1-GFP also demonstrates that part of the
CHAPTER 6
106
bulk of HOP1 also shuttles from the cytoplasm to nuclei and to cytoplasmic foci under heat stress (Supplementary Figure 6.8, the two first panels on the left).
Figure 6.5. Analysis of AtHOP3 subcellular localization under control conditions and during the heat challenge. Subcellular localization of AtHOP3-GFP in the root tip of 7 day-old HOP3pro-HOP3-GFP seedlings grown continuously at 22°C or heat stress at 38°C for the last 3 h. Bars = 40 µm.
The formation under heat stress of different cytoplasmic foci as P-bodies, stress granules (SGs) and heat stress granules (HSGs) is well-documented in plants (Weber et al., 2008). Although to our knowledge, HOP has not been described associated with any cytoplasmic foci during heat stress, mammalian HOP has been associated to SGs induced by the translational inhibitor hippuristanol (Pare et al., 2009).
Therefore, we decided to test whether Arabidopsis HOPs were also associated with these structures under heat stress by co-localization analyses using a SG marker. For these assays, N. benthamiana leaves were co-agroinfiltrated with the constructs 35Spro-(HOP1, HOP2 or HOP3)-GFP and 35Spro-Cherry-UBP. As shown in Figure 6.6, we can detect, as in the case of Arabidopsis, a clear GFP signal corresponding to the accumulation of AtHOP1, AtHOP2 and AtHOP3 in cytoplasmic foci formed under heat stress conditions. These cytoplasmic foci co-localize with Cherry-UBP1, a well-characterized SG marker (Weber et al., 2008), indicating that AtHOPs are recruited to SGs under heat.
Interestingly, a study of the space and temporal localization of HOP3 in the HOP3pro-HOP3-GFP transgenic lines demonstrates that HOP3 localization to nuclei and UBP1 containing foci is reverted during recovery, since only a diffuse cytoplasmic GFP signal from the HOP3-GFP fusion is observed 3 h after the completion of the challenge (Figure 6.7). This heat-dependent change in localization, although quicker, can also be observed for HOP1 (Supplementary Figure 6.8, the two last panels on the right).
CHAPTER 6
107
Figure 6.6. AtHOPs colocalize with UBP1 in cytoplasmic foci during the heat challenge. Co-localization experiments of GFP-AtHOP1 (upper panel), GFP-AtHOP2 (middle panel) or GFP-AtHOP3 (lower panel) with Cherry-AtUBP1 by transient co-expression of the cited proteins in N. benthamiana leaves after a heat treatment at 38°C for 2 h. Bars = 20 µm.
Figure 6.7. Analysis of AtHOP3 subcellular localization during the heat challenge and the recovery period from the stress. Localization of AtHOP3-GFP in the root tip of 7 day-old HOP3pro-HOP3-GFP seedlings grown continuously at 22°C, heat stressed at 38°C for the last 3 h (0 min) or left to recover from the heat stress for different time-points (20 min-110 min). Bars= 40 µm.
CHAPTER 6
108
All these data demonstrate that part of the bulk of HOP1 and HOP3 shuttles from the cytoplasm to the nuclei and to UBP1-containing foci during the heat challenge and that this localization is reverted to the cytoplasm during recovery.
6.2.7 HOPs have a main role in the proper establishment of the transcriptional response to heat in Arabidopsis
The data described before open the possibility that AtHOPs could have a role in the nuclei during the heat stress. In this sense, despite mammalian HOP was described to localize at nuclei in response to different stresses (Daniel et al., 2008), it has remained largely unknown whether this change in localization is associated to specific changes in gene expression.
So, in order to shed light on this specific question and to evaluate the possible role of AtHOPs in the transcriptional response to heat, we performed RNA-seq analysis of wild-type (Col-0) and hop1 hop2 hop3 triple mutant seedlings (hop-tm) that were allowed to grow for 7 days under control conditions (CC) or that were challenged at 38°C for the last 3 h (HS). Three independent biological replicates were generated and analysed, leading to the identification of genes with altered expression under the tested conditions (fold change ≥ 2; padj ≤ 0.01 for the upregulated genes; fold change ≤ 0.5; padj ≤ 0.01 in the case of the downregulated genes). As shown in Figure 6.8A, this specific heat challenge promotes the significant induction of 3971 and 4015 genes, and the repression of 4662 and 4579 in Col-0 and in the hop1 hop2 hop3 triple mutant, respectively.
Figure 6.8. The Arabidopsis hop1 hop2 hop3 triple mutant shows a clear misregulation of gene expression under control conditions and in response to heat. (A) Representative scheme displaying the total number of genes either upregulated (red) or downregulated (blue) in 7 day-old seedlings from Col-0 or from the hop1 hop2 hop3 triple mutant (hop-tm) either grown continuously at 22 °C (CC) or heat stressed at 38 °C for the last 3 h (HS). The total number of altered genes identified for each transition is shown inside the arrow. (B) Venn diagrams showing the number of overlapping and unique genes that are significantly changed in response to heat in both genotypes.
CHAPTER 6
109
A common set of 7410 genes showed similar changes upon the heat challenge in both genotypes, being approximately 50% of them (3518 and 3892) coordinately upregulated and downregulated, respectively in both genotypes (Figure 6.8B); however 1184 genes display a different pattern of expression in the hop1 hop2 hop3 triple mutant under these heat stress conditions (497 and 687 specifically upregulated and downregulated, respectively).
To further explore to what extent the absence of AtHOPs could specifically disturb the proper establishment of gene expression during the stress, we selected those genes that were upregulated by our heat treatment in control plants (fold change expression HS/CC ≥ 2; padj ≤ 0 .01 in Col-0) and analysed whether the expression of these genes was significantly altered in the hop1 hop2 hop3 triple mutant under the heat stress. This analysis allowed the identification of 45 genes (Table 2) and 29 genes (Supplementary Table 2) that were specifically upregulated and downregulated, respectively in the hop1 hop2 hop3 triple mutant compared to the control plants (fold change expression in hop-tm/Col-0 ≥ 2 or ≤ 0.5, respectively; padj ≤ 0.01 under HS). In the same way, we could also observe, among the genes downregulated by our heat treatment (fold change expression HS/CC ≤ 0.5; padj ≤ 0.01 in Col-0), a clear misexpresion under the stress of 56 genes in the hop1 hop2 hop3 triple mutant (fold change expression in hop-tm/Col-0 ≥ 2 or ≤ 0.5, padj ≤ 0.01 under HS) (Supplementary Table 3).
Altogether, this analysis demonstrates that AtHOPs are required for the tight expression of a subset of genes (more than 100) during the heat stress treatment.
6.2.8 The absence of AtHOPs leads to misregulation of some Hsf1A/B/D/E and HsfA2-dependent genes during the heat challenge
Recent evidence in tomato suggests that HSP70 and HSP90 chaperones regulate the HSR through a network of specific interactions with HsfA1, HsfA2 and HsfB1. These interactions modulate the function of these Hsfs by a fine control of their DNA binding activity and abundance (Hahn et al., 2011).
Since our results clearly demonstrate that plant HOPs (1) bind with high affinity to HSP90, (2) localize to nuclei in response to heat and (3) participate in the proper establishment of the transcriptional response to heat in plants, we wondered whether HOP may also participate in the regulation of the HSR and the activity of the Hsfs.
In order to investigate this possibility, we compared the genes with an altered expression (at least two-fold) in the hop1 hop2 hop3 triple mutant under heat stress with those genes already described as Hsf1A/B/D/E- and HsfA2- responsive genes (Liu and Charng, 2013; Nishizawa et al., 2006; Schramm et al., 2006). This analysis clearly shows that 8 out the 45 genes specifically upregulated in the hop1 hop2 hop3 triple mutant by the heat treatment are Hsf1A/B/D/E- and HsfA2- responsive genes (genes highlighted in grey, Table 2). These genes among others include LTI65 and COR15A. The number of genes regulated by Hsf1A/B/D/E and HsfA2 highly increases (to 43 genes) when we analyse the distribution throughout all the genes with a statistically significant change in the hop1 hop2 hop3 triple mutant compared to Col-0 (hop-tm/Col-0 padj ≤ 0.01 under HS) (Figure6. 9), being the majority of them (31) upregulated in the hop1 hop2 hop3 triple mutant.
CHAPTER 6
110
These results demonstrate that a proportion of the HsfA1A/B/D/E- and HsfA2- dependent genes are slightly but significantly upregulated by the applied heat treatment in the hop1 hop2 hop3 triple mutant.
Figure 6.9. Identification of genes regulated by Hsf1A/B/D/E and HsfA2 that change significantly in the hop1 hop2 hop3 triple mutant compared to its wt (Col-0) counterpart during heat stress conditions. All the included genes were previously identified as downregulated genes in the hsf1a hsf1b hsf1d hsf1e mutant and hsf2a mutants [42-44]. The expression change in hop1 hop2 hop3 triple mutant (hop-tm) compared to Col-0 is coloured coded according to the scale shown on the right.
6.2.9 AtHOP3 forms a complex with Hsf1A under heat stress conditions
The results described before suggest that AtHOPs could be involved in modulating the activity of the Hsf1s and HsfA2 in plants, and so, in order to evaluate how HOP could modulate this activity, we decided to analyse whether AtHOPs could interact with these Hsfs in vivo. With this purpose, we agroinfiltrated N. benthamina leaves with the constructs p35S-Flag-HOP3 and p35S-HA-HsfA1a.
These leaves were heat stressed at 38ºC for 2 h and subsequently used for HOP3 immunoprecipitations using anti-Flag agarose beads. As shown in Figure 6.10, AtHsfA1a specifically co-immunoprecipitates with AtHOP3. Interestingly, when the same membrane is
CHAPTER 6
111
incubated with an antibody that allows the detection of N. benthamina HSP90, this latter protein is also specifically detected in the immunoprecipitations.
These results support that HOP3 is part of complexes containing HSP90 and HsfA1a.
Figure 6.10. HsfA1 forms part of an in vivo complex with HOP3 and HSP90. N. benthamiana leaves transiently expressing different combinations of Flag-HOP3 and HA-Hsf1A under the control of the 35S promoter were subjected to a heat stress treatment for 2 h at 38°C. Protein extracts from the different combinations were extracted and equal amounts of protein from each one (crude extracts) were immunoprecipitated with anti-Flag agarose beads. Equal amounts in volume of the eluted fractions (Ip:α-Flag), which were eluted with the Flag peptide, were run in SDS-PAGE and subjected to Western blot using anti-Flag, anti-HA and anti-HSP90.1 antibodies .
6.2.10 AtHOPs also participate in the tight control of transcription under control conditions
In addition to the response to the heat treatment, the RNAseq analysis also shows that there is a significant misregulation of 88 genes under control conditions, 34 specifically upregulated (Table 3) and 54 specifically downregulated (Supplementary Table 4) in the hop1 hop2 hop3 triple mutant compared to its wt counterpart (fold change expression in hop-tm/Col-0 ≥ 2 or ≤ 0.5, padj ≤ 0.01 under CC). Although no GO enrichment can be observed for the downregulated genes, gene ontology (GO) analysis using the Agrigo tool (Du et al., 2010) demonstrates that among the upregulated genes there is a high enrichment in terms related to seed development and reproductive process (Supplementary Figure 6.9). It is also noteworthy that among the 34 specifically up-regulated genes under control conditions, 16 genes were identified as heat responsive in Col-0 (fold change expression HS/CC ≥ 2; padj ≤ 0 .01 in Col-0) (genes highlighted in grey, Table 3), suggesting that in the absence of HOP activity, part of the transcriptional response to heat is activated under control conditions.
6.2.11 hop1 hop2 hop3 phenotype is also associated with a QC failure
Apart from the role of HSP90 in the regulation of the HSR, HSP90 also plays a critical role in protein QC during different physiological situations and especially during the abrupt accumulation of misfolded proteins caused by heat (Chen et al., 2011; Houck et al., 2012; Sontag et al., 2014). This QC involves the recognition of misfolded proteins, protein re-folding and, in the case of failure to achieve the proper conformation, ubiquitination and further protein degradation (Houck et al., 2012). Based on these data and on the strong interaction
CHAPTER 6
112
between the different members of the Arabidopsis HOP family and HSP90, we wondered whether HOPs could also participate in assisting protein QC under heat stress.
QC failure leads to a high accumulation of misfolded proteins that, if protein degradation is overwhelmed, could be observed by a strong accumulation of insoluble-ubiquitinated proteins. So, to test the possible involvement of HOP in protein QC, we compared the accumulation of these insoluble protein species in 7 day-old seedlings from Col-0 and from the hop1 hop2 hop3 triple mutant grown under control conditions or challenged at 45°C for different time points.
As shown in Figure 6.11, these heat treatments promote the accumulation of insoluble proteins in both genotypes (upper panel). This accumulation is even clearer when the insoluble fractions are subjected to a western-blot using an anti-ubiquitin antibody (lower panel). However, although this accumulation is perceptible in both genotypes, it is clearly higher in the hop1 hop2 hop3 triple mutant compared to the wild-type plants.
Figure 6.11. The hop1 hop2 hop3 triple mutant accumulates a larger proportion of ubiquitinated-insoluble proteins upon heat challenge. Coomassie staining of insoluble proteins from extracts of 7 day-old seedlings from Col-0 and from the hop1 hop2 hop3 triple mutant grown at control conditions or subjected to a heat challenge at 45°C for the last 1-3 h (upper panel). Western-blot analysis of the same fractions shown above, but run on an independent gel, using the anti-ubiquitin antibody (lower panel).
These data demonstrate that, in the absence of AtHOPs, heat leads to a higher accumulation of insoluble-ubiquitinated proteins under the heat challenge, revealing a failure in QC in the hop1 hop2 hop3 mutant.
CHAPTER 6
113
6.3 DISCUSSION
6.3.1 HOP3 is highly induced by heat, but HOP1 and HOP2 act redundantly with HOP3 during LAT
HOP3 is the only member of the Arabidopsis HOP family highly induced by heat, however, as stated before, hop3-1 single mutant does not show a clear phenotype under the assayed heat stress conditions. Nevertheless, the hop1 hop3 and hop2 hop3 double mutants show a subtle decrease in LAT, which is clearly marked in the hop1 hop2 hop3 triple mutant, demonstrating a clear genetic redundancy among the HOP family members. Why is HOP3 specifically highly induced by heat if the other HOP constitutive members can also exert its function under this stress? Heat response is a complex trait that depends on different aspects as heat intensity and duration, the rate of increase in temperature or the plant developmental and acclimation stage among others (Echevarria-Zomeno et al., 2015). Therefore, we cannot discard that HOP3 induction could be essential in the course of a different heat stress treatment from the ones assayed. In addition, since HOP3 plays an important role in the alleviation of ER stress in Arabidopsis as demonstrated in Chapter 4 , it could also be possible that the induction of HOP3 under heat could be a mechanism to facilitate the correct folding of the denatured proteins in the ER during the heat challenge.
