微生物遺傳與生物技術微生物遺傳與生物技術 (M(Microbial Genetics and Biicrobial Genetics and Biotechnology)otechnology)

金門大學 食品科學系金門大學 食品科學系

何國傑 教授何國傑 教授

Autonomously replicating Autonomously replicating genetic entities genetic entities (1) the plasmid and bacterial (1) the plasmid and bacterial conjugationconjugation

I. What is a plasmid?I. What is a plasmid?1. In addition to chromosome, bacteria cells often contain other 1. In addition to chromosome, bacteria cells often contain other DNA molecules called plasmids. It is an extrachromosomal DNA molecules called plasmids. It is an extrachromosomal DNA which can replicate independent of chromosome.DNA which can replicate independent of chromosome.2. Naming plasmid2. Naming plasmid (1) previously plasmids are named by the gene function they (1) previously plasmids are named by the gene function they carry, for example, R-factor plasmids contain genes for carry, for example, R-factor plasmids contain genes for resistance to several antibiotics.resistance to several antibiotics. (2) The naming of plasmids is now standardized: A small ‘p’ for (2) The naming of plasmids is now standardized: A small ‘p’ for plasmid, precedes letters that describe the plasmid or plasmid, precedes letters that describe the plasmid or sometimes give the initials of the person or persons who sometimes give the initials of the person or persons who isolated or constructed it. These letters are often followed isolated or constructed it. These letters are often followed by numbers to identify the particular construct. by numbers to identify the particular construct. For example, pBR322 was constructed by Bolivar and For example, pBR322 was constructed by Bolivar and Rodriguez, and 322 of the plasmid they constructed.Rodriguez, and 322 of the plasmid they constructed.3. Functions encoded by plasmids3. Functions encoded by plasmids (1) Unlike chromosomes, plasmids generally do not encode (1) Unlike chromosomes, plasmids generally do not encode functions essential to bacterial growth. Instead, plasmid functions essential to bacterial growth. Instead, plasmid genes usually give bacteria a selective advantage under genes usually give bacteria a selective advantage under only some condition.only some condition.

I. What is a plasmid?I. What is a plasmid?

(2) Why many nonessential functions are encoded on plasmid (2) Why many nonessential functions are encoded on plasmid and not on chromosome?and not on chromosome?4. Plasmid structure4. Plasmid structure (1) Most plasmids are circular with no free ends, although a few (1) Most plasmids are circular with no free ends, although a few known plasmids are linear.known plasmids are linear. (2) Plasmid DNA can be supercoiled because it is a covalently (2) Plasmid DNA can be supercoiled because it is a covalently closed circular, and are usually negatively supercoiledclosed circular, and are usually negatively supercoiled (3) The negative supercoiling introduces stress and this stress (3) The negative supercoiling introduces stress and this stress is partially relieved by the plasmid wrapping up on itself. In is partially relieved by the plasmid wrapping up on itself. In the cell, the DNA wraps around proteins, which relieves the cell, the DNA wraps around proteins, which relieves some of the stress. The remaining stress facilitates some some of the stress. The remaining stress facilitates some reactions involving the plasmid, such as separation of the reactions involving the plasmid, such as separation of the two DNA strands for replication or transcription. two DNA strands for replication or transcription. 5. Properties of plasmids5. Properties of plasmids (1) replication – A plasimid is a replicon that can replicate (1) replication – A plasimid is a replicon that can replicate autonomously in the cell. Plasmid encodes only a few of autonomously in the cell. Plasmid encodes only a few of the proteins required for their own replication.the proteins required for their own replication.