6.3.2 AtHOPs interact very tightly with HSP90 under heat stress conditions
We have previously described that HOP3 interacts with cytosolic HSP90 and HSP70, demonstrating that indeed this protein is, as expected, a plant HSP70-HSP90 organizing protein (Fernandez-Bautista et al., 2017). In this chapter, we have demonstrated that HOP3 interacts tightly with HSP90 during the applied heat challenge. The fact that HSP70 was not identified in our proteomic data does not involve the absence of HSP70-HOP3 association under heat; indeed, peptides from HSP70 were specifically spotted in one of the replicates. In contrast, this observation probably reflects the high stringency of the assay in which only proteins that bind to HOP3 with a high affinity have been systematically identified in both replicas. These data are consistent with the higher affinity of HOP for HSP90 than for HSP70 in mammals (Hernandez et al., 2002) and in plants (Fernandez-Bautista et al., 2017).
Apart from HOP3, the interactions between HOP1 and HOP2 with HSP90.1 were further confirmed by co-immunoprecipitation analyses in plants, demonstrating the interaction of all the members of the AtHOP family with HSP90 in vivo (Supplementary Figure 6.7).
6.3.3 Part of the HOP bulk is localized to the nucleus in response to heat
In mouse, HOP remains predominantly cytoplasmatic in resting cells, although a small fraction of HOP was also observed in some nuclei (Daniel et al., 2008). In contrast to the situation in control conditions, treatment with leptomycin B, G1/S arrest or heat stress promotes its retention in the nucleus (Daniel et al., 2008; Odunuga et al., 2004).
In Arabidopsis, we can observe a nuclear accumulation of HOP3 and HOP1 during the heat challenge. This nuclear redistribution seems dynamic and dependent on the presence and
CHAPTER 6
114
persistence of the stress, since both proteins shuttle from the cytoplasm to the nucleus early during the challenge, remain there if the heat is maintained (at least for 3 h in the case of HOP3 and for a shorter period in the case of HOP1), and return back to the cytosol during the recovery time. It has to be noted that all the members of the AtHOP family have a conserved nuclear localization signal (NLS), and so, it is also possible that part of the bulk of HOP2 could also be detected in this compartment.
6.3.4 Localization of HOP to SGs
Heat stress courses with a rapid inhibition of mRNA translation and, under such conditions, different ribonucleoprotein complexes aggregate forming different foci in the cytosol. One of these aggregations, which can be distinguished based on the presence of the UBP1 marker, is the SGs (Weber et al., 2008).
In addition to the partial distribution to nuclei, we can also observe that part of the bulk of HOP that remains in the cytosol accumulates in specific UBP1 containing foci under the heat challenge and remains associated to them until these foci disassemble during the attenuation period, when these HOPs recover their diffuse cytosolic localization. Based on (1) the presence of AtHOPs in heat-induced SGs, (2) the main role of the mammalian HSP90 in the recruitment of certain components as AGO-2, eIF4E or 4E-T to SGs (Matsumoto et al.; Pare et al., 2009), and (3) the tight interaction between AtHOPs and HSP90 under heat, one could hypothesize that AtHOPs could be targeted by HSP90 to SGs. Alternatively, it is also possible that HOPs may assist HSP90 in its role in SGs´ protein incorporation during heat stress or in their rapid disassembly during the recovery period.
SGs have been proposed to serve as sorting sites, where mRNAs that have been dissociated from polysomes are targeted for storage, re-initiation or degradation by transfer to P-bodies, modulating translation and mRNA homeostasis (Balagopal and Parker, 2009). The study of whether HOPs, through their association to these foci, could also affect these processes should await further studies.
6.3.5 HOP seems to participate along with HSP90 in the attenuation of the HSR in plants
In Arabidopsis, HSP90.1 was described to interact with HsfA2 and to partially change its subcellular localization from the cytoplasm to the nucleus in response to heat (Meiri and Breiman, 2009). More recently, the interaction between HSP90 with HsfA1, HsfA2 and HsfB1 has been demonstrated in tomato mesophyll protoplast. In this species, HSP90 negatively regulates the transcriptional activity of the HsfA1 and HsfA2 complex and modulates HsfB1 DNA binding to function as an HSR repressor (Hahn et al., 2011). In addition to HSP90, the possible role of HOP in the formation of Hsf-HSE complexes were also evaluated in vitro using lysates from HeLa cells or Xenopus laevis oocytes (Bharadwaj et al., 1999; Zou et al., 1998), obtaining contradictory results. Nevertheless, in any case, the targets of HOP, the magnitude of the changes in gene expression and the importance of this regulation for the acquisition of thermotolerance were previously addressed.
CHAPTER 6
115
Our RNAseq analysis reveals a slight but significant activation of some Hsf1A/B/C/D and HsfA2 target genes in the hop1 hop2 hop3 triple mutant under the challenge, a stage where part of the bulk of HOPs and AtHSP90, especially of AtHSP90.1, are observed in the nuclei (Meiri and Breiman, 2009). Due to the prominent role of HSP90 in the negative regulation of HSR in plants, the described data are consistent with the formation of an HOP3-HSP90-HsfA1a ternary complex involved in the attenuation of the HSR in plants. A previous report demonstrated that the interaction between HSP90 and HsfA1 and HsfA2 seems to be independent of the HSP90´s MEEVD sequence that is essential for the interaction with HOP in mammals and yeast (Hahn et al., 2011), suggesting that HSP90 could support the simultaneous binding of HOPs and Hsfs. In this context, the absence of HsfA1a in the immunoprecipitations carried out under severe stringent conditions (Table 1) further reinforces the idea that HSP90 mediates the HsfA1a and HOP3 interaction. Moreover, the high conservation of the protein domains in the HOP family, and, the redundant role of the different AtHOPs in the LAT phenotype open the possibility that the other members of the HOP family could also become part of these higher complexes exerting a similar function.
In addition to the possible regulation of the Hsf1s and HsfA2 activity, the fact that the expression of other genes (non-specifically defined as targets of these Hsfs) is also altered in the triple mutant, strongly suggests that HOP could also directly or indirectly modulate other aspects of the transcriptional regulation during the applied heat stress.
Besides the situation under heat stress, our analysis also shows that the hop1 hop2 hop3 triple mutant also shows an upregulation of a subset of heat responsive genes under control conditions, implying that the response to our applied heat stress is partially activated in the triple mutant under control conditions. From those, only 3 were identified as a target of Hsf1A/B/D/E and HsfA2 (At3g02480, At1g62730 and At2g21820) (Liu and Charng, 2013; Nishizawa et al., 2006; Schramm et al., 2006). Apart from these genes, we can also observe a milder upregulation of other Hsf1A/B/D/E and HsfA2 responsive genes in the hop1 hop2 hop3 triple mutant (Supplementary Figure 6.10). Although present, the small number these genes suggests a more active role of HOP in regulating the HSR during the heat treatment.
It was previously shown that the strong constitutive activation of the HSR (for example by a high overexpression of HsfA1 and HsfA2 (Lee et al., 1995; Ogawa et al., 2007), confers increased thermotolerance in Arabidopsis. However, despite the fact that we can observe an upregulation of different Hsf1A/B/D/E and HsfA2 responsive genes in our hop1 hop2 hop3 triple mutant, especially under heat stress conditions, this mutant shows a reduced LAT. Since only a small subset of these genes is induced, it seems possible that this partial expression is not sufficient to promote thermotolerance. Anyway, this observation suggests that somehow other aspects as the full regulation of gene expression that affects a large number of genes, not only to the direct targets of the Hsf1A/B/D/E and HsfA2, could have a higher impact on the output of the phenotype. In addition, it is highly possible that the defect in QC could be a main factor in the LAT hypersensitivity outcome of the hop1 hop2 hop3 triple mutant.
CHAPTER 6
116
6.3.6 A defect in QC is observed in the hop1 hop2 hop3 triple mutants during heat treatments
Proper protein folding is crucial to maintain protein structure (and, subsequently, protein activity) and to avoid extensive cell and tissue damage. For this reason, a whole network of chaperones and cochaperones have evolved in living cells to avoid the deadly accumulation of misfolded proteins (Chen et al., 2011). This system is especially important during heat stress, since heat, per-se, promotes protein denaturation and aggregation.
Our data establish an unusually high increase in the accumulation of insoluble proteins in the hop1 hop2 hop3 mutant during the heat treatment. These insoluble proteins are ubiquitinated, further demonstrating that the QC system is completely overwhelmed in the absence of AtHOPs. Based on the information of HOPs in other eukaryotes, it seems possible that HOP could exert a role in QC under heat stress through their tight binding to HSP90 and probably to HSP70 (to which HOPs bind with lesser affinity in plants, as demonstrated in Chapter 4).
It is interesting to note that HOP3 does not only bind with high affinity to HSP90 but also to other two proteins, RCA and actin, which have a major role during the heat stress response in plants. RCA is a chloroplastic protein encoded in the nucleus that is synthesized in the cytoplasm, opening the possibility that HOP could participate along with other chaperones and cochaperones in maintaining RCA in a competent state until they are imported in the chloroplast. This hypothesis is strengthened by the finding that different chaperones complexes including HSP90 and HOP associate to chloroplast pre-proteins in wheat germ extracts (WGE) (Fellerer et al., 2011). Since RCA is subjected to a high catalytic turnover under heat (Crafts-Brandner and Salvucci, 2000), HOP interaction with RCA may be crucial to regulating RCA levels, and so, the control of plant photosynthesis under heat stress (Kurek et al., 2007; Ristic et al., 2009). Furthermore, in plants mild heat challenges, as the treatment used for this proteomics analysis, promote actin cytoskeletal reorganization (Fan et al., 2016). Interestingly, in mammals, different observations support that HSP90 and HOP are involved in cancerous cell migration, a process mediated by HOP interaction with HSP90 and actin filaments (Willmer et al., 2012). Based on these data and on the interaction between HOP3 and actin, it is possible that HOP can assist actin reorganization under sublethal heat challenges. In this sense, it is noteworthy that one of the subunits of the CCT chaperonin complex, a major chaperone involved in actin folding in mammals, has also been identified among our HOP3 interactors. This result, which should be further validated, is consistent with the described interaction between HOP and CTT in rabbit reticulocytes (Gebauer et al., 1998), and suggests a role of HOP in thermotolerance acquisition through the active re-organization of actin microfilaments under heat.
Plants due to their sessile nature are forced to adapt to the continuously changing conditions, and among them, heat and drought are considered the most deleterious environmental factors. This article describes, for the first time in plants, that HOP proteins play a main role during LAT, unravelling a new important player of plant acclimation to high temperatures. In addition, this article dissects the molecular role of HOP in the control of the HSR and QC (Figure 6.12), increasing our scarce knowledge on how molecular chaperones modulate these
CHAPTER 6
117
important processes during the plant response to one of the most devastating stresses for crop production.
Figure 6.12. Proposed model for the role of AtHOPs during the plant response to heat stress. Under control conditions (left panel), the constitutive members of the AtHOP family, mainly HOP1 and HOP2, would assist protein folding in the cytoplasm. In addition, they contribute to the inhibition of heat-induced gene expression the absence of a heat challenge. During the heat stress (right panel), AtHOP3 is highly induced and, in such a way, the global amount of AtHOP is increased, enhancing the role of AtHOP in protein QC. In addition to its cytosolic role, during the challenge, part of the bulk of AtHOP shuttles to the nuclei where is involved in modulating the HSR and probably in attenuating part of the Hsf1/HsfA2-dependent transcriptional response. Furthermore, heat also promotes the reversible localization of AtHOPs to cytoplasmic foci containing UBP1, where they may modulate HSP90 activity in the incorporation of selected proteins to these foci. The tight affinity of AtHOPs for HSP90 and the described presence of this chaperone in the locations where AtHOPs are observed highly suggest that AtHOPs may exert this function through the formation of higher ordered complexes containing HSP90 and other proteins as HSP70, Hsfs or UBP1 among others.
CHAPTER 6
118
6.4 SUPPLEMENTAL DATA
Supplementary Figure 6.1. Analysis of GUS expression in the AtHOP3pro-AtHOP3-GUS line used for this study. (A) qRT-PCR analysis of GUS expression from transgenic Arabidopsis seedlings expressing the construct AtHOP3pro-AtHOP3-GUS. 7 day-old seedlings were grown continuously at 22°C (C), heat stressed at 38°C for the last 2 h (H), or left to recover at 22°C for 1 h after the 38°C challenge (as shown schematically in (B)). Expression values from the analysis of three biological replicates are shown as means + SEM. Fold change values are related to GUS expression at 22°C conditions.
Supplementary Figure 6.2. Analysis of AtHOP3 expression in the hop3-1 mutant. qRT-PCR analysis of HOP3 expression in seedlings from hop3-1 mutant or Col-0. In each case, 7 day-old seedlings were grown continuously at 22°C or heat stressed at 38°C for 1 h. Values from the analysis of three biological replicates are shown as means + SEM. Fold change values are related to AtHOP3 expression in Col-0 grown at 22°C conditions.
CHAPTER 6
119
Supplementary Figure 6.3. None of the HOP members alone is crucial for the establishment of LAT in Arabidopsis. Seedlings from Col-0 and from hop1-1, hop2-1 and hop3-1 single mutants were either grown at control conditions (upper panel) or subjected to a LAT assay following the heat regimes are schematically shown on the left of each row. Seedlings in the same horizontal file were grown on the same plate. Photographs were taken 7 days after the 45°C heat treatment or after 12 days for those grown at control conditions.
Supplementary Figure 6.4. Analysis of the expression of the three members of the AtHOP family in the hop1 hop2 hop3 triple mutant. qRT-PCR analysis of the expression of AtHOP1, AtHOP2 and AtHOP3 in hop1 hop2 hop3 triple mutant or Col-0 plants. Values from the analysis of three biological replicates are shown as means + SEM. These values are related to the expression of each gene in Col-0 grown at 22°C conditions.
CHAPTER 6
120
Supplementary Figure 6.5. hop1 hop3 and hop2 hop3 double mutants show a subtle decrease in LAT. Phenotypes of Arabidopsis seedlings of the wild type (Col-0) and double hop1 hop3 or hop2 hop3 mutants after the recovery from the assays schematically shown on the left of each row. Seedlings in the same horizontal file were grown on the same plate. Photographs were taken 7 days after the 45°C heat treatment or after 12 days for those grown at control conditions.
Supplementary Figure 6.6. AtHOP3 immunoprecipitation from Arabidopsis extracts. Seedlings from Arabidopsis plants expressing the constructs HOP3pro-HOP3-HA (AtHOP3-HA +) or from Col-0 as control (AtHOP3-HA -) were subjected to a heat treatment of 38°C for 3 h. After the treatment, equal amounts of protein extracts were subjected to purification with anti-HA beads which were eluted with the HA-peptide. Equal amounts in volume of the eluted fractions were run in an SDS-PAGE gel and silver stained (left panel) or subjected to Western blot using anti-HA antibodies (right panel).
CHAPTER 6
121
Supplementary Figure 6.7. The different members of AtHOP family interact in vivo with AtHSP90.1. Protein extracts (crude extracts) from N. benthamiana leaves transiently expressing under the control of the 35S promoter different combinations of HSP90-2xIgGBD (IgG binding domain) and HOP1-GFP (A) or HSP90-2xIgGBD, HOP2-HA and HA-HOP3 (B) were subjected to purification with IgG agarose beads and to further elution by low pH. Equal amounts in volume of the eluted fractions (IP:IgG) were run in SDS-PAGE and subjected to Western blot using anti-GFP (A) and anti-HA antibodies (B).
Supplementary Figure 6.8. Analysis of AtHOP1 subcellular localization during the heat challenge and the recovery period from the stress. Localization of AtHOP1-GFP in the root tip of 7 day-old HOP1pro-HOP1-GFP seedlings grown at 22°C, heat stress at 38°C for the last 3 h and left to recover from the heat stress for 20 min and 30 min. Bars= 40 µm.
CHAPTER 6
122
Supplementary Figure 6.9. Enrichment in GO terms of the genes upregulated in the hop1 hop2 hop3 triple mutant compared to Col-0 under control conditions. For this analysis the agriGo tool, a GO analysis toolkit and database for the agricultural community (http://bioinfo.cau.edu.cn/agriGO/analysis.php) was used, selecting the Arabidopsis genome (TAIR 10) as reference.
CHAPTER 6
123
Supplementary Figure 6.10. Identification of genes regulated by Hsf1A/B/D/E and HsfA2 that change significantly in the RNAseq analysis in the hop1 hop2 hop3 triple mutant compared to Col-0 under control conditions. All the included genes were previously identified as genes upregulated in the the hsf1a hsf1b hsf1d hsf1e mutant and hsf2a mutants [42-44]. The expression change in the hop1 hop2 hop3 triple mutant (hop-tm) compared to Col-0 is coloured coded according to the scale shown on the right.
7. CHAPTER 7. GENERAL CONCLUSIONS
CHAPTER 7
126
GENERAL CONCLUSIONS The results of this thesis permit the extraction of the following conclusions:
1. HOP3 is expressed in roots, seedlings and reproductive tissues in Arabidopsis. Consistently with this expression, HOP3 protein is accumulated in roots in 7 day-old seedlings and in roots and leaves at older stages. HOP3 is also detected at high levels in reproductive tissues such as anthers, pollen grains and ovules.
2. HOP3 interacts with cytosolic HSP90.1 and HSP70 in vivo. Additionally, HOP3 interacts with BiP. This latter interaction involves BiP´s NBD domain.
3. Under control conditions, HOP3 is located in the cytoplasm and the ER.
4. HOP3 is induced by different UPR inducer agents by a mechanism dependent on IRE1.
5. hop3 loss-of-function mutants show a hypersensitive phenotype in the presence of DTT and TM. This phenotype is reverted by the addition of TUDCA, demonstrating that this protein plays an essential role in the alleviation of the ER stress response.
6. The hypersusceptibility phenotype of the hop3-1 mutant against both Botrytis cinerea and Fusarium oxysporum sp. Conglutinans, compared to wild-type plants, demonstrate that HOP3 protein is necessary for an effective defense response against those fungal phytopathogens.
7. The interaction of the HOP3 protein with COI1 , by yeast two-hybrid assays, and the reduced sensitivity to MeJA of the hop3-1 mutant, compared to wild-type plants, suggest an implication of HOP3 in the jasmonic acid signaling pathway in Arabidopsis.
8. The hypersusceptibility phenotype of the hop3-1 mutant against Pseudomonas syringae pv tomato DC3000, compared to the wild-type plants, demonstrate that HOP3 protein is involved in defense response against this phytopathogenic bacteria.
9. The members of the AtHOP family display a different induction pattern in response to high temperatures: HOP1 is not significantly induced, HOP2 is modestly upregulated while HOP3 is highly upregulated by heat.
10. In contrast to the absence of a LAT related phenotype in the hop1-1, hop2-1 and hop3-1 single mutants, the hop1 hop2 hop3 triple mutant shows a LAT hypersensitivity phenotype, revealing a functional redundancy of the different members of the HOP family in LAT acquisition in Arabidopsis. These data also demonstrate an essential role of HOPs in LAT in plants.
11. HOP1 and HOP2 also form a complex with HSP90.1 in vivo.
CHAPTER 7
127
12. Part of the bulk of HOP1 and HOP3 shuttles from the cytoplasm to nuclei and to UBP1c-containing cytoplasmic foci under heat stress. This change in subcellular localization is dynamic and dependent on the presence and persistence of the stress.
13. Transcriptome analyses show a clear misregulation of different subsets of genes in the hop1 hop2 hop3 triple mutant both under control conditions and during the response to heat stress. This misexpression includes an upregulation of specific targets of Hsf1s and HsfA2. These data reveal that HOPs have a role in the proper establishment of the transcriptional response to heat in Arabidopsis.
14. Consistent with this role, HOP interacts with HsfA1a during the heat challenge.
15. In the absence of AtHOPs, heat also leads to a higher accumulation of insoluble-ubiquitinated proteins in the hop1 hop2 hop3 mutant.
8. CHAPTER 8. PUBLICATIONS
CHAPTER 8
130
PUBLICATIONS • Fernandez-Bautista, N., L. Fernandez-Calvino, A. Munoz, and M.M. Castellano. 2017a.
HOP3 a new regulator of the ER stress response in Arabidopsis with possible implications in plant development and response to biotic and abiotic stresses. Plant signaling & behavior:0.
• Fernandez-Bautista, N., L. Fernandez-Calvino, A. Munoz, and M.M. Castellano. 2017. HOP3, a member of the HOP family in Arabidopsis, interacts with BiP and plays a major role in the ER stress response. Plant Cell Environ.
• Fernández-Bautista, N., Domínguez-Núñez, J. A., Moreno, M. C. and Berrocal-Lobo, M. (2016). Plant Tissue Trypan Blue Staining During Phytopathogen Infection. Bio-protocol 6(24): e2078.
9. CHAPTER 9. REFERENCES
Abbas-Terki, T., O. Donze, P.A. Briand, and D. Picard. 2001. Hsp104 interacts with Hsp90 cochaperones in respiring yeast. Molecular and cellular biology. 21:7569-7575.
AbuQamar, S., K. Moustafa, and L.S. Tran. 2017. Mechanisms and strategies of plant defense against Botrytis cinerea. Critical reviews in biotechnology. 37:262-274.
Ahmad, P., S. Rasool, A. Gul, S.A. Sheikh, N.A. Akram, M. Ashraf, A.M. Kazi, and S. Gucel. 2016. Jasmonates: Multifunctional Roles in Stress Tolerance. Front Plant Sci. 7:813.
Ahsan, N., T. Donnart, M.Z. Nouri, and S. Komatsu. 2010. Tissue-specific defense and thermo-adaptive mechanisms of soybean seedlings under heat stress revealed by proteomic approach. J Proteome Res. 9:4189-4204.
Akerfelt, M., R.I. Morimoto, and L. Sistonen. 2010. Heat shock factors: integrators of cell stress, development and lifespan. Nature reviews. Molecular cell biology. 11:545-555.
Alvim, F.C., S.M. Carolino, J.C. Cascardo, C.C. Nunes, C.A. Martinez, W.C. Otoni, and E.P. Fontes. 2001. Enhanced accumulation of BiP in transgenic plants confers tolerance to water stress. Plant physiology. 126:1042-1054.
Anders, S., P.T. Pyl, and W. Huber. 2015. HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics. 31:166-169.
Antico CJ, C.C., Banks T, et al. 2012. Insights into the role of jasmonic acid-mediated defenses against necrotrophic and biotrophic fungal pathogens. 7.
Atkinson, N.J., and P.E. Urwin. 2012. The interaction of plant biotic and abiotic stresses: from genes to the field. J Exp Bot. 63:3523-3543.
Aviezer-Hagai, K., J. Skovorodnikova, M. Galigniana, O. Farchi-Pisanty, E. Maayan, S. Bocovza, Y. Efrat, P. von Koskull-Doring, N. Ohad, and A. Breiman. 2007. Arabidopsis immunophilins ROF1 (AtFKBP62) and ROF2 (AtFKBP65) exhibit tissue specificity, are heat-stress induced, and bind HSP90. Plant Mol Biol. 63:237-255.
Awad, W., I. Estrada, Y. Shen, and L.M. Hendershot. 2008. BiP mutants that are unable to interact with endoplasmic reticulum DnaJ proteins provide insights into interdomain interactions in BiP. Proceedings of the National Academy of Sciences of the United States of America. 105:1164-1169.
Azevedo, C., A. Sadanandom, K. Kitagawa, A. Freialdenhoven, K. Shirasu, and P. Schulze-Lefert. 2002. The RAR1 interactor SGT1, an essential component of R gene-triggered disease resistance. Science. 295:2073-2076.
Balagopal, V., and R. Parker. 2009. Polysomes, P bodies and stress granules: states and fates of eukaryotic mRNAs. Current opinion in cell biology. 21:403-408.
Ballinger, C.A., P. Connell, Y. Wu, Z. Hu, L.J. Thompson, L.Y. Yin, and C. Patterson. 1999. Identification of CHIP, a novel tetratricopeptide repeat-containing protein that interacts with heat shock proteins and negatively regulates chaperone functions. Molecular and cellular biology. 19:4535-4545.
Bao, F., X. Huang, C. Zhu, X. Zhang, X. Li, and S. Yang. 2014. Arabidopsis HSP90 protein modulates RPP4-mediated temperature-dependent cell death and defense responses. New Phytol. 202:1320-1334.
Bari, R., and J.D. Jones. 2009. Role of plant hormones in plant defence responses. Plant Mol Biol. 69:473-488.
Bartlett, A.I., and S.E. Radford. 2009. An expanding arsenal of experimental methods yields an explosion of insights into protein folding mechanisms. Nature structural & molecular biology. 16:582-588.
Ben Khaled, S., J. Postma, and S. Robatzek. 2015. A moving view: subcellular trafficking processes in pattern recognition receptor-triggered plant immunity. Annual review of phytopathology. 53:379-402.
Berger, E., and D. Haller. 2011. Structure-function analysis of the tertiary bile acid TUDCA for the resolution of endoplasmic reticulum stress in intestinal epithelial cells. Biochemical and biophysical research communications. 409:610-615.
135
Berrocal-Lobo, M., and A. Molina. 2004. Ethylene response factor 1 mediates Arabidopsis resistance to the soilborne fungus Fusarium oxysporum. Molecular plant-microbe interactions : MPMI. 17:763-770.
Berrocal-Lobo, M., and A. Molina. 2008. Arabidopsis defense response against Fusarium oxysporum. Trends in plant science. 13:145-150.
Berrocal-Lobo, M., A. Molina, and R. Solano. 2002. Constitutive expression of ETHYLENE-RESPONSE-FACTOR1 in Arabidopsis confers resistance to several necrotrophic fungi. The Plant journal : for cell and molecular biology. 29:23-32.
Berrocal-Lobo, M., S. Stone, X. Yang, J. Antico, J. Callis, K.M. Ramonell, and S. Somerville. 2010. ATL9, a RING zinc finger protein with E3 ubiquitin ligase activity implicated in chitin- and NADPH oxidase-mediated defense responses. PLoS One. 5:e14426.
Bharadwaj, S., A. Ali, and N. Ovsenek. 1999. Multiple components of the HSP90 chaperone complex function in regulation of heat shock factor 1 In vivo. Molecular and cellular biology. 19:8033-8041.
Bieri, S., S. Mauch, Q.H. Shen, J. Peart, A. Devoto, C. Casais, F. Ceron, S. Schulze, H.H. Steinbiss, K. Shirasu, and P. Schulze-Lefert. 2004. RAR1 positively controls steady state levels of barley MLA resistance proteins and enables sufficient MLA6 accumulation for effective resistance. The Plant cell. 16:3480-3495.
Bisson, M.M., A. Bleckmann, S. Allekotte, and G. Groth. 2009. EIN2, the central regulator of ethylene signalling, is localized at the ER membrane where it interacts with the ethylene receptor ETR1. The Biochemical journal. 424:1-6.
Bita, C.E., and T. Gerats. 2013. Plant tolerance to high temperature in a changing environment: scientific fundamentals and production of heat stress-tolerant crops. Front Plant Sci. 4:273.
Blatch, G.L., and M. Lassle. 1999. The tetratricopeptide repeat: a structural motif mediating protein-protein interactions. BioEssays : news and reviews in molecular, cellular and developmental biology. 21:932-939.
Blatch, G.L., M. Lassle, B.R. Zetter, and V. Kundra. 1997. Isolation of a mouse cDNA encoding mSTI1, a stress-inducible protein containing the TPR motif. Gene. 194:277-282.
Boavida, L.C., and S. McCormick. 2007. Temperature as a determinant factor for increased and reproducible in vitro pollen germination in Arabidopsis thaliana. The Plant journal : for cell and molecular biology. 52:570-582.
Boorstein, W.R., T. Ziegelhoffer, and E.A. Craig. 1994. Molecular evolution of the HSP70 multigene family. Journal of molecular evolution. 38:1-17.
Bose, S., T. Weikl, H. Bugl, and J. Buchner. 1996. Chaperone function of Hsp90-associated proteins. Science. 274:1715-1717.