Supercoiling of a covalently closed circSupercoiling of a covalently closed circular plasmidular plasmid

Less EtBr can bind to a covalently closed Less EtBr can bind to a covalently closed circular DNA than to a linear or nicked circircular DNA than to a linear or nicked circular DNAcular DNA

Separation ofSeparation of covalently closed circular plcovalently closed circular plasmid DNA from linear or nicked circular asmid DNA from linear or nicked circular DNAs on EtBr-CsCl gradientDNAs on EtBr-CsCl gradient

I. What is a plasmid?I. What is a plasmid?2. Each type of plasmid replicates by one of two general 2. Each type of plasmid replicates by one of two general mechanisms:mechanisms: i. Theta (θ) replication – In this process, two strands of DNA i. Theta (θ) replication – In this process, two strands of DNA are opened at are opened at oriori and an RNA primer begins replication, and an RNA primer begins replication, which can proceed in one or both direction(s).which can proceed in one or both direction(s). ii. Rolling-circle replication:ii. Rolling-circle replication: (i) A Rep protein recognizes and binds to a palindromic (i) A Rep protein recognizes and binds to a palindromic sequence which contains the double-strand origin (DSO) sequence which contains the double-strand origin (DSO) on the DNA.on the DNA. (ii) Rep protein mightallow the formation of a cruciform (ii) Rep protein mightallow the formation of a cruciform structure by base pairing between the inverted repeated structure by base pairing between the inverted repeated sequences.sequences. (iii) Rep protein makes a nick and remains covalently (iii) Rep protein makes a nick and remains covalently attached to the phosphate at 5’ end of DNA through a attached to the phosphate at 5’ end of DNA through a tyrosine in one copy of the dimmer Rep.tyrosine in one copy of the dimmer Rep. (iv) The DNA polymerase III uses the free 3’ OH end at the (iv) The DNA polymerase III uses the free 3’ OH end at the break as a primer to replicate around the circle, break as a primer to replicate around the circle, displacing one of the strand. displacing one of the strand.

Uni- and bi- directional replicationUni- and bi- directional replication

A. Unidirectional replication: Replication terminates when the replication fork gets back to the origin.B. Bidirectional replication: Replication terminates when the replication forks meet somewhere on the DNA molecule opposite the origin.

Rolling-circle replicationRolling-circle replication

Rolling-circle replicationRolling-circle replication1. A nick is made at the double-stranded origin (DSO) by plasmid- encoded Rep protein, which remains bound to the 5’ phosphate e

nd.2. The free 3’ end serves as a primer for Pol III that replicate around the circle, displacing one of the old strands as a single-stranded DNA.3. Rep make another nick, releasing the single-stranded circle, and also joins the ends of new DNA to form a circle by phosphotransferase reaction.4. The DNA ligase joins the ends of the new DNA to form a double- stranded circle.5. The host RNA polymerase makes a primer on the single-strande

d DNA origin (SSO), and Pol III replicates the single-stranded (SS) DNA to make another double-stranded circle.6. DNA pol I removes nthe primer, replacing it with DNA, and ligase joins the ends to make another double-stranded DNA7. CCC DNA: covalently closed circular; SSB: single-stranded-DNA- binding protein

(3) Replication of linear plasmids(3) Replication of linear plasmids

i. Linear DNA replication faces a problem with replicating the i. Linear DNA replication faces a problem with replicating the lagging strand. There is no upstream primer on this strand lagging strand. There is no upstream primer on this strand from which to grow. Different linear DNAs solve the primer from which to grow. Different linear DNAs solve the primer problem in different ways.problem in different ways. ii. Some linear plasmids have hairpin ends, which means that ii. Some linear plasmids have hairpin ends, which means that the 3’ end is attached to the 5’ end on the other antiparallel the 3’ end is attached to the 5’ end on the other antiparallel strand. The plasmid replicates from an internal origin of strand. The plasmid replicates from an internal origin of replication to form dimeric circles, composed of two replication to form dimeric circles, composed of two plasmids joined head to tail to form a circle. These dimeric plasmids joined head to tail to form a circle. These dimeric circles are then resolved into individual linear plasmid DNA circles are then resolved into individual linear plasmid DNA by prototelomerases.by prototelomerases. iii. Some linear plasmids have extensive inverted repeated iii. Some linear plasmids have extensive inverted repeated sequences at their ends and a terminal protein attached to sequences at their ends and a terminal protein attached to the 5’ ends. They might use some sort of slippage the 5’ ends. They might use some sort of slippage mechanism, using the terminal protein as either a mechanism, using the terminal protein as either a recombinase or a primer or both.recombinase or a primer or both.