Boter, M., B. Amigues, J. Peart, C. Breuer, Y. Kadota, C. Casais, G. Moore, C. Kleanthous, F. Ochsenbein, K. Shirasu, and R. Guerois. 2007. Structural and functional analysis of SGT1 reveals that its interaction with HSP90 is required for the accumulation of Rx, an R protein involved in plant immunity. The Plant cell. 19:3791-3804.
Bradford, M.M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72:248-254.
Breiman, A. 2014. Plant Hsp90 and its co-chaperones. Current protein & peptide science. 15:232-244.
Brinker, A., C. Scheufler, F. Von Der Mulbe, B. Fleckenstein, C. Herrmann, G. Jung, I. Moarefi, and F.U. Hartl. 2002. Ligand discrimination by TPR domains. Relevance and selectivity of EEVD-recognition in Hsp70 x Hop x Hsp90 complexes. The Journal of biological chemistry. 277:19265-19275.
Buchberger, A., B. Bukau, and T. Sommer. 2010. Protein quality control in the cytosol and the endoplasmic reticulum: brothers in arms. Molecular cell. 40:238-252.
136
Camejo, D., A. Jiménez, J.J. Alarcón, W. Torres, J.M. Gómez, and F. Sevilla. 2006. Changes in photosynthetic parameters and antioxidant activities following heat-shock treatment in tomato plants. Functional Plant Biology. 33:177-187.
Caplan, A.J. 2003. What is a co-chaperone? Cell Stress Chaperones. 8:105-107. Caramelo, J.J., and A.J. Parodi. 2008. Getting in and out from calnexin/calreticulin cycles. The
Journal of biological chemistry. 283:10221-10225. Carrara, M., F. Prischi, P.R. Nowak, M.C. Kopp, and M.M. Ali. 2015. Noncanonical binding of BiP
ATPase domain to Ire1 and Perk is dissociated by unfolded protein CH1 to initiate ER stress signaling. eLife. 4.
Carvalho, H.H., P.A. Silva, G.C. Mendes, O.J. Brustolini, M.R. Pimenta, B.C. Gouveia, M.A. Valente, H.J. Ramos, J.R. Soares-Ramos, and E.P. Fontes. 2014. The endoplasmic reticulum binding protein BiP displays dual function in modulating cell death events. Plant physiology. 164:654-670.
Cazale, A.C., M. Clement, S. Chiarenza, M.A. Roncato, N. Pochon, A. Creff, E. Marin, N. Leonhardt, and L.D. Noel. 2009. Altered expression of cytosolic/nuclear HSC70-1 molecular chaperone affects development and abiotic stress tolerance in Arabidopsis thaliana. J Exp Bot. 60:2653-2664.
Cianciotto, N.P., and R.C. White. 2017. Expanding Role of Type II Secretion in Bacterial Pathogenesis and Beyond. Infection and immunity. 85.
Clement, M., N. Leonhardt, M.J. Droillard, I. Reiter, J.L. Montillet, B. Genty, C. Lauriere, L. Nussaume, and L.D. Noel. 2011. The cytosolic/nuclear HSC70 and HSP90 molecular chaperones are important for stomatal closure and modulate abscisic acid-dependent physiological responses in Arabidopsis. Plant physiology. 156:1481-1492.
Clough, S.J., and A.F. Bent. 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. The Plant journal : for cell and molecular biology. 16:735-743.
Cox, J.S., C.E. Shamu, and P. Walter. 1993. Transcriptional induction of genes encoding endoplasmic reticulum resident proteins requires a transmembrane protein kinase. Cell. 73:1197-1206.
Crafts-Brandner, S.J., and M.E. Salvucci. 2000. Rubisco activase constrains the photosynthetic potential of leaves at high temperature and CO2. Proceedings of the National Academy of Sciences of the United States of America. 97:13430-13435.
Credle, J.J., J.S. Finer-Moore, F.R. Papa, R.M. Stroud, and P. Walter. 2005. On the mechanism of sensing unfolded protein in the endoplasmic reticulum. Proceedings of the National Academy of Sciences of the United States of America. 102:18773-18784.
Creelman, R.A., and J.E. Mullet. 1995. Jasmonic acid distribution and action in plants: regulation during development and response to biotic and abiotic stress. Proceedings of the National Academy of Sciences of the United States of America. 92:4114-4119.
Crofts, A.J., N. Leborgne-Castel, M. Pesca, A. Vitale, and J. Denecke. 1998. BiP and calreticulin form an abundant complex that is independent of endoplasmic reticulum stress. The Plant cell. 10:813-824.
Czarnecka-Verner, E., S. Pan, T. Salem, and W.B. Gurley. 2004. Plant class B HSFs inhibit transcription and exhibit affinity for TFIIB and TBP. Plant Mol Biol. 56:57-75.
Czymmek, K.J., M. Fogg, D.H. Powell, J. Sweigard, S.Y. Park, and S. Kang. 2007. In vivo time-lapse documentation using confocal and multi-photon microscopy reveals the mechanisms of invasion into the Arabidopsis root vascular system by Fusarium oxysporum. Fungal genetics and biology : FG & B. 44:1011-1023.
Chakrabarti, A., A.W. Chen, and J.D. Varner. 2011. A review of the mammalian unfolded protein response. Biotechnology and bioengineering. 108:2777-2793.
137
Charng, Y.Y., H.C. Liu, N.Y. Liu, W.T. Chi, C.N. Wang, S.H. Chang, and T.T. Wang. 2007. A heat-inducible transcription factor, HsfA2, is required for extension of acquired thermotolerance in Arabidopsis. Plant physiology. 143:251-262.
Che, P., J.D. Bussell, W. Zhou, G.M. Estavillo, B.J. Pogson, and S.M. Smith. 2010. Signaling from the endoplasmic reticulum activates brassinosteroid signaling and promotes acclimation to stress in Arabidopsis. Science signaling. 3:ra69.
Chen, B., M. Retzlaff, T. Roos, and J. Frydman. 2011. Cellular strategies of protein quality control. Cold Spring Harb Perspect Biol. 3:a004374.
Chen, B., D. Zhong, and A. Monteiro. 2006. Comparative genomics and evolution of the HSP90 family of genes across all kingdoms of organisms. BMC Genomics. 7:156.
Chen, L., S. Hamada, M. Fujiwara, T. Zhu, N.P. Thao, H.L. Wong, P. Krishna, T. Ueda, H. Kaku, N. Shibuya, T. Kawasaki, and K. Shimamoto. 2010. The Hop/Sti1-Hsp90 chaperone complex facilitates the maturation and transport of a PAMP receptor in rice innate immunity. Cell host & microbe. 7:185-196.
Chen, S., V. Prapapanich, R.A. Rimerman, B. Honore, and D.F. Smith. 1996. Interactions of p60, a mediator of progesterone receptor assembly, with heat shock proteins hsp90 and hsp70. Molecular endocrinology. 10:682-693.
Chen, S., and D.F. Smith. 1998. Hop as an adaptor in the heat shock protein 70 (Hsp70) and hsp90 chaperone machinery. The Journal of biological chemistry. 273:35194-35200.
Chen, Y., and F. Brandizzi. 2013. IRE1: ER stress sensor and cell fate executor. Trends in cell biology. 23:547-555.
Chisholm, S.T., G. Coaker, B. Day, and B.J. Staskawicz. 2006. Host-microbe interactions: shaping the evolution of the plant immune response. Cell. 124:803-814.
Daniel, S., G. Bradley, V.M. Longshaw, C. Soti, P. Csermely, and G.L. Blatch. 2008. Nuclear translocation of the phosphoprotein Hop (Hsp70/Hsp90 organizing protein) occurs under heat shock, and its proposed nuclear localization signal is involved in Hsp90 binding. Biochimica et biophysica acta. 1783:1003-1014.
de Almeida, S.F., G. Picarote, J.V. Fleming, M. Carmo-Fonseca, J.E. Azevedo, and M. de Sousa. 2007. Chemical chaperones reduce endoplasmic reticulum stress and prevent mutant HFE aggregate formation. The Journal of biological chemistry. 282:27905-27912.
Dean, R., J.A. Van Kan, Z.A. Pretorius, K.E. Hammond-Kosack, A. Di Pietro, P.D. Spanu, J.J. Rudd, M. Dickman, R. Kahmann, J. Ellis, and G.D. Foster. 2012. The Top 10 fungal pathogens in molecular plant pathology. Molecular plant pathology. 13:414-430.
del Pozo, O., K.F. Pedley, and G.B. Martin. 2004. MAPKKKalpha is a positive regulator of cell death associated with both plant immunity and disease. EMBO J. 23:3072-3082.
Delaney, T.P., S. Uknes, B. Vernooij, L. Friedrich, K. Weymann, D. Negrotto, T. Gaffney, M. Gut-Rella, H. Kessmann, E. Ward, and J. Ryals. 1994. A central role of salicylic Acid in plant disease resistance. Science. 266:1247-1250.
Demand, J., J. Luders, and J. Hohfeld. 1998. The carboxy-terminal domain of Hsc70 provides binding sites for a distinct set of chaperone cofactors. Molecular and cellular biology. 18:2023-2028.
Denance, N., A. Sanchez-Vallet, D. Goffner, and A. Molina. 2013. Disease resistance or growth: the role of plant hormones in balancing immune responses and fitness costs. Front Plant Sci. 4:155.
Denby, K.J., P. Kumar, and D.J. Kliebenstein. 2004. Identification of Botrytis cinerea susceptibility loci in Arabidopsis thaliana. The Plant journal : for cell and molecular biology. 38:473-486.
Deng, Y., S. Humbert, J.X. Liu, R. Srivastava, S.J. Rothstein, and S.H. Howell. 2011. Heat induces the splicing by IRE1 of a mRNA encoding a transcription factor involved in the unfolded protein response in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America. 108:7247-7252.
138
Deng, Y., R. Srivastava, and S.H. Howell. 2013. Endoplasmic reticulum (ER) stress response and its physiological roles in plants. International journal of molecular sciences. 14:8188-8212.
Di Pietro, A., F.I. Garcia-MacEira, E. Meglecz, and M.I. Roncero. 2001. A MAP kinase of the vascular wilt fungus Fusarium oxysporum is essential for root penetration and pathogenesis. Molecular microbiology. 39:1140-1152.
Doyle, J. 1987. DNA Protocols for Plants. Dragovic, Z., S.A. Broadley, Y. Shomura, A. Bracher, and F.U. Hartl. 2006. Molecular chaperones
of the Hsp110 family act as nucleotide exchange factors of Hsp70s. EMBO J. 25:2519-2528.
Du, Z., X. Zhou, Y. Ling, Z. Zhang, and Z. Su. 2010. agriGO: a GO analysis toolkit for the agricultural community. Nucleic acids research. 38:W64-70.
Durrant, W.E., and X. Dong. 2004. Systemic acquired resistance. Annual review of phytopathology. 42:185-209.
Echevarria-Zomeno, S., L. Fernandez-Calvino, A.B. Castro-Sanz, J.A. Lopez, J. Vazquez, and M.M. Castellano. 2015. Dissecting the proteome dynamics of the early heat stress response leading to plant survival or death in Arabidopsis. Plant, cell & environment. 39 1264-1278.
Echevarria-Zomeno, S., L. Fernandez-Calvino, A.B. Castro-Sanz, J.A. Lopez, J. Vazquez, and M.M. Castellano. 2016. Dissecting the proteome dynamics of the early heat stress response leading to plant survival or death in Arabidopsis. Plant Cell Environ. 39:1264-1278.
Eichmann, R., and P. Schafer. 2012. The endoplasmic reticulum in plant immunity and cell death. Front Plant Sci. 3:200.
El Oirdi, M., T.A. El Rahman, L. Rigano, A. El Hadrami, M.C. Rodriguez, F. Daayf, A. Vojnov, and K. Bouarab. 2011. Botrytis cinerea manipulates the antagonistic effects between immune pathways to promote disease development in tomato. The Plant cell. 23:2405-2421.
Ellis, J. 1987. Proteins as molecular chaperones. Nature. 328:378-379. Fan, T., R. Wang, Y. Xiang, L. An, and S. Cao. 2016. Heat stress induces actin cytoskeletal
reorganization and transcript profiles of vegetative profilins and actin depolymerizing factors (ADFs) in Arabidopsis. Acta Physiologiae Plantarum. 38:37.
FAO. 2010. The Second Report on THE STATE OF THE WORLD’s PLANT GENETIC RESOURCES FOR FOOD AND AGRICULTURE. In COMMISSION ON GENETIC RESOURCES FOR FOOD AND AGRICULTURE FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS. FAO, editor, Rome.
Fellerer, C., R. Schweiger, K. Schongruber, J. Soll, and S. Schwenkert. 2011. Cytosolic HSP90 cochaperones HOP and FKBP interact with freshly synthesized chloroplast preproteins of Arabidopsis. Molecular plant. 4:1133-1145.
Fernández-Bautista. 2016. Plant Tissue Trypan Blue Staining During Phytopathogen Infection. Fernandez-Bautista, N., L. Fernandez-Calvino, A. Munoz, and M.M. Castellano. 2017. HOP3, a
member of the HOP family in Arabidopsis, interacts with BiP and plays a major role in the ER stress response. Plant Cell Environ.
Feys, B., C.E. Benedetti, C.N. Penfold, and J.G. Turner. 1994. Arabidopsis Mutants Selected for Resistance to the Phytotoxin Coronatine Are Male Sterile, Insensitive to Methyl Jasmonate, and Resistant to a Bacterial Pathogen. The Plant cell. 6:751-759.
Filichkin, S.A., H.D. Priest, S.A. Givan, R. Shen, D.W. Bryant, S.E. Fox, W.K. Wong, and T.C. Mockler. 2010. Genome-wide mapping of alternative splicing in Arabidopsis thaliana. Genome Res. 20:45-58.
139
Flom, G., R.H. Behal, L. Rosen, D.G. Cole, and J.L. Johnson. 2007. Definition of the minimal fragments of Sti1 required for dimerization, interaction with Hsp70 and Hsp90 and in vivo functions. The Biochemical journal. 404:159-167.
Fonseca, S., A. Chini, M. Hamberg, B. Adie, A. Porzel, R. Kramell, O. Miersch, C. Wasternack, and R. Solano. 2009. (+)-7-iso-Jasmonoyl-L-isoleucine is the endogenous bioactive jasmonate. Nature chemical biology. 5:344-350.
Fragkostefanakis, S., A. Mesihovic, Y. Hu, and E. Schleiff. 2016. Unfolded protein response in pollen development and heat stress tolerance. Plant reproduction:81-91.
Freeman, B.C., D.O. Toft, and R.I. Morimoto. 1996. Molecular chaperone machines: chaperone activities of the cyclophilin Cyp-40 and the steroid aporeceptor-associated protein p23. Science. 274:1718-1720.
Frydman, J. 2001. Folding of newly translated proteins in vivo: the role of molecular chaperones. Annual review of biochemistry. 70:603-647.
Fujita, M., S. Mizukado, Y. Fujita, T. Ichikawa, M. Nakazawa, M. Seki, M. Matsui, K. Yamaguchi-Shinozaki, and K. Shinozaki. 2007. Identification of stress-tolerance-related transcription-factor genes via mini-scale Full-length cDNA Over-eXpressor (FOX) gene hunting system. Biochemical and biophysical research communications. 364:250-257.
Gallie, D.R. 2015. Ethylene receptors in plants - why so much complexity? F1000prime reports. 7:39.
Gani, A.R., J.K. Uppala, and K.V. Ramaiah. 2015. Tauroursodeoxycholic acid prevents stress induced aggregation of proteins in vitro and promotes PERK activation in HepG2 cells. Archives of biochemistry and biophysics. 568:8-15.
Gao, H., F. Brandizzi, C. Benning, and R.M. Larkin. 2008. A membrane-tethered transcription factor defines a branch of the heat stress response in Arabidopsis thaliana. Proceedings of the National Academy of Sciences of the United States of America. 105:16398-16403.
Gebauer, M., R. Melki, and U. Gehring. 1998. The chaperone cofactor Hop/p60 interacts with the cytosolic chaperonin-containing TCP-1 and affects its nucleotide exchange and protein folding activities. The Journal of biological chemistry. 273:29475-29480.
Gething, M.J., and J. Sambrook. 1992. Protein folding in the cell. Nature. 355:33-45. Gidalevitz, T., F. Stevens, and Y. Argon. 2013. Orchestration of secretory protein folding by ER
chaperones. Biochimica et biophysica acta. 1833:2410-2424. Glazebrook, J. 2001. Genes controlling expression of defense responses in Arabidopsis--2001
status. Current opinion in plant biology. 4:301-308. Glazebrook, J. 2005. Contrasting mechanisms of defense against biotrophic and necrotrophic
pathogens. Annual review of phytopathology. 43:205-227. Grigorova, B., I. Vaseva, K. Demirevska, and U. Feller. 2011. Combined drought and heat stress
in wheat: changes in some heat shock proteins. Biologia Plantarum. 55:105-111. Gupta, D., and N. Tuteja. 2011. Chaperones and foldases in endoplasmic reticulum stress
signaling in plants. Plant signaling & behavior. 6:232-236. Gupta, R.S., and G.B. Golding. 1993. Evolution of HSP70 gene and its implications regarding
relationships between archaebacteria, eubacteria, and eukaryotes. Journal of molecular evolution. 37:573-582.
Guy, C.L., and Q.B. Li. 1998. The organization and evolution of the spinach stress 70 molecular chaperone gene family. The Plant cell. 10:539-556.
Hahn, A., D. Bublak, E. Schleiff, and K.D. Scharf. 2011. Crosstalk between Hsp90 and Hsp70 chaperones and heat stress transcription factors in tomato. The Plant cell. 23:741-755.
Hammond, C., I. Braakman, and A. Helenius. 1994. Role of N-linked oligosaccharide recognition, glucose trimming, and calnexin in glycoprotein folding and quality control. Proceedings of the National Academy of Sciences of the United States of America. 91:913-917.
140
Harding, H.P., Y. Zhang, and D. Ron. 1999. Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature. 397:271-274.
Hartl, F.U. 1996. Molecular chaperones in cellular protein folding. Nature. 381:571-579. Hartl, F.U., A. Bracher, and M. Hayer-Hartl. 2011. Molecular chaperones in protein folding and
proteostasis. Nature. 475:324-332. Hartl, F.U., and J. Martin. 1995. Molecular chaperones in cellular protein folding. Current
opinion in structural biology. 5:92-102. Hendershot, L.M. 2004. The ER function BiP is a master regulator of ER function. The Mount
Sinai journal of medicine, New York. 71:289-297. Hernandez, M.P., W.P. Sullivan, and D.O. Toft. 2002. The assembly and intermolecular
properties of the hsp70-Hop-hsp90 molecular chaperone complex. The Journal of biological chemistry. 277:38294-38304.
Hofmann, N.R. 2009. The plasma membrane as first responder to heat stress. The Plant cell. 21:2544.
Hohfeld, J., Y. Minami, and F.U. Hartl. 1995. Hip, a novel cochaperone involved in the eukaryotic Hsc70/Hsp40 reaction cycle. Cell. 83:589-598.
Hombach, A., G. Ommen, M. Chrobak, and J. Clos. 2013. The Hsp90-Sti1 interaction is critical for Leishmania donovani proliferation in both life cycle stages. Cellular microbiology. 15:585-600.
Hong, S.W., U. Lee, and E. Vierling. 2003. Arabidopsis hot mutants define multiple functions required for acclimation to high temperatures. Plant physiology. 132:757-767.
Honore, B., H. Leffers, P. Madsen, H.H. Rasmussen, J. Vandekerckhove, and J.E. Celis. 1992. Molecular cloning and expression of a transformation-sensitive human protein containing the TPR motif and sharing identity to the stress-inducible yeast protein STI1. The Journal of biological chemistry. 267:8485-8491.
Hou, S., X. Wang, D. Chen, X. Yang, M. Wang, D. Turra, A. Di Pietro, and W. Zhang. 2014. The secreted peptide PIP1 amplifies immunity through receptor-like kinase 7. PLoS pathogens. 10:e1004331.
Houck, S.A., S. Singh, and D.M. Cyr. 2012. Cellular responses to misfolded proteins and protein aggregates. Methods Mol Biol. 832:455-461.
Howell, S.H. 2013. Endoplasmic reticulum stress responses in plants. Annual review of plant biology. 64:477-499.
Huang, L., A.E. Franklin, and N.E. Hoffman. 1993. Primary structure and characterization of an Arabidopsis thaliana calnexin-like protein. The Journal of biological chemistry. 268:6560-6566.
Hubert, D.A., P. Tornero, Y. Belkhadir, P. Krishna, A. Takahashi, K. Shirasu, and J.L. Dangl. 2003. Cytosolic HSP90 associates with and modulates the Arabidopsis RPM1 disease resistance protein. EMBO J. 22:5679-5689.
Huckelhoven, R., and R. Panstruga. 2011. Cell biology of the plant-powdery mildew interaction. Current opinion in plant biology. 14:738-746.
Ikeda, M., N. Mitsuda, and M. Ohme-Takagi. 2011. Arabidopsis HsfB1 and HsfB2b act as repressors of the expression of heat-inducible Hsfs but positively regulate the acquired thermotolerance. Plant physiology. 157:1243-1254.
Iwata, Y., M. Ashida, C. Hasegawa, K. Tabara, K.I. Mishiba, and N. Koizumi. 2017. Activation of the Arabidopsis membrane-bound transcription factor bZIP28 is mediated by site-2 protease, but not site-1 protease. The Plant journal : for cell and molecular biology.
Iwata, Y., N.V. Fedoroff, and N. Koizumi. 2008. Arabidopsis bZIP60 is a proteolysis-activated transcription factor involved in the endoplasmic reticulum stress response. The Plant cell. 20:3107-3121.
141
Iwata, Y., and N. Koizumi. 2005. An Arabidopsis transcription factor, AtbZIP60, regulates the endoplasmic reticulum stress response in a manner unique to plants. Proceedings of the National Academy of Sciences of the United States of America. 102:5280-5285.
Iwata, Y., T. Nishino, S. Takayama, and N. Koizumi. 2010. Characterization of a plant-specific gene induced by endoplasmic reticulum stress in Arabidopsis thaliana. Bioscience, biotechnology, and biochemistry. 74:2087-2091.
Jefferson, R.A., T.A. Kavanagh, and M.W. Bevan. 1987. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6:3901-3907.
Jelenska, J., J.A. van Hal, and J.T. Greenberg. 2010. Pseudomonas syringae hijacks plant stress chaperone machinery for virulence. Proceedings of the National Academy of Sciences of the United States of America. 107:13177-13182.
Jia, X.Y., C.Y. Xu, R.L. Jing, R.Z. Li, X.G. Mao, J.P. Wang, and X.P. Chang. 2008. Molecular cloning and characterization of wheat calreticulin (CRT) gene involved in drought-stressed responses. J Exp Bot. 59:739-751.
Jiang, C.J., M. Shimono, S. Sugano, M. Kojima, K. Yazawa, R. Yoshida, H. Inoue, N. Hayashi, H. Sakakibara, and H. Takatsuji. 2010. Abscisic acid interacts antagonistically with salicylic acid signaling pathway in rice-Magnaporthe grisea interaction. Molecular plant-microbe interactions : MPMI. 23:791-798.
Johansen, L.K., and J.C. Carrington. 2001. Silencing on the spot. Induction and suppression of RNA silencing in the Agrobacterium-mediated transient expression system. Plant physiology. 126:930-938.
Johnson, J.L., T.G. Beito, C.J. Krco, and D.O. Toft. 1994. Characterization of a novel 23-kilodalton protein of unactive progesterone receptor complexes. Molecular and cellular biology. 14:1956-1963.
Jones, J.D., and J.L. Dangl. 2006. The plant immune system. Nature. 444:323-329. Jungkunz, I., K. Link, F. Vogel, L.M. Voll, S. Sonnewald, and U. Sonnewald. 2011. AtHsp70-15-
deficient Arabidopsis plants are characterized by reduced growth, a constitutive cytosolic protein response and enhanced resistance to TuMV. The Plant journal : for cell and molecular biology. 66:983-995.
Kabani, M., S.S. Kelley, M.W. Morrow, D.L. Montgomery, R. Sivendran, M.D. Rose, L.M. Gierasch, and J.L. Brodsky. 2003. Dependence of endoplasmic reticulum-associated degradation on the peptide binding domain and concentration of BiP. Mol Biol Cell. 14:3437-3448.
Kaganovich, D., R. Kopito, and J. Frydman. 2008. Misfolded proteins partition between two distinct quality control compartments. Nature. 454:1088-1095.
Kamauchi, S., H. Nakatani, C. Nakano, and R. Urade. 2005. Gene expression in response to endoplasmic reticulum stress in Arabidopsis thaliana. The FEBS journal. 272:3461-3476.
Kang, Y., S. Khan, and X. Ma. 2009. Climate change impacts on crop yield, crop water productivity and food security–A review. Progress in Natural Science. 19:1665-1674.
Kanzaki, H., H. Saitoh, A. Ito, S. Fujisawa, S. Kamoun, S. Katou, H. Yoshioka, and R. Terauchi. 2003. Cytosolic HSP90 and HSP70 are essential components of INF1-mediated hypersensitive response and non-host resistance to Pseudomonas cichorii in Nicotiana benthamiana. Molecular plant pathology. 4:383-391.
Katsir, L., H.S. Chung, A.J. Koo, and G.A. Howe. 2008. Jasmonate signaling: a conserved mechanism of hormone sensing. Current opinion in plant biology. 11:428-435.
Keenan, R.J., D.M. Freymann, R.M. Stroud, and P. Walter. 2001. The signal recognition particle. Annual review of biochemistry. 70:755-775.
Kidd, B.N., C.I. Edgar, K.K. Kumar, E.A. Aitken, P.M. Schenk, J.M. Manners, and K. Kazan. 2009. The mediator complex subunit PFT1 is a key regulator of jasmonate-dependent defense in Arabidopsis. The Plant cell. 21:2237-2252.
142
Kim, B.H., and F. Schöffl. 2002. Interaction between Arabidopsis heat shock transcription factor 1 and 70 kDa heat shock proteins. Journal of Experimental Botany. 53:371-375.
Kim, D., G. Pertea, C. Trapnell, H. Pimentel, R. Kelley, and S.L. Salzberg. 2013a. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 14:R36.
Kim, Y.E., M.S. Hipp, A. Bracher, M. Hayer-Hartl, and F.U. Hartl. 2013b. Molecular chaperone functions in protein folding and proteostasis. Annual review of biochemistry. 82:323-355.
Koizumi, N., I.M. Martinez, Y. Kimata, K. Kohno, H. Sano, and M.J. Chrispeels. 2001. Molecular characterization of two Arabidopsis Ire1 homologs, endoplasmic reticulum-located transmembrane protein kinases. Plant physiology. 127:949-962.
Koizumi, S., K. Suzuki, and S. Yamaguchi. 2013. Heavy metal response of the heat shock protein 70 gene is mediated by duplicated heat shock elements and heat shock factor 1. Gene. 522:184-191.
Korner, C.J., X. Du, M.E. Vollmer, and K.M. Pajerowska-Mukhtar. 2015. Endoplasmic Reticulum Stress Signaling in Plant Immunity--At the Crossroad of Life and Death. International journal of molecular sciences. 16:26582-26598.
Krishna, P., and G. Gloor. 2001. The Hsp90 family of proteins in Arabidopsis thaliana. Cell Stress Chaperones. 6:238-246.
Krishna, P., and K.C. Kanelakis. 2003. The 70-kDa protein bound to hsp90 in wheat germ lysate is a plant homologue of animal Hop. Physiologia Plantarum. 119:456-462.
Kurek, I., T.K. Chang, S.M. Bertain, A. Madrigal, L. Liu, M.W. Lassner, and G. Zhu. 2007. Enhanced Thermostability of Arabidopsis Rubisco activase improves photosynthesis and growth rates under moderate heat stress. Plant Cell. 19:3230-3241.
Lamb, J.R., S. Tugendreich, and P. Hieter. 1995. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci. 20:257-259.
Larkindale, J., J.D. Hall, M.R. Knight, and E. Vierling. 2005. Heat stress phenotypes of Arabidopsis mutants implicate multiple signaling pathways in the acquisition of thermotolerance. Plant physiology. 138:882-897.
Larkindale, J., and E. Vierling. 2008. Core genome responses involved in acclimation to high temperature. Plant physiology. 146:748-761.