(4) Functions of the (4) Functions of the oriori region region In most plasmids, the genes for proteins required for replication In most plasmids, the genes for proteins required for replication are located very close to the are located very close to the ori ori sequences at which they act. Thesequences at which they act. The genes in the genes in the ori ori region often determine many other properties of region often determine many other properties of the plasmid. Therefore any DNA molecule with the the plasmid. Therefore any DNA molecule with the ori ori region of a region of a particular plasmid will have most of the characteristics of that particular plasmid will have most of the characteristics of that plasmid, such asplasmid, such as i. Host range – Some plasmids, such as those withi. Host range – Some plasmids, such as those with ori ori regions regions of ColE1 plasmid type have a narrow host range. Other of ColE1 plasmid type have a narrow host range. Other plasmids have a broad host range. These plasmids of broad plasmids have a broad host range. These plasmids of broad host range must encode all of their own proteins required for host range must encode all of their own proteins required for initiation of replication and so do not have to depend on the initiation of replication and so do not have to depend on the host cell for any of these functions.host cell for any of these functions. ii. Copy number – Plasmids that have high copy numbers, ii. Copy number – Plasmids that have high copy numbers, called relaxed plasmids, such as ColE1 plasmids need only called relaxed plasmids, such as ColE1 plasmids need only have a mechanism that inhibits the initiation of plasmid have a mechanism that inhibits the initiation of plasmid replication when the number of the plasmids in the cell replication when the number of the plasmids in the cell reaches a certain level. Low-copy-number plasmids, called reaches a certain level. Low-copy-number plasmids, called stringent plasmids, such as F plasmids must have a tighter stringent plasmids, such as F plasmids must have a tighter mechanism for regulating their replication.mechanism for regulating their replication.

IncompatibilityIncompatibility

iii. Incompatibility – refers to the ability of two plasmids to iii. Incompatibility – refers to the ability of two plasmids to coexist stably in the same cell. If two plasmids can not coexist stably in the same cell. If two plasmids can not coexist stably, they are said to be members of the same coexist stably, they are said to be members of the same incompatibility (Inc) group. If they can coexist stably, they incompatibility (Inc) group. If they can coexist stably, they belong to different Inc groups. belong to different Inc groups. iv. There are a number of ways in which plasmids can be iv. There are a number of ways in which plasmids can be incompatible:incompatible: (i) Due to shared replication control – Each plasmid regulate (i) Due to shared replication control – Each plasmid regulate the other’s replication.the other’s replication. (ii) Due to partitioning – Two plasmids share the same Par (ii) Due to partitioning – Two plasmids share the same Par (partition) system. (partition) system.

Coexistence of two plasmids from Coexistence of two plasmids from different Inc groupsdifferent Inc groups

B. Curing of cells of one of two plasmids when they are members of the same Inc group. The sum of the two plasmids will equal the copy number, but one may be underrepresented and lost in the subsequent divisions. Eventually, most of the cells will contain only one or the other plasmid.

A. Coexistence of two plasmids of different Inc

groups. After division, both plasmids will replicate to reach their copy number.

(5) Control mechanisms of plasmid (5) Control mechanisms of plasmid replication replication

(5) (using ColE1-derive plasmid as an example)(5) (using ColE1-derive plasmid as an example) i. Replication is regulated mostly through a small plasmid-i. Replication is regulated mostly through a small plasmid- encoded RNA I which interferes with the processing of RNA IIencoded RNA I which interferes with the processing of RNA II ii. RNA II is cleaved by the RNA endonuclease RNase H, ii. RNA II is cleaved by the RNA endonuclease RNase H, releasing a 3’ hydroxyl group that serves as the primer for releasing a 3’ hydroxyl group that serves as the primer for replication first catalyzed by DNA polymerase I.replication first catalyzed by DNA polymerase I. iii. RNA I can form a double-stranded RNA with RNA II because iii. RNA I can form a double-stranded RNA with RNA II because they are transcribed from opposite strands in the same region they are transcribed from opposite strands in the same region of DNA. Initially, the pairing between RNA I and II occurs of DNA. Initially, the pairing between RNA I and II occurs through short exposed regions on the two RNAs that are not through short exposed regions on the two RNAs that are not occluded by being part of secondary structure. occluded by being part of secondary structure. This initial pairing is very weak and has been called “kissing This initial pairing is very weak and has been called “kissing complex”. Rop protein (sometimescomplex”. Rop protein (sometimes called Rom) is known to help the formation of called Rom) is known to help the formation of kissing complex. kissing complex. Mutations that inactivate Rop cause only a moderate increaseMutations that inactivate Rop cause only a moderate increase in plasmid copy number.in plasmid copy number.