Lassle, M., G.L. Blatch, V. Kundra, T. Takatori, and B.R. Zetter. 1997. Stress-inducible, murine protein mSTI1. Characterization of binding domains for heat shock proteins and in vitro phosphorylation by different kinases. J Biol Chem. 272:1876-1884.
Lee, J.H., A. Hubel, and F. Schoffl. 1995. Derepression of the activity of genetically engineered heat shock factor causes constitutive synthesis of heat shock proteins and increased thermotolerance in transgenic Arabidopsis. Plant J. 8:603-612.
Li, H., A.V. Korennykh, S.L. Behrman, and P. Walter. 2010. Mammalian endoplasmic reticulum stress sensor IRE1 signals by dynamic clustering. Proceedings of the National Academy of Sciences of the United States of America. 107:16113-16118.
Li, J., J. Soroka, and J. Buchner. 2012. The Hsp90 chaperone machinery: conformational dynamics and regulation by co-chaperones. Biochim Biophys Acta. 1823:624-635.
Li, Q.B., D.W. Haskell, and C.L. Guy. 1999. Coordinate and non-coordinate expression of the stress 70 family and other molecular chaperones at high and low temperature in spinach and tomato. Plant Mol Biol. 39:21-34.
Li, W., M. Ma, Y. Feng, H. Li, Y. Wang, Y. Ma, M. Li, F. An, and H. Guo. 2015. EIN2-directed translational regulation of ethylene signaling in Arabidopsis. Cell. 163:670-683.
Li, X. 2011. Histostaining for Tissue Expression Pattern of Promoter-driven GUS Activity in Arabidopsis. Bio-protocol Bio101: e93. .
143
Lin, B.L., J.S. Wang, H.C. Liu, R.W. Chen, Y. Meyer, A. Barakat, and M. Delseny. 2001. Genomic analysis of the Hsp70 superfamily in Arabidopsis thaliana. Cell Stress Chaperones. 6:201-208.
Liu, H.C., and Y.Y. Charng. 2013. Common and distinct functions of Arabidopsis class A1 and A2 heat shock factors in diverse abiotic stress responses and development. Plant physiology. 163:276-290.
Liu, H.C., H.T. Liao, and Y.Y. Charng. 2011. The role of class A1 heat shock factors (HSFA1s) in response to heat and other stresses in Arabidopsis. Plant Cell Environ. 34:738-751.
Liu, J.X., and S.H. Howell. 2010a. bZIP28 and NF-Y transcription factors are activated by ER stress and assemble into a transcriptional complex to regulate stress response genes in Arabidopsis. The Plant cell. 22:782-796.
Liu, J.X., and S.H. Howell. 2010b. Endoplasmic reticulum protein quality control and its relationship to environmental stress responses in plants. Plant Cell. 22:2930-2942.
Liu, J.X., and S.H. Howell. 2016. Managing the protein folding demands in the endoplasmic reticulum of plants. New Phytol. 211:418-428.
Liu, J.X., R. Srivastava, P. Che, and S.H. Howell. 2007a. An endoplasmic reticulum stress response in Arabidopsis is mediated by proteolytic processing and nuclear relocation of a membrane-associated transcription factor, bZIP28. The Plant cell. 19:4111-4119.
Liu, J.X., R. Srivastava, P. Che, and S.H. Howell. 2007b. Salt stress responses in Arabidopsis utilize a signal transduction pathway related to endoplasmic reticulum stress signaling. The Plant journal : for cell and molecular biology. 51:897-909.
Liu, J.X., R. Srivastava, P. Che, and S.H. Howell. 2008. Salt stress signaling in Arabidopsis thaliana involves a membrane-bound transcription factor AtbZIP17 as a signal transducer. Plant signaling & behavior. 3:56-57.
Liu, Y., T. Burch-Smith, M. Schiff, S. Feng, and S.P. Dinesh-Kumar. 2004. Molecular chaperone Hsp90 associates with resistance protein N and its signaling proteins SGT1 and Rar1 to modulate an innate immune response in plants. The Journal of biological chemistry. 279:2101-2108.
Lo, T., N. Koulena, D. Seto, D.S. Guttman, and D. Desveaux. 2017. The HopF family of Pseudomonas syringae type III secreted effectors. Molecular plant pathology. 18:457-468.
Loake, G., and M. Grant. 2007. Salicylic acid in plant defence--the players and protagonists. Current opinion in plant biology. 10:466-472.
Lopes, M.H., G.N. Hajj, A.G. Muras, G.L. Mancini, R.M. Castro, K.C. Ribeiro, R.R. Brentani, R. Linden, and V.R. Martins. 2005. Interaction of cellular prion and stress-inducible protein 1 promotes neuritogenesis and neuroprotection by distinct signaling pathways. The Journal of neuroscience : the official journal of the Society for Neuroscience. 25:11330-11339.
Luo, H.B., L. Ma, H.F. Xi, W. Duan, S.H. Li, W. Loescher, J.F. Wang, and L.J. Wang. 2011. Photosynthetic responses to heat treatments at different temperatures and following recovery in grapevine (Vitis amurensis L.) leaves. PLoS One. 6:e23033.
M Suginoa, T.H., Y Tanakab, N Niia, T Takabec, T Takabe. 1999. Overexpression of DnaK from a halotolerant cyanobacterium Aphanothece halophytica acquires resistance to salt stress in transgenic tobacco plants. Plant science. 146.
Malinovsky, F.G., J.U. Fangel, and W.G. Willats. 2014. The role of the cell wall in plant immunity. Front Plant Sci. 5:178.
Mansfield, J., S. Genin, S. Magori, V. Citovsky, M. Sriariyanum, P. Ronald, M. Dow, V. Verdier, S.V. Beer, M.A. Machado, I. Toth, G. Salmond, and G.D. Foster. 2012. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular plant pathology. 13:614-629.
144
Martinez, I.M., and M.J. Chrispeels. 2003. Genomic analysis of the unfolded protein response in Arabidopsis shows its connection to important cellular processes. The Plant cell. 15:561-576.
Matlack, K.E., B. Misselwitz, K. Plath, and T.A. Rapoport. 1999. BiP acts as a molecular ratchet during posttranslational transport of prepro-alpha factor across the ER membrane. Cell. 97:553-564.
Matsumoto, K., M. Minami, F. Shinozaki, Y. Suzuki, K. Abe, S. Zenno, S. Matsumoto, and Y. Minami. Hsp90 is involved in the formation of P-bodies and stress granules. Biochemical and biophysical research communications. 407:720-724.
Mayer, M.P., and B. Bukau. 2005. Hsp70 chaperones: cellular functions and molecular mechanism. Cellular and molecular life sciences : CMLS. 62:670-684.
McClellan, A.J., Y. Xia, A.M. Deutschbauer, R.W. Davis, M. Gerstein, and J. Frydman. 2007. Diverse cellular functions of the Hsp90 molecular chaperone uncovered using systems approaches. Cell. 131:121-135.
Meiri, D., and A. Breiman. 2009. Arabidopsis ROF1 (FKBP62) modulates thermotolerance by interacting with HSP90.1 and affecting the accumulation of HsfA2-regulated sHSPs. The Plant journal : for cell and molecular biology. 59:387-399.
Meiri, D., K. Tazat, R. Cohen-Peer, O. Farchi-Pisanty, K. Aviezer-Hagai, A. Avni, and A. Breiman. 2010. Involvement of Arabidopsis ROF2 (FKBP65) in thermotolerance. Plant Mol Biol. 72:191-203.
Mengiste, T. 2012. Plant immunity to necrotrophs. Annual review of phytopathology. 50:267-294.
Merret, R., J. Descombin, Y.T. Juan, J.J. Favory, M.C. Carpentier, C. Chaparro, Y.Y. Charng, J.M. Deragon, and C. Bousquet-Antonelli. 2013. XRN4 and LARP1 are required for a heat-triggered mRNA decay pathway involved in plant acclimation and survival during thermal stress. Cell Rep. 5:1279-1293.
Meunier, L., Y.K. Usherwood, K.T. Chung, and L.M. Hendershot. 2002. A subset of chaperones and folding enzymes form multiprotein complexes in endoplasmic reticulum to bind nascent proteins. Mol Biol Cell. 13:4456-4469.
Michalak, M., J. Groenendyk, E. Szabo, L.I. Gold, and M. Opas. 2009. Calreticulin, a multi-process calcium-buffering chaperone of the endoplasmic reticulum. The Biochemical journal. 417:651-666.
Michielse, C.B., and M. Rep. 2009. Pathogen profile update: Fusarium oxysporum. Molecular plant pathology. 10:311-324.
Mishiba, K., Y. Nagashima, E. Suzuki, N. Hayashi, Y. Ogata, Y. Shimada, and N. Koizumi. 2013. Defects in IRE1 enhance cell death and fail to degrade mRNAs encoding secretory pathway proteins in the Arabidopsis unfolded protein response. Proceedings of the National Academy of Sciences of the United States of America. 110:5713-5718.
Mishra, S.K., J. Tripp, S. Winkelhaus, B. Tschiersch, K. Theres, L. Nover, and K.D. Scharf. 2002. In the complex family of heat stress transcription factors, HsfA1 has a unique role as master regulator of thermotolerance in tomato. Genes Dev. 16:1555-1567.
Moreno, A.A., M.S. Mukhtar, F. Blanco, J.L. Boatwright, I. Moreno, M.R. Jordan, Y. Chen, F. Brandizzi, X. Dong, A. Orellana, and K.M. Pajerowska-Mukhtar. 2012. IRE1/bZIP60-mediated unfolded protein response plays distinct roles in plant immunity and abiotic stress responses. PLoS One. 7:e31944.
Moreno, A.A., and A. Orellana. 2011. The physiological role of the unfolded protein response in plants. Biological research. 44:75-80.
Mori, K., W. Ma, M.J. Gething, and J. Sambrook. 1993. A transmembrane protein with a cdc2+/CDC28-related kinase activity is required for signaling from the ER to the nucleus. Cell. 74:743-756.
145
Morimoto, R.I. 2011. The heat shock response: systems biology of proteotoxic stress in aging and disease. Cold Spring Harbor symposia on quantitative biology. 76:91-99.
Muchowski, P.J. 2002. Protein misfolding, amyloid formation, and neurodegeneration: a critical role for molecular chaperones? Neuron. 35:9-12.
Nagashima, Y., Y. Iwata, M. Ashida, K. Mishiba, and N. Koizumi. 2014. Exogenous salicylic acid activates two signaling arms of the unfolded protein response in Arabidopsis. Plant Cell Physiol. 55:1772-1778.
Nagashima, Y., K. Mishiba, E. Suzuki, Y. Shimada, Y. Iwata, and N. Koizumi. 2011. Arabidopsis IRE1 catalyses unconventional splicing of bZIP60 mRNA to produce the active transcription factor. Scientific reports. 1:29.
Nakagawa, T., T. Kurose, T. Hino, K. Tanaka, M. Kawamukai, Y. Niwa, K. Toyooka, K. Matsuoka, T. Jinbo, and T. Kimura. 2007a. Development of series of gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transformation. Journal of bioscience and bioengineering. 104:34-41.
Nakagawa, T., T. Suzuki, S. Murata, S. Nakamura, T. Hino, K. Maeo, R. Tabata, T. Kawai, K. Tanaka, Y. Niwa, Y. Watanabe, K. Nakamura, T. Kimura, and S. Ishiguro. 2007b. Improved Gateway binary vectors: high-performance vectors for creation of fusion constructs in transgenic analysis of plants. Bioscience, biotechnology, and biochemistry. 71:2095-2100.
Nakajima, Y., and S. Suzuki. 2013. Environmental stresses induce misfolded protein aggregation in plant cells in a microtubule-dependent manner. International journal of molecular sciences. 14:7771-7783.
Nakashima, A., L. Chen, N.P. Thao, M. Fujiwara, H.L. Wong, M. Kuwano, K. Umemura, K. Shirasu, T. Kawasaki, and K. Shimamoto. 2008. RACK1 functions in rice innate immunity by interacting with the Rac1 immune complex. The Plant cell. 20:2265-2279.
Nawrot, R., J. Barylski, G. Nowicki, J. Broniarczyk, W. Buchwald, and A. Gozdzicka-Jozefiak. 2014. Plant antimicrobial peptides. Folia microbiologica. 59:181-196.
Nekrasov, V., J. Li, M. Batoux, M. Roux, Z.H. Chu, S. Lacombe, A. Rougon, P. Bittel, M. Kiss-Papp, D. Chinchilla, H.P. van Esse, L. Jorda, B. Schwessinger, V. Nicaise, B.P. Thomma, A. Molina, J.D. Jones, and C. Zipfel. 2009. Control of the pattern-recognition receptor EFR by an ER protein complex in plant immunity. EMBO J. 28:3428-3438.
Newman, M.A., T. Sundelin, J.T. Nielsen, and G. Erbs. 2013. MAMP (microbe-associated molecular pattern) triggered immunity in plants. Front Plant Sci. 4:139.
Nicolet, C.M., and E.A. Craig. 1989. Isolation and characterization of STI1, a stress-inducible gene from Saccharomyces cerevisiae. Mol Cell Biol. 9:3638-3646.
Nishikawa, S., J.L. Brodsky, and K. Nakatsukasa. 2005. Roles of molecular chaperones in endoplasmic reticulum (ER) quality control and ER-associated degradation (ERAD). Journal of biochemistry. 137:551-555.
Nishizawa-Yokoi, A., R. Nosaka, H. Hayashi, H. Tainaka, T. Maruta, M. Tamoi, M. Ikeda, M. Ohme-Takagi, K. Yoshimura, Y. Yabuta, and S. Shigeoka. 2011. HsfA1d and HsfA1e involved in the transcriptional regulation of HsfA2 function as key regulators for the Hsf signaling network in response to environmental stress. Plant Cell Physiol. 52:933-945.
Nishizawa, A., Y. Yabuta, E. Yoshida, T. Maruta, K. Yoshimura, and S. Shigeoka. 2006. Arabidopsis heat shock transcription factor A2 as a key regulator in response to several types of environmental stress. Plant J. 48:535-547.
Noel, L.D., G. Cagna, J. Stuttmann, L. Wirthmuller, S. Betsuyaku, C.P. Witte, R. Bhat, N. Pochon, T. Colby, and J.E. Parker. 2007. Interaction between SGT1 and cytosolic/nuclear HSC70 chaperones regulates Arabidopsis immune responses. The Plant cell. 19:4061-4076.