Control mechanisms of plasmid Control mechanisms of plasmid replication replication

iv. Formation of the double-stranded RNA prevents the iv. Formation of the double-stranded RNA prevents the RNA II from forming the secondary structure RNA II from forming the secondary structure required for it to hybridize to the DNA before being required for it to hybridize to the DNA before being processed by RNase H to form the mature primer.processed by RNase H to form the mature primer. v. RNA I is synthesized from the plasmid, more RNA I v. RNA I is synthesized from the plasmid, more RNA I is made when the concentration of the plasmid is is made when the concentration of the plasmid is high (up to 16 copies) and will interfere with high (up to 16 copies) and will interfere with processing of most of the RNA II. This mechanism processing of most of the RNA II. This mechanism provides an explanation for how the copy number provides an explanation for how the copy number of ColE1 plasmids is maintained.of ColE1 plasmids is maintained. vi. A single-base-pair mutation in the RNA I coding vi. A single-base-pair mutation in the RNA I coding region of plasmid will effectively change the Inc region of plasmid will effectively change the Inc group of plasmid to form a new Inc group. group of plasmid to form a new Inc group.

Control mechanisms of plasmid Control mechanisms of plasmid replicationreplication

vii. The ColE1-derived plasmids are unusual in that vii. The ColE1-derived plasmids are unusual in that they do not required the plasmid encoded protein, they do not required the plasmid encoded protein, Rep to initiate DNA replication at their Rep to initiate DNA replication at their oriVoriV region, region, only an RNA primer synthesized from plasmid. only an RNA primer synthesized from plasmid. The Rep protein is required to separate the DNA The Rep protein is required to separate the DNA strands of DNA at the strands of DNA at the oriVoriV region, often with the region, often with the help of host proteins including DnaA. The copy help of host proteins including DnaA. The copy number of some plasmids can be controlled, at number of some plasmids can be controlled, at least partial, by controlling the synthesis of the least partial, by controlling the synthesis of the Rep protein, such as R1 plasmid.Rep protein, such as R1 plasmid.

Pairing between an RNA and its antiPairing between an RNA and its antisense RNAsense RNA

Regulation of replication of IncFII plaRegulation of replication of IncFII plasmid R1smid R1

B. Immediately after the plasmid enters the cell, most of the repA mRNA is made from promoter PrepA until the plasmid reaches its copy number.C. Once the plasmid reaches its copy number, CopB protein represses transcription from PrepA. Now, repA is transcribed only from PcopB. C’ The antisense RNA CopA hybridizes to the leader peptide coding sequence in the repA mRNA, and the double-stranded RNA is cleaved by RNase III. This prevents translation of RepA, which is translationally coupled to translation of the leader peptide.

A. The locations of promoters and genes, and gene products involved in regulation.

Iteron plasmidsIteron plasmids

• The plasmids whose oriV region contains several repeats of a certain set of DNA bases called iteron sequence, such as pSC101, F.

The The ori ori region of pSC101, R1, R2, and R3 are the region of pSC101, R1, R2, and R3 are the three iteron sequence (CAAGGTCTAGCAGCAthree iteron sequence (CAAGGTCTAGCAGCAGAATTTACAGA for R3) to which RepA binds to GAATTTACAGA for R3) to which RepA binds to handcuff two plasmids. RepA autoregulates its handcuff two plasmids. RepA autoregulates its own synthesis by binding to the inverted repeatown synthesis by binding to the inverted repeats IR1 and IR2.s IR1 and IR2.

The “handcuffing” or “coupling” model fThe “handcuffing” or “coupling” model for regulation of interon plasmidsor regulation of interon plasmids

Left: At low concentrations of plasmids, the RepA binds to only one plasmid at a time, initiating replication.Right: At high plasmid and RepA concentrations, the RepA may dimerize and bind to two plasmids simultaneously, handcuffing them and inhibiting replication.

Molecular genetic analysis for the regulatMolecular genetic analysis for the regulation of interon plasmidsion of interon plasmids

B. Additional iteron sequences in an unrelated plasmid can cower the copy number of an iteron plasmid.

A. The RepA protein

is expressed from a

clone of the RepA

gene in an unrelated

cloning plasmid

vector.

6. Mechanism to prevent curing of 6. Mechanism to prevent curing of plasmidsplasmids

Cells that have lost a plasmid during cell division are said to be Cells that have lost a plasmid during cell division are said to be cured of the plasmid. Several mechanisms prevent curing, cured of the plasmid. Several mechanisms prevent curing, including plasmid addition systems, site-specific recombination including plasmid addition systems, site-specific recombination and partitioning systems. and partitioning systems. i. Resolution of multimeric plasmids – i. Resolution of multimeric plasmids – (i) A possibility that a cell will lose a plasmid during cell (i) A possibility that a cell will lose a plasmid during cell division is increased if the plasmids form dimmers or division is increased if the plasmids form dimmers or multimers during replication due to segregating into only multimers during replication due to segregating into only one daughter cell. because of with more than one par site. one daughter cell. because of with more than one par site. (ii) Dimers or multimers can occur as a recombination (ii) Dimers or multimers can occur as a recombination between monomers or the termination of rolling-circle between monomers or the termination of rolling-circle replication after each round of replication is not efficient.replication after each round of replication is not efficient. (iii) Multimers may replicate more efficiently than monomers, (iii) Multimers may replicate more efficiently than monomers, perhaps because they have more than one origin of perhaps because they have more than one origin of replication. replication. (iv) To avoid the problem, many plasmids have site-specific (iv) To avoid the problem, many plasmids have site-specific recombination systems that resolve multimers as soon as recombination systems that resolve multimers as soon as they form. The recombination occurs between the they form. The recombination occurs between the specific sites on the plasmid.specific sites on the plasmid.

6. Mechanism to prevent curing of6. Mechanism to prevent curing of plasmids plasmids ii. The most effective mechanism that plasmids have to avoid ii. The most effective mechanism that plasmids have to avoid being lost from dividing cells is their set of partitioning being lost from dividing cells is their set of partitioning systems. The following is the example of R 1 plasmid:systems. The following is the example of R 1 plasmid: (i) The partitioning system of R 1 plasmid consists of two (i) The partitioning system of R 1 plasmid consists of two protein-coding genes, protein-coding genes, parMparM and and parRparR , as well as a , as well as a centromere-like cis-actin site, centromere-like cis-actin site, parCparC. . (ii) Protein ParM can bind to ParR only a few dimmers of ParR (ii) Protein ParM can bind to ParR only a few dimmers of ParR protein bound to protein bound to parCparC site. The ParR- site. The ParR-parCparC complex serves complex serves as a sort of nucleation site for the assembly of ParM.as a sort of nucleation site for the assembly of ParM. (iii) While plasmid is replicating, this complex of the two ParM (iii) While plasmid is replicating, this complex of the two ParM and ParR proteins is localized to the midpoint of the cell and ParR proteins is localized to the midpoint of the cell and thereby localizes plasmid to this point. and thereby localizes plasmid to this point. (iv) When replication is completed, the ParM protein, in ParM-(iv) When replication is completed, the ParM protein, in ParM- ATP form begins to polymerize into helical filaments that ATP form begins to polymerize into helical filaments that extend from the center of the cell toward the cell pole by theextend from the center of the cell toward the cell pole by the addition of ParM subunits to the end.addition of ParM subunits to the end. (v) After the plasmid copies have been pushed to the ends, the (v) After the plasmid copies have been pushed to the ends, the ParM-ADP dissociate and the filaments disappear. ParM-ADP dissociate and the filaments disappear.

Partioning Partioning of the R1 of the R1 plasmidplasmid