146
Noh, S.J., C.S. Kwon, D.H. Oh, J.S. Moon, and W.I. Chung. 2003. Expression of an evolutionarily distinct novel BiP gene during the unfolded protein response in Arabidopsis thaliana. Gene. 311:81-91.
Nover, L., K. Bharti, P. Doring, S.K. Mishra, A. Ganguli, and K.D. Scharf. 2001. Arabidopsis and the heat stress transcription factor world: how many heat stress transcription factors do we need? Cell Stress Chaperones. 6:177-189.
Odunuga, O.O., J.A. Hornby, C. Bies, R. Zimmermann, D.J. Pugh, and G.L. Blatch. 2003. Tetratricopeptide repeat motif-mediated Hsc70-mSTI1 interaction. Molecular characterization of the critical contacts for successful binding and specificity. J Biol Chem. 278:6896-6904.
Odunuga, O.O., V.M. Longshaw, and G.L. Blatch. 2004. Hop: more than an Hsp70/Hsp90 adaptor protein. Bioessays. 26:1058-1068.
Ogawa, D., K. Yamaguchi, and T. Nishiuchi. 2007. High-level overexpression of the Arabidopsis HsfA2 gene confers not only increased themotolerance but also salt/osmotic stress tolerance and enhanced callus growth. J Exp Bot. 58:3373-3383.
Osbourn, A.E. 1996. Preformed Antimicrobial Compounds and Plant Defense against Fungal Attack. The Plant cell. 8:1821-1831.
Ozcan, U., E. Yilmaz, L. Ozcan, M. Furuhashi, E. Vaillancourt, R.O. Smith, C.Z. Gorgun, and G.S. Hotamisligil. 2006. Chemical chaperones reduce ER stress and restore glucose homeostasis in a mouse model of type 2 diabetes. Science. 313:1137-1140.
Pare, J.M., N. Tahbaz, J. Lopez-Orozco, P. LaPointe, P. Lasko, and T.C. Hobman. 2009. Hsp90 regulates the function of argonaute 2 and its recruitment to stress granules and P-bodies. Mol Biol Cell. 20:3273-3284.
Park, C.J., R. Bart, M. Chern, P.E. Canlas, W. Bai, and P.C. Ronald. 2010. Overexpression of the endoplasmic reticulum chaperone BiP3 regulates XA21-mediated innate immunity in rice. PLoS One. 5:e9262.
Pearl, L.H., and C. Prodromou. 2006. Structure and mechanism of the Hsp90 molecular chaperone machinery. Annual review of biochemistry. 75:271-294.
Pelham, H.R. 1982. A regulatory upstream promoter element in the Drosophila hsp 70 heat-shock gene. Cell. 30:517-528.
Picard, D. 2002. Heat-shock protein 90, a chaperone for folding and regulation. Cellular and molecular life sciences : CMLS. 59:1640-1648.
Pieterse, C.M., A. Leon-Reyes, S. Van der Ent, and S.C. Van Wees. 2009. Networking by small-molecule hormones in plant immunity. Nature chemical biology. 5:308-316.
Pietro, A.D., M.P. Madrid, Z. Caracuel, J. Delgado-Jarana, and M.I. Roncero. 2003. Fusarium oxysporum: exploring the molecular arsenal of a vascular wilt fungus. Molecular plant pathology. 4:315-325.
Plemper, R.K., S. Bohmler, J. Bordallo, T. Sommer, and D.H. Wolf. 1997. Mutant analysis links the translocon and BiP to retrograde protein transport for ER degradation. Nature. 388:891-895.
Prasad, B.D., S. Goel, and P. Krishna. 2010. In silico identification of carboxylate clamp type tetratricopeptide repeat proteins in Arabidopsis and rice as putative co-chaperones of Hsp90/Hsp70. PLoS One. 5:e12761.
Pratt, W.B. 1993. The role of heat shock proteins in regulating the function, folding, and trafficking of the glucocorticoid receptor. J Biol Chem. 268:21455-21458.
Pratt, W.B., and D.O. Toft. 1997. Steroid receptor interactions with heat shock protein and immunophilin chaperones. Endocrine reviews. 18:306-360.
Pratt, W.B., and D.O. Toft. 2003. Regulation of signaling protein function and trafficking by the hsp90/hsp70-based chaperone machinery. Experimental biology and medicine. 228:111-133.
Prodromou, C. 2012. The 'active life' of Hsp90 complexes. Biochim Biophys Acta. 1823:614-623.
147
Prodromou, C., G. Siligardi, R. O'Brien, D.N. Woolfson, L. Regan, B. Panaretou, J.E. Ladbury, P.W. Piper, and L.H. Pearl. 1999. Regulation of Hsp90 ATPase activity by tetratricopeptide repeat (TPR)-domain co-chaperones. EMBO J. 18:754-762.
Qiu, X.B., Y.M. Shao, S. Miao, and L. Wang. 2006. The diversity of the DnaJ/Hsp40 family, the crucial partners for Hsp70 chaperones. Cellular and molecular life sciences : CMLS. 63:2560-2570.
Reis, P.A., G.L. Rosado, L.A. Silva, L.C. Oliveira, L.B. Oliveira, M.D. Costa, F.C. Alvim, and E.P. Fontes. 2011. The binding protein BiP attenuates stress-induced cell death in soybean via modulation of the N-rich protein-mediated signaling pathway. Plant Physiol. 157:1853-1865.
Ristic, Z., I. Momcilovic, U. Bukovnik, P.V. Prasad, J. Fu, B.P. Deridder, T.E. Elthon, and N. Mladenov. 2009. Rubisco activase and wheat productivity under heat-stress conditions. J Exp Bot. 60:4003-4014.
Ruberti, C., and F. Brandizzi. 2014. Conserved and plant-unique strategies for overcoming endoplasmic reticulum stress. Front Plant Sci. 5:69.
Ruberti, C., S.J. Kim, G. Stefano, and F. Brandizzi. 2015. Unfolded protein response in plants: one master, many questions. Current opinion in plant biology. 27:59-66.
Saijo, Y. 2010. ER quality control of immune receptors and regulators in plants. Cellular microbiology. 12:716-724.
Saijo, Y., N. Tintor, X. Lu, P. Rauf, K. Pajerowska-Mukhtar, H. Haweker, X. Dong, S. Robatzek, and P. Schulze-Lefert. 2009. Receptor quality control in the endoplasmic reticulum for plant innate immunity. EMBO J. 28:3439-3449.
Sakuma, Y., K. Maruyama, F. Qin, Y. Osakabe, K. Shinozaki, and K. Yamaguchi-Shinozaki. 2006. Dual function of an Arabidopsis transcription factor DREB2A in water-stress-responsive and heat-stress-responsive gene expression. Proceedings of the National Academy of Sciences of the United States of America. 103:18822-18827.
Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold spring harbor laboratory press.
Schaller, G.E. 2017. Localization of the Ethylene-Receptor Signaling Complex to the Endoplasmic Reticulum: Analysis by Two-Phase Partitioning and Density-Gradient Centrifugation. Methods Mol Biol. 1573:113-131.
Scharf, K.D., T. Berberich, I. Ebersberger, and L. Nover. 2012. The plant heat stress transcription factor (Hsf) family: structure, function and evolution. Biochimica et biophysica acta. 1819:104-119.
Scheufler, C., A. Brinker, G. Bourenkov, S. Pegoraro, L. Moroder, H. Bartunik, F.U. Hartl, and I. Moarefi. 2000. Structure of TPR domain-peptide complexes: critical elements in the assembly of the Hsp70-Hsp90 multichaperone machine. Cell. 101:199-210.
Schramm, F., A. Ganguli, E. Kiehlmann, G. Englich, D. Walch, and P. von Koskull-Doring. 2006. The heat stress transcription factor HsfA2 serves as a regulatory amplifier of a subset of genes in the heat stress response in Arabidopsis. Plant Mol Biol. 60:759-772.
Schwessinger, B., and C. Zipfel. 2008. News from the frontline: recent insights into PAMP-triggered immunity in plants. Current opinion in plant biology. 11:389-395.
Seo, H.S., J.T. Song, J.J. Cheong, Y.H. Lee, Y.W. Lee, I. Hwang, J.S. Lee, and Y.D. Choi. 2001. Jasmonic acid carboxyl methyltransferase: a key enzyme for jasmonate-regulated plant responses. Proceedings of the National Academy of Sciences of the United States of America. 98:4788-4793.
Sheard, L.B., X. Tan, H. Mao, J. Withers, G. Ben-Nissan, T.R. Hinds, Y. Kobayashi, F.F. Hsu, M. Sharon, J. Browse, S.Y. He, J. Rizo, G.A. Howe, and N. Zheng. 2010. Jasmonate perception by inositol-phosphate-potentiated COI1-JAZ co-receptor. Nature. 468:400-405.
148
Shiau, A.K., S.F. Harris, D.R. Southworth, and D.A. Agard. 2006. Structural Analysis of E. coli hsp90 reveals dramatic nucleotide-dependent conformational rearrangements. Cell. 127:329-340.
Song, H., R. Zhao, P. Fan, X. Wang, X. Chen, and Y. Li. 2009a. Overexpression of AtHsp90.2, AtHsp90.5 and AtHsp90.7 in Arabidopsis thaliana enhances plant sensitivity to salt and drought stresses. Planta. 229:955-964.
Song, H.O., W. Lee, K. An, H.S. Lee, J.H. Cho, Z.Y. Park, and J. Ahnn. 2009b. C. elegans STI-1, the homolog of Sti1/Hop, is involved in aging and stress response. Journal of molecular biology. 390:604-617.
Song, S., J.J. Liang, M.L. Mulhern, C.J. Madson, and T. Shinohara. 2011. Cholesterol-derived bile acids enhance the chaperone activity of alpha-crystallins. Cell Stress Chaperones. 16:475-480.
Song, Y., and D.C. Masison. 2005. Independent regulation of Hsp70 and Hsp90 chaperones by Hsp70/Hsp90-organizing protein Sti1 (Hop1). The Journal of biological chemistry. 280:34178-34185.
Sontag, E.M., W.I. Vonk, and J. Frydman. 2014. Sorting out the trash: the spatial nature of eukaryotic protein quality control. Current opinion in cell biology. 26:139-146.
Sorger, P.K. 1991. Heat shock factor and the heat shock response. Cell. 65:363-366. Souret, F.F., J.P. Kastenmayer, and P.J. Green. 2004. AtXRN4 degrades mRNA in Arabidopsis
and its substrates include selected miRNA targets. Molecular cell. 15:173-183. Srivastava, R., Y. Chen, Y. Deng, F. Brandizzi, and S.H. Howell. 2012. Elements proximal to and
within the transmembrane domain mediate the organelle-to-organelle movement of bZIP28 under ER stress conditions. The Plant journal : for cell and molecular biology. 70:1033-1042.
Srivastava, R., Y. Deng, and S.H. Howell. 2014. Stress sensing in plants by an ER stress sensor/transducer, bZIP28. Front Plant Sci. 5:59.
Srivastava, R., Y. Deng, S. Shah, A.G. Rao, and S.H. Howell. 2013. BINDING PROTEIN is a master regulator of the endoplasmic reticulum stress sensor/transducer bZIP28 in Arabidopsis. Plant Cell. 25:1416-1429.
Staswick, P.E. 1992. Jasmonate, genes, and fragrant signals. Plant physiology. 99:804-807. Staswick, P.E., G.Y. Yuen, and C.C. Lehman. 1998. Jasmonate signaling mutants of Arabidopsis
are susceptible to the soil fungus Pythium irregulare. The Plant journal : for cell and molecular biology. 15:747-754.
Steel, G.J., D.M. Fullerton, J.R. Tyson, and C.J. Stirling. 2004. Coordinated activation of Hsp70 chaperones. Science. 303:98-101.
Stone, P. 2001. The effects of heat stress on cereal yield and quality
In Crop Responses and Adaptations to Temperature Stress. A.S. Basra, editor. 243-291. Sung, D.Y., and C.L. Guy. 2003. Physiological and molecular assessment of altered expression of
Hsc70-1 in Arabidopsis. Evidence for pleiotropic consequences. Plant physiology. 132:979-987.
Sung, D.Y., E. Vierling, and C.L. Guy. 2001. Comprehensive expression profile analysis of the Arabidopsis Hsp70 gene family. Plant physiology. 126:789-800.
Takahashi, A., C. Casais, K. Ichimura, and K. Shirasu. 2003. HSP90 interacts with RAR1 and SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America. 100:11777-11782.
Tam, J.P., S. Wang, K.H. Wong, and W.L. Tan. 2015. Antimicrobial Peptides from Plants. Pharmaceuticals. 8:711-757.
Tanaka, K., C.T. Nguyen, Y. Liang, Y. Cao, and G. Stacey. 2013. Role of LysM receptors in chitin-triggered plant innate immunity. Plant signaling & behavior. 8:e22598.
149
Thatcher, L.F., V. Cevik, M. Grant, B. Zhai, J.D. Jones, J.M. Manners, and K. Kazan. 2016. Characterization of a JAZ7 activation-tagged Arabidopsis mutant with increased susceptibility to the fungal pathogen Fusarium oxysporum. J Exp Bot. 67:2367-2386.
Thatcher, L.F., J.M. Manners, and K. Kazan. 2009. Fusarium oxysporum hijacks COI1-mediated jasmonate signaling to promote disease development in Arabidopsis. The Plant journal : for cell and molecular biology. 58:927-939.
Thines, B., L. Katsir, M. Melotto, Y. Niu, A. Mandaokar, G. Liu, K. Nomura, S.Y. He, G.A. Howe, and J. Browse. 2007. JAZ repressor proteins are targets of the SCF(COI1) complex during jasmonate signalling. Nature. 448:661-665.
Thomas, C.L., E.M. Bayer, C. Ritzenthaler, L. Fernandez-Calvino, and A.J. Maule. 2008. Specific targeting of a plasmodesmal protein affecting cell-to-cell communication. PLoS Biol. 6:e7.
Tintor, N., and Y. Saijo. 2014. ER-mediated control for abundance, quality, and signaling of transmembrane immune receptors in plants. Front Plant Sci. 5:65.
Trinklein, N.D., J.I. Murray, S.J. Hartman, D. Botstein, and R.M. Myers. 2004. The role of heat shock transcription factor 1 in the genome-wide regulation of the mammalian heat shock response. Mol Biol Cell. 15:1254-1261.
Urade, R. 2007. Cellular response to unfolded proteins in the endoplasmic reticulum of plants. FEBS J. 274:1152-1171.
Valente, M.A., J.A. Faria, J.R. Soares-Ramos, P.A. Reis, G.L. Pinheiro, N.D. Piovesan, A.T. Morais, C.C. Menezes, M.A. Cano, L.G. Fietto, M.E. Loureiro, F.J. Aragao, and E.P. Fontes. 2009. The ER luminal binding protein (BiP) mediates an increase in drought tolerance in soybean and delays drought-induced leaf senescence in soybean and tobacco. J Exp Bot. 60:533-546.
Van Der Spuy, J., B.D. Kana, H.W. Dirr, and G.L. Blatch. 2000. Heat shock cognate protein 70 chaperone-binding site in the co-chaperone murine stress-inducible protein 1 maps to within three consecutive tetratricopeptide repeat motifs. The Biochemical journal. 345 645-651.
van Loon, L.C., B.P. Geraats, and H.J. Linthorst. 2006. Ethylene as a modulator of disease resistance in plants. Trends in plant science. 11:184-191.
VanEtten, H.D., J.W. Mansfield, J.A. Bailey, and E.E. Farmer. 1994. Two Classes of Plant Antibiotics: Phytoalexins versus "Phytoanticipins". The Plant cell. 6:1191-1192.
Vierling, E. 1991. Heat shock proteins in plants. Annual Review of Plant Physiology and Plant Molecular Biology 42:579-620.
Vitale, A., and R.S. Boston. 2008. Endoplasmic reticulum quality control and the unfolded protein response: insights from plants. Traffic. 9:1581-1588.
Vitale, A., and J. Denecke. 1999. The endoplasmic reticulum-gateway of the secretory pathway. The Plant cell. 11:615-628.
Voeltz, G.K., M.M. Rolls, and T.A. Rapoport. 2002. Structural organization of the endoplasmic reticulum. EMBO reports. 3:944-950.
Wahid, A., S. Gelani, M. Ashraf, and M.R. Foolad. 2007. Heat tolerance in plants: An overview. Environmental and Experimental Botany. 61:199-223.
Wan, J., K. Tanaka, X.C. Zhang, G.H. Son, L. Brechenmacher, T.H. Nguyen, and G. Stacey. 2012. LYK4, a lysin motif receptor-like kinase, is important for chitin signaling and plant innate immunity in Arabidopsis. Plant physiology. 160:396-406.
Wang, D., N.D. Weaver, M. Kesarwani, and X. Dong. 2005. Induction of protein secretory pathway is required for systemic acquired resistance. Science. 308:1036-1040.
Wang, M., Q. Xu, J. Yu, and M. Yuan. 2010. The putative Arabidopsis zinc transporter ZTP29 is involved in the response to salt stress. Plant Mol Biol. 73:467-479.
Wang, M., Q. Xu, and M. Yuan. 2011. The unfolded protein response induced by salt stress in Arabidopsis. Methods in enzymology. 489:319-328.
150
Wang, P., C. Hawes, and P.J. Hussey. 2017a. Plant Endoplasmic Reticulum-Plasma Membrane Contact Sites. Trends in plant science. 22:289-297.
Wang, W., B. Vinocur, and A. Altman. 2003. Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance. Planta. 218:1-14.
Wang, X., R. Guo, M. Tu, D. Wang, C. Guo, R. Wan, Z. Li, and X. Wang. 2017b. Ectopic Expression of the Wild Grape WRKY Transcription Factor VqWRKY52 in Arabidopsis thaliana Enhances Resistance to the Biotrophic Pathogen Powdery Mildew But Not to the Necrotrophic Pathogen Botrytis cinerea. Front Plant Sci. 8:97.
Wang, X.Z., H.P. Harding, Y. Zhang, E.M. Jolicoeur, M. Kuroda, and D. Ron. 1998. Cloning of mammalian Ire1 reveals diversity in the ER stress responses. EMBO J. 17:5708-5717.
Ware, F.E., A. Vassilakos, P.A. Peterson, M.R. Jackson, M.A. Lehrman, and D.B. Williams. 1995. The molecular chaperone calnexin binds Glc1Man9GlcNAc2 oligosaccharide as an initial step in recognizing unfolded glycoproteins. The Journal of biological chemistry. 270:4697-4704.
Wasternack, C., and B. Hause. 2013. Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Annals of botany. 111:1021-1058.
Watanabe, N., and E. Lam. 2008. BAX inhibitor-1 modulates endoplasmic reticulum stress-mediated programmed cell death in Arabidopsis. The Journal of biological chemistry. 283:3200-3210.
Webb, J.R., A. Campos-Neto, Y.A. Skeiky, and S.G. Reed. 1997. Molecular characterization of the heat-inducible LmSTI1 protein of Leishmania major. Molecular and biochemical parasitology. 89:179-193.
Webb, M.A., J.M. Cavaletto, P. Klanrit, and G.A. Thompson. 2001. Orthologs in Arabidopsis thaliana of the Hsp70 interacting protein Hip. Cell Stress Chaperones. 6:247-255.
Weber, C., L. Nover, and M. Fauth. 2008. Plant stress granules and mRNA processing bodies are distinct from heat stress granules. The Plant journal : for cell and molecular biology. 56:517-530.
Wegele, H., L. Muller, and J. Buchner. 2004. Hsp70 and Hsp90--a relay team for protein folding. Reviews of physiology, biochemistry and pharmacology. 151:1-44.
Weis, E., and J.A. Berry. 1988. Plants and high temperature stress. Symposia of the Society for Experimental Biology. 42:329-346.
Whalen, M.C., R.W. Innes, A.F. Bent, and B.J. Staskawicz. 1991. Identification of Pseudomonas syringae pathogens of Arabidopsis and a bacterial locus determining avirulence on both Arabidopsis and soybean. The Plant cell. 3:49-59.
Wheeler, T.R., P.Q. Craufurd, H.E. Ellis, P.J. R., and P.V.V. Prasad. 2000. Temperature variability and the yield of annual crops. Agriculture, Ecosystems and Environment 82:159-167.
Williams, B., M. Kabbage, R. Britt, and M.B. Dickman. 2010. AtBAG7, an Arabidopsis Bcl-2-associated athanogene, resides in the endoplasmic reticulum and is involved in the unfolded protein response. Proceedings of the National Academy of Sciences of the United States of America. 107:6088-6093.
Williams, B., J. Verchot, and M.B. Dickman. 2014. When supply does not meet demand-ER stress and plant programmed cell death. Front Plant Sci. 5:211.
Willmer, T., L. Contu, G.L. Blatch, and A.L. Edkins. 2012. Knockdown of Hop downregulates RhoC expression, and decreases pseudopodia formation and migration in cancer cell lines. Cancer Lett. 328:252-260.
Wimmer, B., F. Lottspeich, I. van der Klei, M. Veenhuis, and C. Gietl. 1997. The glyoxysomal and plastid molecular chaperones (70-kDa heat shock protein) of watermelon cotyledons are encoded by a single gene. Proceedings of the National Academy of Sciences of the United States of America. 94:13624-13629.
151
Wittstock, U., and J. Gershenzon. 2002. Constitutive plant toxins and their role in defense against herbivores and pathogens. Current opinion in plant biology. 5:300-307.
Wójcik, M., and A. Tukiendorf. 2011. Glutathione in adaptation of Arabidopsis thaliana to cadmium stress. Biologia Plantarum. 55:125-132.
Wu, C. 1995. Heat shock transcription factors: structure and regulation. Annual review of cell and developmental biology. 11:441-469.
Xie, Q., V.I. Khaoustov, C.C. Chung, J. Sohn, B. Krishnan, D.E. Lewis, and B. Yoffe. 2002. Effect of tauroursodeoxycholic acid on endoplasmic reticulum stress-induced caspase-12 activation. Hepatology. 36:592-601.
Xin, X.F., and S.Y. He. 2013. Pseudomonas syringae pv. tomato DC3000: a model pathogen for probing disease susceptibility and hormone signaling in plants. Annual review of phytopathology. 51:473-498.
Xu, G., S. Li, K. Xie, Q. Zhang, Y. Wang, Y. Tang, D. Liu, Y. Hong, C. He, and Y. Liu. 2012a. Plant ERD2-like proteins function as endoplasmic reticulum luminal protein receptors and participate in programmed cell death during innate immunity. The Plant journal : for cell and molecular biology. 72:57-69.
Xu, K., J.Y. Lin, and P.D. Nagy. 2014. The hop-like stress-induced protein 1 cochaperone is a novel cell-intrinsic restriction factor for mitochondrial tombusvirus replication. Journal of virology. 88:9361-9378.
Xu, W., M. Mollapour, C. Prodromou, S. Wang, B.T. Scroggins, Z. Palchick, K. Beebe, M. Siderius, M.J. Lee, A. Couvillon, J.B. Trepel, Y. Miyata, R. Matts, and L. Neckers. 2012b. Dynamic tyrosine phosphorylation modulates cycling of the HSP90-P50(CDC37)-AHA1 chaperone machine. Molecular cell. 47:434-443.
Yamada, K., Y. Fukao, M. Hayashi, M. Fukazawa, I. Suzuki, and M. Nishimura. 2007. Cytosolic HSP90 regulates the heat shock response that is responsible for heat acclimation in Arabidopsis thaliana. The Journal of biological chemistry. 282:37794-37804.
Yamada, K., and M. Nishimura. 2008. Cytosolic heat shock protein 90 regulates heat shock transcription factor in Arabidopsis thaliana. Plant signaling & behavior. 3:660-662.
Yan, J., J. Wang, Q. Li, J.R. Hwang, C. Patterson, and H. Zhang. 2003. AtCHIP, a U-box-containing E3 ubiquitin ligase, plays a critical role in temperature stress tolerance in Arabidopsis. Plant physiology. 132:861-869.
Yan, J., C. Zhang, M. Gu, Z. Bai, W. Zhang, T. Qi, Z. Cheng, W. Peng, H. Luo, F. Nan, Z. Wang, and D. Xie. 2009. The Arabidopsis CORONATINE INSENSITIVE1 protein is a jasmonate receptor. The Plant cell. 21:2220-2236.
Yanguez, E., A.B. Castro-Sanz, N. Fernandez-Bautista, J.C. Oliveros, and M.M. Castellano. 2013. Analysis of genome-wide changes in the translatome of Arabidopsis seedlings subjected to heat stress. PLoS One. 8:e71425.
Ye, C., M.B. Dickman, S.A. Whitham, M. Payton, and J. Verchot. 2011. The unfolded protein response is triggered by a plant viral movement protein. Plant physiology. 156:741-755.
Yoshida, T., N. Ohama, J. Nakajima, S. Kidokoro, J. Mizoi, K. Nakashima, K. Maruyama, J.M. Kim, M. Seki, D. Todaka, Y. Osakabe, Y. Sakuma, F. Schoffl, K. Shinozaki, and K. Yamaguchi-Shinozaki. 2011. Arabidopsis HsfA1 transcription factors function as the main positive regulators in heat shock-responsive gene expression. Molecular genetics and genomics : MGG. 286:321-332.
Yoshida, T., Y. Sakuma, D. Todaka, K. Maruyama, F. Qin, J. Mizoi, S. Kidokoro, Y. Fujita, K. Shinozaki, and K. Yamaguchi-Shinozaki. 2008. Functional analysis of an Arabidopsis heat-shock transcription factor HsfA3 in the transcriptional cascade downstream of the DREB2A stress-regulatory system. Biochemical and biophysical research communications. 368:515-521.
152
Young-Su Seo, S.-K.L., Min-Young Song, Jung-Pil Suh, Tae-Ryong Hahn, Pamela Ronald, Jong-Seong Jeon. 2008. The HSP90-SGT1-RAR1 molecular chaperone complex: A core modulator in plant immunity. Journal of Plant Biology. 51:10.
Zanata, S.M., M.H. Lopes, A.F. Mercadante, G.N. Hajj, L.B. Chiarini, R. Nomizo, A.R. Freitas, A.L. Cabral, K.S. Lee, M.A. Juliano, E. de Oliveira, S.G. Jachieri, A. Burlingame, L. Huang, R. Linden, R.R. Brentani, and V.R. Martins. 2002. Stress-inducible protein 1 is a cell surface ligand for cellular prion that triggers neuroprotection. EMBO J. 21:3307-3316.
Zhang, M., Y. Kadota, C. Prodromou, K. Shirasu, and L.H. Pearl. 2010a. Structural basis for assembly of Hsp90-Sgt1-CHORD protein complexes: implications for chaperoning of NLR innate immunity receptors. Molecular cell. 39:269-281.
Zhang, X.C., Y.A. Millet, Z. Cheng, J. Bush, and F.M. Ausubel. 2015. Jasmonate signalling in Arabidopsis involves SGT1b-HSP70-HSP90 chaperone complexes. Nature plants. 1.
Zhang, Z., M.K. Quick, K.C. Kanelakis, M. Gijzen, and P. Krishna. 2003. Characterization of a plant homolog of hop, a cochaperone of hsp90. Plant physiology. 131:525-535.
Zhang, Z., W. Sullivan, S.J. Felts, B.D. Prasad, D.O. Toft, and P. Krishna. 2010b. Characterization of plant p23-like proteins for their co-chaperone activities. Cell Stress Chaperones. 15:703-715.
Zhao, R., M. Davey, Y.C. Hsu, P. Kaplanek, A. Tong, A.B. Parsons, N. Krogan, G. Cagney, D. Mai, J. Greenblatt, C. Boone, A. Emili, and W.A. Houry. 2005. Navigating the chaperone network: an integrative map of physical and genetic interactions mediated by the hsp90 chaperone. Cell. 120:715-727.
Zheng, Y., and Z. Zhu. 2016. Relaying the Ethylene Signal: New Roles for EIN2. Trends in plant science. 21:2-4.
Zhu, J.K. 2016. Abiotic Stress Signaling and Responses in Plants. Cell. 167:313-324. Zipfel, C. 2008. Pattern-recognition receptors in plant innate immunity. Current opinion in
immunology. 20:10-16. Zipfel, C. 2014. Plant pattern-recognition receptors. Trends in immunology. 35:345-351. Zou, J., Y. Guo, T. Guettouche, D.F. Smith, and R. Voellmy. 1998. Repression of heat shock
transcription factor HSF1 activation by HSP90 (HSP90 complex) that forms a stress-sensitive complex with HSF1. Cell. 94:471-480.